Starting /dee2/code/volunteer_pipeline.sh SRR17229375 current disk space = 1548368572416 free memory = 1391441196 SRR17229375 SRAfilesize b2793a599aae87cd2a91e08c3a0900b8 SRR17229375.sra SRR17229375.sra file validated SRR17229375 is paired end SRR17229375 is conventional basespace SRR17229375 read1 length is 36-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17229375_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36-151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.8825 32.0 32.0 32.0 27.0 32.0 2 31.3725 32.0 32.0 32.0 32.0 32.0 3 32.2325 32.0 32.0 37.0 27.0 37.0 4 34.6975 37.0 32.0 37.0 32.0 37.0 5 35.67875 37.0 37.0 37.0 32.0 37.0 6 38.1385 41.0 37.0 41.0 32.0 41.0 7 38.464 41.0 37.0 41.0 32.0 41.0 8 39.67825 41.0 41.0 41.0 37.0 41.0 9 39.41025 41.0 41.0 41.0 37.0 41.0 10-14 38.62645 41.0 38.6 41.0 34.0 41.0 15-19 37.832300000000004 41.0 37.0 41.0 30.0 41.0 20-24 37.9317 41.0 37.8 41.0 32.0 41.0 25-29 37.42475 41.0 36.8 41.0 30.0 41.0 30-34 38.20375 41.0 37.8 41.0 33.0 41.0 35-39 35.03515203369548 36.4 32.8 40.2 27.0 41.0 40-44 38.846109265998464 41.0 39.4 41.0 33.0 41.0 45-49 39.229879437341026 41.0 40.2 41.0 36.0 41.0 50-54 37.624604657156816 40.2 36.6 41.0 31.0 41.0 55-59 39.26917375965455 41.0 41.0 41.0 37.0 41.0 60-64 38.984092870403025 41.0 40.2 41.0 34.0 41.0 65-69 38.69949533536858 41.0 40.2 41.0 33.0 41.0 70-74 38.98080008242984 41.0 39.4 41.0 35.0 41.0 75-79 38.545346012889254 41.0 39.4 41.0 33.0 41.0 80-84 39.100427472101416 41.0 39.4 41.0 35.0 41.0 85-89 37.67782471572148 41.0 37.6 41.0 28.0 41.0 90-94 36.46696256221081 40.2 34.8 41.0 26.0 41.0 95-99 30.19665958751137 31.8 22.0 39.4 18.0 41.0 100-104 27.983791161174725 28.0 18.0 37.8 12.0 41.0 105-109 37.308768472535185 40.2 36.0 41.0 30.0 41.0 110-114 38.43363291685548 41.0 37.8 41.0 33.0 41.0 115-119 38.69488276134877 41.0 40.2 41.0 34.0 41.0 120-124 37.90700241151861 41.0 37.0 41.0 30.0 41.0 125-129 37.243807583164994 41.0 36.8 41.0 28.0 41.0 130-134 34.81090104945902 37.4 30.0 40.2 24.0 41.0 135-139 36.47249315766541 40.2 34.0 41.0 28.0 41.0 140-144 33.0781572129667 35.8 28.0 40.2 19.0 41.0 145-149 31.752860056091748 33.8 26.0 38.4 21.0 40.2 150-151 36.11463897991918 39.0 34.5 41.0 24.5 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 2.0 26 2.0 27 3.0 28 10.0 29 30.0 30 63.0 31 95.0 32 148.0 33 224.0 34 288.0 35 388.0 36 546.0 37 626.0 38 800.0 39 641.0 40 134.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 25.924999999999997 27.85 21.15 25.074999999999996 2 24.706176544136035 32.3330832708177 20.855213803450862 22.1055263815954 3 24.275 31.374999999999996 21.475 22.875 4 26.025 29.65 21.675 22.650000000000002 5 24.175 31.0 21.675 23.150000000000002 6 24.6 30.2 21.224999999999998 23.974999999999998 7 25.974999999999998 29.549999999999997 22.15 22.325 8 27.425 29.75 22.2 20.625 9 17.875 27.750000000000004 26.700000000000003 27.675 10-14 25.415 23.695 25.665 25.224999999999998 15-19 25.155 25.83 27.169999999999998 21.845 20-24 24.725 24.884999999999998 32.375 18.015 25-29 25.19 25.885 26.974999999999998 21.95 30-34 24.965 25.685000000000002 26.284999999999997 23.064999999999998 35-39 25.100140196274783 26.607250150210294 25.931303825355496 22.361305828159423 40-44 25.533303217386937 26.37654971640817 25.262259699844403 22.82788736636049 45-49 25.405676965586537 25.551369002763124 25.973373524240138 23.069580507410198 50-54 24.74983657665812 26.137677880022125 25.659978880675823 23.452506662643938 55-59 25.187799344592893 26.26165868414419 25.888580791530124 22.661961179732796 60-64 25.612776065093247 26.32031131551018 24.753626118158387 23.31328650123819 65-69 25.04309033762547 26.295244854506745 25.337118523775725 23.32454628409206 70-74 25.2961211936353 25.646891362920034 25.79431650653246 23.262670936912205 75-79 25.4003059663437 25.905150433452317 25.191228964813874 23.503314635390108 80-84 25.884038687887006 25.715162990635076 25.489995394299164 22.910802927178754 85-89 25.75609253439126 25.957030243701375 25.106909165850894 23.17996805605647 90-94 25.031413612565444 26.36125654450262 25.722513089005233 22.8848167539267 95-99 25.98407018353919 26.734387625533877 25.331871176266883 21.949671014660048 100-104 26.008797093134444 26.92675463759801 24.69560782813795 22.3688404411296 105-109 25.10385756676558 26.12594790636334 25.512693702604682 23.2575008242664 110-114 25.09941675503712 26.656945917285256 25.05965005302227 23.183987274655355 115-119 25.40051851359436 25.407166123778502 25.034899953466727 24.157415409160407 120-124 25.828479614380395 25.841869183905736 24.958157595233313 23.371493606480552 125-129 25.857412908452602 25.87766675668377 25.243046178773966 23.02187415608966 130-134 26.139401000616818 25.371804537043385 25.591117812350078 22.89767664998972 135-139 25.378973105134474 25.958784491791825 25.344044708347884 23.31819769472581 140-144 25.986559908492996 26.265370317414927 24.39948527309122 23.348584501000857 145-149 26.41213389121339 26.63628212791393 24.566646742378957 22.384937238493723 150-151 26.514851485148515 26.495049504950497 24.237623762376238 22.752475247524753 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 2.5 11 5.5 12 7.0 13 4.0 14 2.5 15 3.5 16 2.5 17 1.5 18 2.0 19 2.5 20 2.0 21 2.0 22 2.5 23 3.0 24 3.0 25 4.0 26 4.5 27 2.5 28 2.5 29 4.5 30 5.0 31 9.5 32 17.0 33 16.5 34 26.0 35 36.0 36 38.0 37 51.0 38 74.0 39 98.5 40 120.0 41 153.0 42 196.0 43 218.0 44 233.5 45 251.0 46 234.0 47 219.0 48 190.0 49 176.5 50 192.5 51 176.0 52 155.0 53 141.0 54 127.0 55 116.0 56 108.5 57 93.5 58 79.0 59 73.0 60 62.5 61 59.5 62 57.0 63 46.5 64 47.5 65 37.5 66 19.5 67 16.5 68 17.5 69 14.0 70 9.0 71 7.5 72 5.5 73 2.5 74 3.0 75 2.5 76 1.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35-39 13.0 40-44 5.0 45-49 2.0 50-54 8.0 55-59 10.0 60-64 13.0 65-69 10.0 70-74 10.0 75-79 14.0 80-84 27.0 85-89 17.0 90-94 288.0 95-99 331.0 100-104 211.0 105-109 20.0 110-114 7.0 115-119 17.0 120-124 23.0 125-129 33.0 130-134 59.0 135-139 42.0 140-144 133.0 145-149 101.0 150-152 2606.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.34773767158109 96.72500000000001 2 1.626842907981698 3.2 3 0.02541942043721403 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138-139 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGCAGA 10 0.009177289 131.3625 7 ACCACTG 10 0.009177289 131.3625 7 TATGCTA 25 5.5413693E-8 131.3625 8 GTGTACC 30 9.931682E-10 131.3625 8 CCAGATG 10 0.009177289 131.3625 5 GATGTAC 10 0.009177289 131.3625 7 CCATGCT 10 0.009177289 131.3625 7 CCACTGG 20 3.0726842E-6 131.3625 8 GCTGTAC 10 0.009177289 131.3625 7 GCAGATC 40 0.0 131.3625 9 ATGCTAT 130 0.0 131.3625 9 CGCAGAT 10 0.009177289 131.3625 8 AGATGCT 20 3.0726842E-6 131.3625 7 CGTGTAC 10 0.009177289 131.3625 7 TCACTGG 45 0.0 131.3625 8 ATGTACC 15 1.6912764E-4 131.3625 8 CGCACTG 15 1.6912764E-4 131.3625 7 AATGCTA 30 9.931682E-10 131.3625 8 GGCAGAT 10 0.009177289 131.3625 8 CTGTACC 15 1.6912764E-4 131.3625 8 >>END_MODULE SRR17229375 read2 length is 36-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17229375_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36-151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.29125 32.0 32.0 32.0 27.0 32.0 2 30.96375 32.0 32.0 32.0 32.0 32.0 3 33.58625 37.0 32.0 37.0 32.0 37.0 4 35.285 37.0 37.0 37.0 32.0 37.0 5 33.201 37.0 32.0 37.0 22.0 37.0 6 30.8645 37.0 22.0 41.0 12.0 41.0 7 33.30775 37.0 32.0 41.0 12.0 41.0 8 29.29925 32.0 22.0 41.0 12.0 41.0 9 32.713 37.0 27.0 41.0 12.0 41.0 10-14 35.0339 39.4 31.0 41.0 24.0 41.0 15-19 32.92995 35.8 27.0 40.2 20.0 41.0 20-24 35.158699999999996 38.4 34.0 41.0 23.0 41.0 25-29 36.957550000000005 40.2 35.0 41.0 26.0 41.0 30-34 37.44925 41.0 37.0 41.0 29.0 41.0 35-39 36.695555498856685 41.0 35.0 41.0 25.0 41.0 40-44 37.22370536063479 41.0 36.0 41.0 28.0 41.0 45-49 36.238441336790025 41.0 36.0 41.0 23.0 41.0 50-54 34.14588560948373 37.4 30.0 40.2 22.0 41.0 55-59 35.651995494046965 39.4 33.0 41.0 24.0 41.0 60-64 33.70242060855099 37.4 29.0 40.2 21.0 41.0 65-69 36.30032862835447 40.2 36.0 41.0 25.0 41.0 70-74 38.11389567555157 41.0 37.0 41.0 31.0 41.0 75-79 36.72710600930729 40.2 36.0 41.0 27.0 41.0 80-84 36.464708949152694 41.0 36.0 41.0 25.0 41.0 85-89 33.33344079969798 36.6 28.0 40.2 20.0 41.0 90-94 36.197373276778066 41.0 35.0 41.0 25.0 41.0 95-99 32.04560020218675 36.0 24.0 40.2 14.0 41.0 100-104 32.884749920542546 35.0 25.0 41.0 19.0 41.0 105-109 32.4937326848475 34.8 27.0 39.4 20.0 41.0 110-114 37.582964929743966 41.0 36.0 41.0 29.0 41.0 115-119 33.541152157716525 37.0 29.0 41.0 19.0 41.0 120-124 34.349672196132325 37.0 31.0 41.0 21.0 41.0 125-129 27.926295312395617 28.0 20.0 35.8 14.0 40.2 130-134 31.13789448035514 31.0 28.0 37.4 21.0 40.2 135-139 36.16523048601117 40.2 34.0 41.0 27.0 41.0 140-144 34.69325044128432 38.6 31.0 41.0 22.0 41.0 145-149 33.99580152174755 37.8 30.0 41.0 21.0 41.0 150-151 33.00382625031014 34.5 29.5 39.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 6.0 23 9.0 24 28.0 25 50.0 26 54.0 27 104.0 28 150.0 29 160.0 30 223.0 31 278.0 32 304.0 33 334.0 34 388.0 35 422.0 36 408.0 37 403.0 38 384.0 39 247.0 40 46.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 14.85 15.775 39.15 30.225 2 25.85 12.525 26.525 35.099999999999994 3 25.45 11.05 30.325000000000003 33.175 4 24.4 10.225 34.050000000000004 31.324999999999996 5 24.45 11.200000000000001 34.575 29.775000000000002 6 26.924999999999997 14.099999999999998 33.650000000000006 25.324999999999996 7 24.5 23.400000000000002 33.050000000000004 19.05 8 20.200000000000003 24.925 34.175 20.7 9 17.925 29.775000000000002 31.75 20.549999999999997 10-14 20.72 27.295 30.275000000000002 21.709999999999997 15-19 20.79 26.375 29.765000000000004 23.07 20-24 21.825 26.55 26.985 24.64 25-29 22.075 26.064999999999998 26.424999999999997 25.435000000000002 30-34 22.485 26.235000000000003 26.334999999999997 24.945 35-39 21.70822068689296 26.344247521778314 26.609592470211275 25.337939321117453 40-44 22.14274920666902 25.658590641212914 26.731476351181183 25.467183800936887 45-49 22.819648692810457 26.70547385620915 26.281658496732025 24.193218954248366 50-54 22.71433745537331 26.915713768303412 25.65840533968024 24.711543436643037 55-59 22.00212426978226 26.330323951141793 26.436537440254916 25.23101433882103 60-64 22.917336764232875 26.46617347485794 26.4018441085022 24.21464565240699 65-69 22.165004336513444 26.34431916738942 25.731786643538594 25.758889852558543 70-74 23.05421950153039 25.25688675120245 26.273502404897247 25.41539134236992 75-79 22.772277227722775 25.81958195819582 26.331133113311335 25.077007700770075 80-84 21.987232861504303 26.233694143769082 26.00055509297807 25.778517901748543 85-89 23.024016236328787 25.155034389446385 26.78994249633555 25.03100687788928 90-94 23.208445693958346 26.163291066613116 25.124792013311147 25.50347122611739 95-99 24.82387070037298 25.741519152211232 24.54561600852525 24.88899413889053 100-104 22.983021440079316 25.133225926384927 26.39112653364729 25.49262609988846 105-109 23.613105338728626 25.420963320715313 26.112779010573036 24.85315232998303 110-114 23.399748460978355 26.365261137221157 25.431918977957242 24.80307142384325 115-119 22.905555930601498 25.275096199284413 26.544251670829677 25.275096199284413 120-124 23.077462812236877 25.645523435307325 25.638506876227897 25.638506876227897 125-129 22.875871224692997 26.759044142051113 26.269498838367078 24.095585794888816 130-134 22.94941411831952 25.3977326855292 26.664761360388685 24.9880918357626 135-139 21.965712059224625 26.52444963958699 25.686732904734072 25.823105396454316 140-144 22.613419173121414 26.264963283371895 25.59098682225128 25.53063072125541 145-149 22.35861924247193 24.35211415381387 26.82824467527017 26.461021928444023 150-151 24.311023622047244 28.313648293963254 27.49343832020997 19.88188976377953 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 1.5 8 2.0 9 1.0 10 0.5 11 0.5 12 1.0 13 1.0 14 1.5 15 1.0 16 2.0 17 2.5 18 0.5 19 0.5 20 1.5 21 1.0 22 1.5 23 3.0 24 3.0 25 5.0 26 7.5 27 9.0 28 9.5 29 11.0 30 17.5 31 25.0 32 29.0 33 31.5 34 48.0 35 69.0 36 81.0 37 98.5 38 121.5 39 130.5 40 139.0 41 173.5 42 210.5 43 221.5 44 227.0 45 215.0 46 217.5 47 227.0 48 204.5 49 185.5 50 175.5 51 159.0 52 138.5 53 125.0 54 114.0 55 104.5 56 83.5 57 69.5 58 73.5 59 71.0 60 57.5 61 52.0 62 51.0 63 43.0 64 38.0 65 38.0 66 29.0 67 16.5 68 22.0 69 27.5 70 22.5 71 17.5 72 14.0 73 13.0 74 12.5 75 11.0 76 8.5 77 5.0 78 2.5 79 3.5 80 2.5 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35-39 18.0 40-44 44.0 45-49 46.0 50-54 93.0 55-59 54.0 60-64 35.0 65-69 43.0 70-74 20.0 75-79 31.0 80-84 32.0 85-89 84.0 90-94 62.0 95-99 153.0 100-104 182.0 105-109 69.0 110-114 41.0 115-119 85.0 120-124 277.0 125-129 510.0 130-134 48.0 135-139 60.0 140-144 65.0 145-149 168.0 150-152 1780.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.5021579080985 97.0 2 1.4470677837014472 2.85 3 0.05077430820005078 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138-139 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1815421 spots for SRR17229375.sra Written 1815421 spots for SRR17229375.sra Read 1815421 spots for SRR17229375.sra Written 1815421 spots for SRR17229375.sra Read 1815421 spots for SRR17229375.sra Written 1815421 spots for SRR17229375.sra Read 1815421 spots for SRR17229375.sra Written 1815421 spots for SRR17229375.sra Read 1815421 spots for SRR17229375.sra Written 1815421 spots for SRR17229375.sra Read 1815421 spots for SRR17229375.sra Written 1815421 spots for SRR17229375.sra Read 1815421 spots for SRR17229375.sra Written 1815421 spots for SRR17229375.sra Read 1815421 spots for SRR17229375.sra Written 1815421 spots for SRR17229375.sra Read 1815421 spots for SRR17229375.sra Written 1815421 spots for SRR17229375.sra Read 1815421 spots for SRR17229375.sra Written 1815421 spots for SRR17229375.sra Read 1815421 spots for SRR17229375.sra Written 1815421 spots for SRR17229375.sra Read 1815440 spots for SRR17229375.sra Written 1815440 spots for SRR17229375.sra Read 1815421 spots for SRR17229375.sra Written 1815421 spots for SRR17229375.sra Read 1815421 spots for SRR17229375.sra Written 1815421 spots for SRR17229375.sra Read 1815421 spots for SRR17229375.sra Written 1815421 spots for SRR17229375.sra Read 1815421 spots for SRR17229375.sra Written 1815421 spots for SRR17229375.sra Read 1815421 spots for SRR17229375.sra Written 1815421 spots for SRR17229375.sra Read 1815421 spots for SRR17229375.sra Written 1815421 spots for SRR17229375.sra Read 1815421 spots for SRR17229375.sra Written 1815421 spots for SRR17229375.sra Read 1815421 spots for SRR17229375.sra Written 1815421 spots for SRR17229375.sra SRR ids: ['SRR17229375.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w29syzt4 SRR17229375.sra spots: 36308439 blocks: [[1, 1815421], [1815422, 3630842], [3630843, 5446263], [5446264, 7261684], [7261685, 9077105], [9077106, 10892526], [10892527, 12707947], [12707948, 14523368], [14523369, 16338789], [16338790, 18154210], [18154211, 19969631], [19969632, 21785052], [21785053, 23600473], [23600474, 25415894], [25415895, 27231315], [27231316, 29046736], [29046737, 30862157], [30862158, 32677578], [32677579, 34492999], [34493000, 36308439]] SRR17229375 file size 12106702 SRR17229375 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR17229375 SRR17229375_1.fastq SRR17229375_2.fastq Input file: SRR17229375_1.fastq Paired file: SRR17229375_2.fastq trimmed: SRR17229375-trimmed-pair1.fastq, SRR17229375-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 22:55:24 2024 >> started Fri Dec 6 22:56:14 2024 >> done (49.863s) 36308439 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 1 ( 0.00%) empty read pairs filtered out after trimming by size control 36308438 (100.00%) read pairs available; of these: 14847 ( 0.04%) trimmed read pairs available after processing 36293591 (99.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 426 0.00% 37 996 0.00% 38 1373 0.00% 39 1803 0.00% 40 2217 0.01% 41 2595 0.01% 42 2990 0.01% 43 3322 0.01% 44 3505 0.01% 45 3774 0.01% 46 4471 0.01% 47 4865 0.01% 48 5026 0.01% 49 5408 0.01% 50 5618 0.02% 51 5922 0.02% 52 6132 0.02% 53 6520 0.02% 54 6665 0.02% 55 6841 0.02% 56 7241 0.02% 57 7501 0.02% 58 7708 0.02% 59 8018 0.02% 60 8181 0.02% 61 8622 0.02% 62 8637 0.02% 63 9016 0.02% 64 9504 0.03% 65 9859 0.03% 66 10351 0.03% 67 10424 0.03% 68 10860 0.03% 69 11002 0.03% 70 11487 0.03% 71 11658 0.03% 72 12085 0.03% 73 12562 0.03% 74 12504 0.03% 75 12846 0.04% 76 13190 0.04% 77 13618 0.04% 78 14146 0.04% 79 14623 0.04% 80 14881 0.04% 81 15430 0.04% 82 15941 0.04% 83 16549 0.05% 84 16883 0.05% 85 17620 0.05% 86 18847 0.05% 87 19493 0.05% 88 20713 0.06% 89 21573 0.06% 90 21927 0.06% 91 22896 0.06% 92 25135 0.07% 93 96694 0.27% 94 147532 0.41% 95 149151 0.41% 96 143100 0.39% 97 137781 0.38% 98 133568 0.37% 99 126042 0.35% 100 123656 0.34% 101 125726 0.35% 102 126220 0.35% 103 127335 0.35% 104 123099 0.34% 105 119760 0.33% 106 121878 0.34% 107 132862 0.37% 108 134278 0.37% 109 125476 0.35% 110 125156 0.34% 111 121781 0.34% 112 128113 0.35% 113 137599 0.38% 114 134555 0.37% 115 132244 0.36% 116 138619 0.38% 117 137948 0.38% 118 129907 0.36% 119 125006 0.34% 120 144920 0.40% 121 176573 0.49% 122 188448 0.52% 123 153933 0.42% 124 117069 0.32% 125 95973 0.26% 126 93700 0.26% 127 94653 0.26% 128 95867 0.26% 129 94808 0.26% 130 92704 0.26% 131 95093 0.26% 132 94481 0.26% 133 72581 0.20% 134 80371 0.22% 135 89760 0.25% 136 109862 0.30% 137 176333 0.49% 138 187681 0.52% 139 187692 0.52% 140 200661 0.55% 141 205927 0.57% 142 220167 0.61% 143 240962 0.66% 144 252880 0.70% 145 256436 0.71% 146 262929 0.72% 147 175636 0.48% 148 180337 0.50% 149 289936 0.80% 150 4466538 12.30% 151 23024438 63.41% 36308438 reads passed initial QC criterion=sequence-density sequence-density=23.68 sequence-density-rank=1 fanout-score=63.06 fanout-score-rank=13 prefix-density=24.68 prefix-fanout=60.5 sequence=CACTGGATACAC criterion=fanout-score sequence-density=2.15 sequence-density-rank=30 fanout-score=173.20 fanout-score-rank=1 prefix-density=24.05 prefix-fanout=15.5 sequence=GTACCGAGTTGC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=27 prefix-density=0.27 prefix-fanout=2.5 sequence=CTCCGATCCCGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=228.84 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=11.1 sequence=CAGCAACAACAATTATTCCAGTGTTACCCTCAAACCCATCCATCTCAGTCAATAGCTGATTGAGTGTTTGCTCCCTTTCATCATTCCCACCACCAATACCTGTTCCTCTTTGCCTTCCAACAGCATCAATTTCATCAACAAATACTATGCAGGGAGCATTCTCCTTGGCCTTCTTGAAAAGATCACGAACCCGGGAGGCACCAACACCAACAAACATCTCCACAAACTCAGATCCCGATATTGAAAAAAATGGCACTCCGGCTTCTCCTGCAATTGCCTTGGCA Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x CACTGGATACAC -y CTCCGATCCCGA -o SRR17229375 SRR17229375_1.fastq SRR17229375_2.fastq Input file: SRR17229375_1.fastq Paired file: SRR17229375_2.fastq trimmed: SRR17229375-trimmed-pair1.fastq, SRR17229375-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): CACTGGATACAC -- paired 3' end adapter sequence (-y): CTCCGATCCCGA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:03:57 2024 >> started Fri Dec 6 23:04:35 2024 >> done (37.544s) 30722525 read pairs processed; of these: 434 ( 0.00%) short read pairs filtered out after trimming by size control 155 ( 0.00%) empty read pairs filtered out after trimming by size control 30721936 (100.00%) read pairs available; of these: 9221 ( 0.03%) trimmed read pairs available after processing 30712715 (99.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 366 0.00% 37 870 0.00% 38 1171 0.00% 39 1521 0.00% 40 1869 0.01% 41 2233 0.01% 42 2544 0.01% 43 2828 0.01% 44 2976 0.01% 45 3202 0.01% 46 3768 0.01% 47 4123 0.01% 48 4265 0.01% 49 4570 0.01% 50 4744 0.02% 51 5018 0.02% 52 5176 0.02% 53 5510 0.02% 54 5675 0.02% 55 5862 0.02% 56 6052 0.02% 57 6333 0.02% 58 6553 0.02% 59 6817 0.02% 60 6954 0.02% 61 7231 0.02% 62 7328 0.02% 63 7626 0.02% 64 8061 0.03% 65 8377 0.03% 66 8734 0.03% 67 8836 0.03% 68 9143 0.03% 69 9296 0.03% 70 9701 0.03% 71 9870 0.03% 72 10197 0.03% 73 10612 0.03% 74 10594 0.03% 75 10800 0.04% 76 11179 0.04% 77 11522 0.04% 78 12018 0.04% 79 12430 0.04% 80 12627 0.04% 81 13063 0.04% 82 13448 0.04% 83 13962 0.05% 84 14358 0.05% 85 14894 0.05% 86 15871 0.05% 87 16510 0.05% 88 17462 0.06% 89 18307 0.06% 90 18575 0.06% 91 19484 0.06% 92 21230 0.07% 93 81909 0.27% 94 124905 0.41% 95 126190 0.41% 96 121086 0.39% 97 116617 0.38% 98 112933 0.37% 99 106749 0.35% 100 104951 0.34% 101 106373 0.35% 102 106781 0.35% 103 107505 0.35% 104 104104 0.34% 105 101189 0.33% 106 103353 0.34% 107 112639 0.37% 108 113696 0.37% 109 106198 0.35% 110 106037 0.35% 111 103111 0.34% 112 108446 0.35% 113 116299 0.38% 114 113904 0.37% 115 111889 0.36% 116 117269 0.38% 117 116766 0.38% 118 110201 0.36% 119 105813 0.34% 120 122588 0.40% 121 149442 0.49% 122 159557 0.52% 123 130233 0.42% 124 99076 0.32% 125 81240 0.26% 126 79171 0.26% 127 79986 0.26% 128 81144 0.26% 129 80316 0.26% 130 78400 0.26% 131 80562 0.26% 132 80034 0.26% 133 61456 0.20% 134 67720 0.22% 135 76039 0.25% 136 92860 0.30% 137 149282 0.49% 138 158556 0.52% 139 158631 0.52% 140 169875 0.55% 141 174405 0.57% 142 186238 0.61% 143 204338 0.67% 144 215214 0.70% 145 215265 0.70% 146 222350 0.72% 147 148637 0.48% 148 152609 0.50% 149 245655 0.80% 150 3779316 12.30% 151 19480479 63.41% criterion=sequence-density sequence-density=23.83 sequence-density-rank=1 fanout-score=62.89 fanout-score-rank=13 prefix-density=24.76 prefix-fanout=60.5 sequence=CACTGGATACAC criterion=fanout-score sequence-density=2.17 sequence-density-rank=28 fanout-score=172.97 fanout-score-rank=1 prefix-density=24.16 prefix-fanout=15.5 sequence=GTACCGAGTTGC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=28 prefix-density=0.28 prefix-fanout=2.7 sequence=CTCCGATCCCGA criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=496.65 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=27.4 sequence=CTTCTTCTTTTCCCTGTCGATGTATTCCTTGAGAAGTTCCTTGGCTTGAACTAATTTTGAGAGTAAGTTGCGGTAAATGTCGAGGTCTCTATCCACGCTTCTTTTATTGATGTTTAGAGCGGCACAAAGCTTGTCTAGTACTGTTGGCTCCGTTGCATTTGCAAGTTCAAGCAAACGGAACAAGCCAACTGCAAAGAACCGGCTGTA SRR17229375 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Dec 06 23:34:35 Started mapping on | Dec 06 23:34:45 Finished on | Dec 06 23:43:00 Mapping speed, Million of reads per hour | 263.90 Number of input reads | 36286154 Average input read length | 267 UNIQUE READS: Uniquely mapped reads number | 30672482 Uniquely mapped reads % | 84.53% Average mapped length | 266.05 Number of splices: Total | 30768250 Number of splices: Annotated (sjdb) | 28912403 Number of splices: GT/AG | 30215228 Number of splices: GC/AG | 375418 Number of splices: AT/AC | 22086 Number of splices: Non-canonical | 155518 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.29 Insertion rate per base | 0.01% Insertion average length | 2.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 446381 % of reads mapped to multiple loci | 1.23% Number of reads mapped to too many loci | 39178 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.95% % of reads unmapped: other | 1.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5330339 5330339 5330339 N_multimapping 446381 446381 446381 N_noFeature 1341522 1670587 29745712 N_ambiguous 710349 116285 5039 UnstrandedReadsAssigned:28620611 PositiveStrandReadsAssigned:28885610 NegativeStrandReadsAssigned:921731 Dataset is classified positive stranded MeadianReadLen=131 20thPercentileLength=131 echo kmer=127 SRR17229375 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR17229375-trimmed-pair1.fastq SRR17229375-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,286,154 reads, 29,177,099 reads pseudoaligned [quant] estimated average fragment length: 281.515 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52973 SRR17229375.ke.tsv 35125 SRR17229375.se.tsv 88098 total ==> SRR17229375.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 655.961 0 0 PNS24247 1044 763.485 56.865 3.65979 PNS24249 1928 1647.49 138.857 4.14151 PNS24246 1044 763.485 56.865 3.65979 PNS24248 1044 763.485 56.865 3.65979 PNS24244 1471 1190.49 321.548 13.2719 PNS24243 293 75.7432 0 0 KQK14069 1603 1322.49 1101.54 40.928 KQK14071 474 208.885 35.1281 8.26341 ==> SRR17229375.se.tsv <== BRADI_1g14170v3 1690 BRADI_1g53295v3 86 BRADI_1g59795v3 914 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 278 BRADI_1g74790v3 413 BRADI_1g09890v3 0 BRADI_1g77505v3 521 BRADI_1g48960v3 0 SRR17229375 completed mapping pipeline successfully