Starting /dee2/code/volunteer_pipeline.sh SRR17229376 current disk space = 1548318490624 free memory = 1601645336 SRR17229376 SRAfilesize 70affa26e3a6c38c38dabd87583b0f51 SRR17229376.sra SRR17229376.sra file validated SRR17229376 is paired end SRR17229376 is conventional basespace SRR17229376 read1 length is 36-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17229376_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36-151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.72875 32.0 32.0 32.0 32.0 32.0 2 31.555 32.0 32.0 32.0 32.0 32.0 3 34.46125 37.0 32.0 37.0 32.0 37.0 4 36.04875 37.0 37.0 37.0 32.0 37.0 5 36.33625 37.0 37.0 37.0 37.0 37.0 6 39.52525 41.0 41.0 41.0 37.0 41.0 7 39.65925 41.0 41.0 41.0 37.0 41.0 8 39.72925 41.0 41.0 41.0 37.0 41.0 9 40.24925 41.0 41.0 41.0 37.0 41.0 10-14 39.77115 41.0 41.0 41.0 37.0 41.0 15-19 39.9353 41.0 41.0 41.0 37.0 41.0 20-24 39.65385 41.0 41.0 41.0 36.0 41.0 25-29 39.60625 41.0 41.0 41.0 37.0 41.0 30-34 38.324850000000005 41.0 39.4 41.0 32.0 41.0 35-39 39.02984144912801 41.0 39.4 41.0 35.0 41.0 40-44 39.07371516256836 41.0 40.2 41.0 35.0 41.0 45-49 38.886465665865266 41.0 39.4 41.0 35.0 41.0 50-54 39.34014678818327 41.0 40.2 41.0 36.0 41.0 55-59 39.38284366224621 41.0 41.0 41.0 37.0 41.0 60-64 39.22728771887814 41.0 40.2 41.0 35.0 41.0 65-69 37.143636186218835 40.2 35.6 41.0 28.0 41.0 70-74 38.2957607410981 41.0 38.4 41.0 33.0 41.0 75-79 38.5136195065855 41.0 39.4 41.0 32.0 41.0 80-84 38.051041345812564 41.0 38.4 41.0 30.0 41.0 85-89 38.8576481980282 41.0 40.2 41.0 34.0 41.0 90-94 37.59932952360292 40.2 37.2 41.0 31.0 41.0 95-99 37.799960203234676 41.0 37.8 41.0 30.0 41.0 100-104 38.144280559497545 41.0 37.8 41.0 30.0 41.0 105-109 38.08177592834337 41.0 37.8 41.0 30.0 41.0 110-114 36.42314042446575 41.0 35.0 41.0 24.0 41.0 115-119 35.49336819728385 39.4 33.0 41.0 23.0 41.0 120-124 35.446672990024894 39.4 33.0 41.0 25.0 41.0 125-129 35.74155795672508 40.2 33.0 41.0 21.0 41.0 130-134 33.97455058530845 37.6 30.0 41.0 19.0 41.0 135-139 35.50071240755728 38.6 33.0 41.0 23.0 41.0 140-144 35.964629226323986 39.2 32.0 40.2 28.0 41.0 145-149 37.3225930741943 40.2 36.0 41.0 29.0 41.0 150-151 34.257702122227485 37.0 29.5 41.0 19.5 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 3.0 27 9.0 28 14.0 29 23.0 30 48.0 31 93.0 32 108.0 33 153.0 34 230.0 35 289.0 36 392.0 37 454.0 38 559.0 39 631.0 40 993.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.5 29.95 20.4 23.150000000000002 2 26.525 31.025000000000002 20.549999999999997 21.9 3 25.025 31.775 21.275 21.925 4 25.45 29.475 22.15 22.925 5 25.45 29.725 21.4 23.425 6 25.224999999999998 30.175 20.974999999999998 23.625 7 25.275 29.599999999999998 21.25 23.875 8 25.674999999999997 31.75 21.425 21.15 9 16.975 29.5 27.474999999999998 26.05 10-14 25.0 23.505000000000003 26.064999999999998 25.430000000000003 15-19 26.009999999999998 24.88 27.74 21.37 20-24 26.39 25.19 30.620000000000005 17.8 25-29 25.169999999999998 26.090000000000003 26.715 22.025 30-34 25.715 26.105 25.185000000000002 22.994999999999997 35-39 26.308677810029025 25.698128315483938 24.426984285857273 23.566209588629768 40-44 25.83237081303671 25.85245819314016 24.682368302114195 23.632802691708935 45-49 25.78191891211282 25.681188617476707 24.779652480483506 23.75723998992697 50-54 25.571190800423665 26.277298633176983 24.582639834569022 23.568870731830334 55-59 26.51052445611024 25.647367624047245 24.19362980162536 23.648478118217152 60-64 26.270543615676363 25.572692793931733 24.621997471554995 23.534766118836913 65-69 26.238830219333874 25.568643379366367 24.634443541835907 23.55808285946385 70-74 25.803985525712246 25.544059935783093 24.774476326384995 23.87747821211967 75-79 26.384914145543746 25.756336876533116 23.931929681112017 23.926819296811118 80-84 27.17943455282467 25.94797065011032 23.367027554004824 23.505567243060188 85-89 26.256954461158045 25.777869359159283 23.75334844426128 24.21182773542139 90-94 26.50041390728477 25.3932119205298 24.286009933774835 23.820364238410598 95-99 26.533901830282865 26.49230449251248 23.68448419301165 23.289309484193012 100-104 26.9810530723333 25.541714644614256 23.788338741756515 23.688893541295926 105-109 26.87164367695062 25.355375381699485 24.297146467305463 23.475834474044436 110-114 26.725607158074137 25.846825734980825 23.929484448231786 23.49808265871325 115-119 26.94526063771901 25.623027532919796 23.762106866906084 23.66960496245511 120-124 26.54247812588202 26.46344905447361 23.66920688681908 23.32486593282529 125-129 27.679853017167133 25.383246253660218 23.91341792501579 23.02348280415686 130-134 27.37592867756315 26.187221396731054 23.488855869242197 22.947994056463596 135-139 27.120515179392825 25.55044464888071 24.07237043851579 23.25666973321067 140-144 27.286199444272924 26.236492744674283 23.92713800555727 22.550169805495525 145-149 27.199701102185692 26.02901799613924 23.812192540008716 22.959088361666353 150-151 28.129117259552043 26.15283267457181 22.80961791831357 22.908432147562582 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 3.0 12 4.5 13 4.5 14 5.0 15 3.5 16 1.5 17 1.5 18 2.0 19 1.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.5 25 1.5 26 1.5 27 1.0 28 1.5 29 3.5 30 3.5 31 4.5 32 11.0 33 16.5 34 19.5 35 23.0 36 38.5 37 49.0 38 57.0 39 76.5 40 112.5 41 143.5 42 159.5 43 202.0 44 236.0 45 235.5 46 222.0 47 211.0 48 204.5 49 203.5 50 193.0 51 162.0 52 146.0 53 133.0 54 107.5 55 95.0 56 110.0 57 108.0 58 86.5 59 86.5 60 87.5 61 77.5 62 62.0 63 58.0 64 66.0 65 61.0 66 43.5 67 32.0 68 22.0 69 18.0 70 18.0 71 14.5 72 11.0 73 8.5 74 5.5 75 1.5 76 1.0 77 0.5 78 0.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35-39 14.0 40-44 12.0 45-49 7.0 50-54 4.0 55-59 5.0 60-64 13.0 65-69 16.0 70-74 11.0 75-79 13.0 80-84 16.0 85-89 17.0 90-94 14.0 95-99 25.0 100-104 24.0 105-109 36.0 110-114 47.0 115-119 148.0 120-124 77.0 125-129 70.0 130-134 153.0 135-139 31.0 140-144 21.0 145-149 120.0 150-152 3106.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.125 #Duplication Level Percentage of deduplicated Percentage of total 1 97.06563706563706 94.27499999999999 2 2.9086229086229083 5.65 3 0.02574002574002574 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138-139 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGGGCC 10 0.0028649552 192.8772 145 GTATGTA 10 0.008019399 137.425 6 CCTGTAC 10 0.008019399 137.425 7 ACGCAGA 10 0.008019399 137.425 7 GTGTACC 20 2.454719E-6 137.425 8 TATGTAC 15 1.4130892E-4 137.425 7 CCCACTG 10 0.008019399 137.425 7 GAATGCT 15 1.4130892E-4 137.425 7 TAGCAGA 10 0.008019399 137.425 7 TAGCACT 10 0.008019399 137.425 6 GAGCATG 10 0.008019399 137.425 5 CCACTGG 20 2.454719E-6 137.425 8 TCATGCT 15 1.4130892E-4 137.425 7 CGTATGT 10 0.008019399 137.425 5 CGCAGAT 10 0.008019399 137.425 8 GCATGCT 20 2.454719E-6 137.425 7 AGCACTG 15 1.4130892E-4 137.425 7 CGAGCAT 10 0.008019399 137.425 4 TCACTGG 15 1.4130892E-4 137.425 8 ATGTACC 50 0.0 137.425 8 >>END_MODULE SRR17229376 read2 length is 36-151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR17229376_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36-151 %GC 48 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.06 32.0 32.0 32.0 12.0 32.0 2 31.245 32.0 32.0 32.0 32.0 32.0 3 34.36875 37.0 32.0 37.0 32.0 37.0 4 28.52 32.0 12.0 37.0 12.0 37.0 5 27.82875 32.0 12.0 37.0 12.0 37.0 6 32.72825 37.0 32.0 41.0 12.0 41.0 7 37.14025 41.0 37.0 41.0 32.0 41.0 8 37.57825 41.0 37.0 41.0 32.0 41.0 9 38.58675 41.0 37.0 41.0 32.0 41.0 10-14 38.13065 41.0 38.4 41.0 32.0 41.0 15-19 37.376549999999995 40.2 36.6 41.0 29.0 41.0 20-24 39.0323 41.0 40.2 41.0 36.0 41.0 25-29 37.331900000000005 41.0 36.8 41.0 26.0 41.0 30-34 37.12075 41.0 37.0 41.0 27.0 41.0 35-39 35.77643701551243 38.4 32.0 41.0 26.0 41.0 40-44 36.55114239201741 40.2 35.0 41.0 25.0 41.0 45-49 36.04681073163627 40.2 34.0 41.0 23.0 41.0 50-54 33.99549506857486 37.4 29.0 40.2 20.0 41.0 55-59 36.26892455686352 40.2 35.0 41.0 24.0 41.0 60-64 37.97584885755824 41.0 37.0 41.0 30.0 41.0 65-69 37.52534335856369 41.0 36.0 41.0 30.0 41.0 70-74 37.39492963868071 41.0 36.0 41.0 29.0 41.0 75-79 32.28613378462974 33.8 25.0 39.4 20.0 41.0 80-84 36.964092655012095 41.0 35.0 41.0 28.0 41.0 85-89 37.73293963478174 41.0 37.0 41.0 30.0 41.0 90-94 38.07170084839602 41.0 37.0 41.0 30.0 41.0 95-99 37.2477541451148 40.2 35.0 41.0 27.0 41.0 100-104 38.28321189776673 41.0 37.0 41.0 32.0 41.0 105-109 37.225197087258934 41.0 37.0 41.0 28.0 41.0 110-114 33.18164268391426 37.0 28.0 41.0 18.0 41.0 115-119 37.45744386434279 41.0 37.0 41.0 30.0 41.0 120-124 36.59836668064274 41.0 35.0 41.0 27.0 41.0 125-129 35.63070939820505 40.2 32.0 41.0 23.0 41.0 130-134 32.3978514235775 36.8 27.0 41.0 15.0 41.0 135-139 32.96089977738033 36.0 27.0 41.0 18.0 41.0 140-144 33.52408263608042 36.0 29.0 41.0 21.0 41.0 145-149 31.68825860059345 33.0 26.0 39.4 21.0 41.0 150-151 25.83141113367473 24.5 17.0 32.0 17.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 3.0 22 2.0 23 8.0 24 12.0 25 27.0 26 42.0 27 64.0 28 72.0 29 114.0 30 176.0 31 205.0 32 202.0 33 259.0 34 345.0 35 395.0 36 430.0 37 437.0 38 485.0 39 487.0 40 235.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 14.499999999999998 15.049999999999999 37.425000000000004 33.025 2 22.925 11.975 28.375 36.725 3 23.799999999999997 12.025 31.4 32.775 4 23.849999999999998 9.85 33.45 32.85 5 24.099999999999998 10.7 34.9 30.3 6 24.675 14.45 34.4 26.474999999999998 7 24.125 22.775000000000002 31.95 21.15 8 20.4 24.15 33.1 22.35 9 19.125 28.425 32.175 20.275000000000002 10-14 20.294999999999998 26.25 30.044999999999998 23.41 15-19 21.335 24.86 28.74 25.064999999999998 20-24 21.5 25.595000000000002 26.615 26.290000000000003 25-29 21.275 24.73 27.275 26.72 30-34 21.83 25.335 26.865 25.97 35-39 22.2936332596907 24.593291825667805 27.299658565977104 25.813416348664393 40-44 21.946011895684002 24.630166234558487 26.65344923999797 26.770372629759542 45-49 22.580147965474723 25.030826140567203 26.618372379778048 25.770653514180026 50-54 22.30890052356021 24.418848167539267 27.24083769633508 26.031413612565444 55-59 21.501670290047194 24.041571663396788 27.297311628400234 27.159446418155785 60-64 21.54527979495942 25.005339598462196 26.366937206322085 27.082443400256302 65-69 22.165474974463738 24.966399655932477 26.53083167571636 26.337293693887425 70-74 22.409769335142467 24.30393487109905 27.039348710990502 26.24694708276798 75-79 22.630985915492957 24.99718309859155 27.23943661971831 25.13239436619718 80-84 22.41152592761992 24.44685838431193 26.785203819106968 26.35641186896118 85-89 22.867816091954023 23.517241379310345 27.022988505747126 26.591954022988507 90-94 23.054255503553474 24.562315825966373 26.440168717859823 25.94325995262033 95-99 22.955956594905125 24.429872918238264 25.99083154413045 26.623338942726164 100-104 22.315641968821158 24.697845507094062 26.034915630291355 26.95159689379343 105-109 22.273371104815865 24.746222851746932 26.510859301227573 26.469546742209634 110-114 23.193823150928367 24.32134321956002 25.939089404988053 26.54574422452356 115-119 22.382149591451917 24.424890006285356 25.95223130106851 27.240729101194216 120-124 22.597137014314928 24.169222903885483 26.482617586912067 26.75102249488753 125-129 23.349617111169792 24.14180089780829 25.87140216530235 26.637179825719564 130-134 23.091423185673893 24.62843471326035 26.339447545856594 25.940694555209166 135-139 22.586082350108356 24.937795970784173 26.334376755758885 26.141744923348583 140-144 23.09892328398385 24.621467025572006 26.875841184387617 25.40376850605653 145-149 22.636861313868614 25.337591240875913 25.83941605839416 26.186131386861316 150-151 25.894665766374068 26.704929101958136 27.04253882511816 20.357866306549628 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.5 23 2.0 24 1.5 25 0.0 26 3.0 27 4.5 28 6.5 29 7.5 30 6.5 31 12.5 32 22.5 33 31.5 34 37.5 35 43.5 36 56.0 37 79.0 38 100.5 39 144.5 40 176.0 41 200.0 42 235.5 43 229.5 44 200.5 45 226.0 46 262.0 47 247.0 48 215.5 49 192.5 50 168.5 51 147.5 52 140.5 53 106.0 54 86.0 55 90.0 56 87.0 57 88.0 58 80.5 59 69.0 60 64.0 61 54.5 62 48.5 63 46.0 64 42.5 65 43.5 66 41.5 67 35.5 68 31.0 69 28.0 70 22.0 71 17.5 72 14.0 73 14.0 74 19.5 75 16.5 76 11.5 77 7.5 78 4.0 79 4.0 80 6.0 81 4.5 82 2.5 83 3.0 84 2.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35-39 53.0 40-44 31.0 45-49 70.0 50-54 59.0 55-59 31.0 60-64 23.0 65-69 25.0 70-74 117.0 75-79 85.0 80-84 18.0 85-89 18.0 90-94 17.0 95-99 19.0 100-104 25.0 105-109 95.0 110-114 117.0 115-119 42.0 120-124 83.0 125-129 130.0 130-134 394.0 135-139 116.0 140-144 112.0 145-149 702.0 150-152 1618.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.475 #Duplication Level Percentage of deduplicated Percentage of total 1 98.47677075399848 96.975 2 1.4978420919014979 2.9499999999999997 3 0.02538715410002539 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0125 92-93 0.0 0.0 0.0 0.0 0.025 94-95 0.0 0.0 0.0 0.0 0.025 96-97 0.0 0.0 0.0 0.0 0.025 98-99 0.0 0.0 0.0 0.0 0.025 100-101 0.0 0.0 0.0 0.0 0.025 102-103 0.0 0.0 0.0 0.0 0.025 104-105 0.0 0.0 0.0 0.0 0.025 106-107 0.0 0.0 0.0 0.0 0.025 108-109 0.0 0.0 0.0 0.0 0.025 110-111 0.0 0.0 0.0 0.0 0.025 112-113 0.0 0.0 0.0 0.0 0.025 114-115 0.0 0.0 0.0 0.0 0.025 116-117 0.0 0.0 0.0 0.0 0.025 118-119 0.0 0.0 0.0 0.0 0.025 120-121 0.0 0.0 0.0 0.0 0.025 122-123 0.0 0.0 0.0 0.0 0.025 124-125 0.0 0.0 0.0 0.0 0.025 126-127 0.0 0.0 0.0 0.0 0.025 128-129 0.0 0.0 0.0 0.0 0.025 130-131 0.0 0.0 0.0 0.0 0.025 132-133 0.0 0.0 0.0 0.0 0.025 134-135 0.0 0.0 0.0 0.0 0.025 136-137 0.0 0.0 0.0 0.0 0.025 138-139 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 35 0.0036150212 20.618368 75-79 >>END_MODULE Read 2600468 spots for SRR17229376.sra Written 2600468 spots for SRR17229376.sra Read 2600468 spots for SRR17229376.sra Written 2600468 spots for SRR17229376.sra Read 2600468 spots for SRR17229376.sra Written 2600468 spots for SRR17229376.sra Read 2600468 spots for SRR17229376.sra Written 2600468 spots for SRR17229376.sra Read 2600468 spots for SRR17229376.sra Written 2600468 spots for SRR17229376.sra Read 2600468 spots for SRR17229376.sra Written 2600468 spots for SRR17229376.sra Read 2600468 spots for SRR17229376.sra Written 2600468 spots for SRR17229376.sra Read 2600468 spots for SRR17229376.sra Written 2600468 spots for SRR17229376.sra Read 2600468 spots for SRR17229376.sra Written 2600468 spots for SRR17229376.sra Read 2600468 spots for SRR17229376.sra Written 2600468 spots for SRR17229376.sra Read 2600468 spots for SRR17229376.sra Written 2600468 spots for SRR17229376.sra Read 2600468 spots for SRR17229376.sra Written 2600468 spots for SRR17229376.sra Read 2600468 spots for SRR17229376.sra Written 2600468 spots for SRR17229376.sra Read 2600468 spots for SRR17229376.sra Written 2600468 spots for SRR17229376.sra Read 2600468 spots for SRR17229376.sra Written 2600468 spots for SRR17229376.sra Read 2600468 spots for SRR17229376.sra Written 2600468 spots for SRR17229376.sra Read 2600468 spots for SRR17229376.sra Written 2600468 spots for SRR17229376.sra Read 2600468 spots for SRR17229376.sra Written 2600468 spots for SRR17229376.sra Read 2600468 spots for SRR17229376.sra Written 2600468 spots for SRR17229376.sra Read 2600478 spots for SRR17229376.sra Written 2600478 spots for SRR17229376.sra SRR ids: ['SRR17229376.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nflgmqrq SRR17229376.sra spots: 52009370 blocks: [[1, 2600468], [2600469, 5200936], [5200937, 7801404], [7801405, 10401872], [10401873, 13002340], [13002341, 15602808], [15602809, 18203276], [18203277, 20803744], [20803745, 23404212], [23404213, 26004680], [26004681, 28605148], [28605149, 31205616], [31205617, 33806084], [33806085, 36406552], [36406553, 39007020], [39007021, 41607488], [41607489, 44207956], [44207957, 46808424], [46808425, 49408892], [49408893, 52009370]] SRR17229376 file size 17361698 SRR17229376 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR17229376 SRR17229376_1.fastq SRR17229376_2.fastq Input file: SRR17229376_1.fastq Paired file: SRR17229376_2.fastq trimmed: SRR17229376-trimmed-pair1.fastq, SRR17229376-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:01:13 2024 >> started Fri Dec 6 23:02:10 2024 >> done (56.846s) 52009370 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 1 ( 0.00%) empty read pairs filtered out after trimming by size control 52009369 (100.00%) read pairs available; of these: 10710 ( 0.02%) trimmed read pairs available after processing 51998659 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 0 0.00% 34 2 0.00% 35 0 0.00% 36 607 0.00% 37 1388 0.00% 38 2053 0.00% 39 2678 0.01% 40 3281 0.01% 41 3952 0.01% 42 4431 0.01% 43 4961 0.01% 44 5386 0.01% 45 6032 0.01% 46 6854 0.01% 47 7508 0.01% 48 7742 0.01% 49 8310 0.02% 50 8819 0.02% 51 9151 0.02% 52 9493 0.02% 53 9995 0.02% 54 10104 0.02% 55 10871 0.02% 56 11136 0.02% 57 11698 0.02% 58 11695 0.02% 59 12167 0.02% 60 12730 0.02% 61 12925 0.02% 62 13271 0.03% 63 13574 0.03% 64 14211 0.03% 65 14636 0.03% 66 15080 0.03% 67 15142 0.03% 68 15736 0.03% 69 16050 0.03% 70 16421 0.03% 71 16847 0.03% 72 17096 0.03% 73 17584 0.03% 74 17741 0.03% 75 18415 0.04% 76 18733 0.04% 77 19879 0.04% 78 20354 0.04% 79 20916 0.04% 80 21347 0.04% 81 22534 0.04% 82 23932 0.05% 83 24610 0.05% 84 25493 0.05% 85 26275 0.05% 86 27573 0.05% 87 29081 0.06% 88 30548 0.06% 89 32126 0.06% 90 33762 0.06% 91 34800 0.07% 92 37523 0.07% 93 121943 0.23% 94 187245 0.36% 95 190117 0.37% 96 185247 0.36% 97 181525 0.35% 98 176070 0.34% 99 170689 0.33% 100 166701 0.32% 101 171566 0.33% 102 175666 0.34% 103 176703 0.34% 104 169127 0.33% 105 162476 0.31% 106 158548 0.30% 107 168542 0.32% 108 174641 0.34% 109 168078 0.32% 110 168504 0.32% 111 161634 0.31% 112 164078 0.32% 113 171462 0.33% 114 164560 0.32% 115 159477 0.31% 116 168633 0.32% 117 165237 0.32% 118 156851 0.30% 119 146936 0.28% 120 151155 0.29% 121 158490 0.30% 122 155649 0.30% 123 146726 0.28% 124 139410 0.27% 125 137198 0.26% 126 138600 0.27% 127 143242 0.28% 128 147657 0.28% 129 147509 0.28% 130 148668 0.29% 131 155864 0.30% 132 164064 0.32% 133 168513 0.32% 134 179157 0.34% 135 190899 0.37% 136 212778 0.41% 137 256634 0.49% 138 277873 0.53% 139 302813 0.58% 140 319272 0.61% 141 322684 0.62% 142 348240 0.67% 143 357294 0.69% 144 366177 0.70% 145 377955 0.73% 146 373967 0.72% 147 327410 0.63% 148 352132 0.68% 149 519055 1.00% 150 6418749 12.34% 151 33004017 63.46% 52009369 reads passed initial QC criterion=sequence-density sequence-density=23.70 sequence-density-rank=1 fanout-score=63.77 fanout-score-rank=12 prefix-density=24.79 prefix-fanout=61.0 sequence=TGTACCGAGTTG criterion=fanout-score sequence-density=2.23 sequence-density-rank=28 fanout-score=171.40 fanout-score-rank=1 prefix-density=24.60 prefix-fanout=15.5 sequence=GTACCGAGTTGC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=33 prefix-density=0.30 prefix-fanout=2.1 sequence=CTGTAATCATCGGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=501.43 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=24.7 sequence=CTTCTTCTTTTCCCTGTCGATGTATTCCTTGAGAAGTTCCTTGGCTTGAACTAATTTTGAGAGTAAGTTGCGGTAAATGTCGAGGTCTCTATCCACGCTTCTTTTATTGATGTTTAGAGCGGCACAAAGCTTGTCTAGTACTGTTGGCTCCGTTGCATTTGCAAGTTCAAGCAAACGGAACAAGCCAACTGCAAAGAACCGGCTGTAGCTGAAGTTTCCGTTACCCTGGGCCCTTTCTGATATAT Potential 3prime adapter identified. Now checking if in reference sequence /dee2/code/volunteer_pipeline.sh: line 905: -f: command not found /dee2/code/volunteer_pipeline.sh: line 906: -f: command not found Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TGTACCGAGTTG -y CTGTAATCATCGGT -o SRR17229376 SRR17229376_1.fastq SRR17229376_2.fastq Input file: SRR17229376_1.fastq Paired file: SRR17229376_2.fastq trimmed: SRR17229376-trimmed-pair1.fastq, SRR17229376-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): TGTACCGAGTTG -- paired 3' end adapter sequence (-y): CTGTAATCATCGGT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:09:19 2024 >> started Fri Dec 6 23:10:04 2024 >> done (45.465s) 44007928 read pairs processed; of these: 605 ( 0.00%) short read pairs filtered out after trimming by size control 155 ( 0.00%) empty read pairs filtered out after trimming by size control 44007168 (100.00%) read pairs available; of these: 10544 ( 0.02%) trimmed read pairs available after processing 43996624 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 0 0.00% 34 2 0.00% 35 0 0.00% 36 515 0.00% 37 1185 0.00% 38 1740 0.00% 39 2263 0.01% 40 2777 0.01% 41 3348 0.01% 42 3782 0.01% 43 4194 0.01% 44 4577 0.01% 45 5103 0.01% 46 5785 0.01% 47 6327 0.01% 48 6569 0.01% 49 6997 0.02% 50 7477 0.02% 51 7733 0.02% 52 8011 0.02% 53 8526 0.02% 54 8536 0.02% 55 9226 0.02% 56 9397 0.02% 57 9982 0.02% 58 9900 0.02% 59 10307 0.02% 60 10803 0.02% 61 10955 0.02% 62 11237 0.03% 63 11488 0.03% 64 12000 0.03% 65 12363 0.03% 66 12789 0.03% 67 12869 0.03% 68 13249 0.03% 69 13586 0.03% 70 13814 0.03% 71 14291 0.03% 72 14437 0.03% 73 14941 0.03% 74 14991 0.03% 75 15636 0.04% 76 15839 0.04% 77 16758 0.04% 78 17231 0.04% 79 17792 0.04% 80 18139 0.04% 81 19086 0.04% 82 20237 0.05% 83 20708 0.05% 84 21593 0.05% 85 22220 0.05% 86 23390 0.05% 87 24600 0.06% 88 25841 0.06% 89 27117 0.06% 90 28483 0.06% 91 29370 0.07% 92 31756 0.07% 93 102962 0.23% 94 158230 0.36% 95 160824 0.37% 96 156727 0.36% 97 153488 0.35% 98 148953 0.34% 99 144532 0.33% 100 141216 0.32% 101 145041 0.33% 102 148559 0.34% 103 149379 0.34% 104 142946 0.32% 105 137302 0.31% 106 134004 0.30% 107 142660 0.32% 108 147666 0.34% 109 142119 0.32% 110 142392 0.32% 111 136798 0.31% 112 138827 0.32% 113 145237 0.33% 114 139298 0.32% 115 134993 0.31% 116 142719 0.32% 117 139727 0.32% 118 132768 0.30% 119 124187 0.28% 120 128021 0.29% 121 133804 0.30% 122 131816 0.30% 123 124030 0.28% 124 117950 0.27% 125 115822 0.26% 126 117185 0.27% 127 121059 0.28% 128 124861 0.28% 129 124747 0.28% 130 125858 0.29% 131 132005 0.30% 132 138755 0.32% 133 142507 0.32% 134 151463 0.34% 135 161606 0.37% 136 179935 0.41% 137 217416 0.49% 138 235438 0.53% 139 256187 0.58% 140 270433 0.61% 141 273557 0.62% 142 294793 0.67% 143 302514 0.69% 144 311133 0.71% 145 318731 0.72% 146 316377 0.72% 147 277039 0.63% 148 298473 0.68% 149 441011 1.00% 150 5432211 12.34% 151 27923006 63.45% criterion=sequence-density sequence-density=23.86 sequence-density-rank=1 fanout-score=62.60 fanout-score-rank=13 prefix-density=24.64 prefix-fanout=60.6 sequence=CACTGGATACAC criterion=fanout-score sequence-density=2.20 sequence-density-rank=29 fanout-score=173.87 fanout-score-rank=1 prefix-density=24.66 prefix-fanout=15.5 sequence=GTACCGAGTTGC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=30 prefix-density=0.32 prefix-fanout=2.0 sequence=CTGTAATCATCGGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=441.91 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=24.0 sequence=CTTCTTCTTTTCCCTGTCGATGTATTCCTTGAGAAGTTCCTTGGCTTGAACTAATTTTGAGAGTAAGTTGCGGTAAATGTCGAGGTCTCTATCCACGCTTCTTTTATTGATGTTTAGAGCGGCACAAAGCTTGTCTAGTACTGTTGGCTCCGTTGCATTTGCAAGTTCAAGCAAACGGAACAAGCCAACTGCAAAGAACCGGCTGTAGCTGAAGTTTCCGTTACCCTGGGCCCTTTCTGATATATC SRR17229376 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Dec 06 23:53:09 Started mapping on | Dec 06 23:53:12 Finished on | Dec 06 23:57:24 Mapping speed, Million of reads per hour | 742.50 Number of input reads | 51975140 Average input read length | 267 UNIQUE READS: Uniquely mapped reads number | 50105818 Uniquely mapped reads % | 96.40% Average mapped length | 266.17 Number of splices: Total | 51288712 Number of splices: Annotated (sjdb) | 47996454 Number of splices: GT/AG | 50335027 Number of splices: GC/AG | 649147 Number of splices: AT/AC | 26567 Number of splices: Non-canonical | 277971 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.02% Deletion average length | 2.27 Insertion rate per base | 0.01% Insertion average length | 3.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 584885 % of reads mapped to multiple loci | 1.13% Number of reads mapped to too many loci | 32485 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.69% % of reads unmapped: other | 0.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1504320 1504320 1504320 N_multimapping 584885 584885 584885 N_noFeature 1978230 2499742 48645286 N_ambiguous 1191584 258429 9784 UnstrandedReadsAssigned:46936004 PositiveStrandReadsAssigned:47347647 NegativeStrandReadsAssigned:1450748 Dataset is classified positive stranded MeadianReadLen=131 20thPercentileLength=131 echo kmer=127 SRR17229376 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR17229376-trimmed-pair1.fastq SRR17229376-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 51,975,140 reads, 47,541,160 reads pseudoaligned [quant] estimated average fragment length: 310.9 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,371 rounds 52973 SRR17229376.ke.tsv 35125 SRR17229376.se.tsv 88098 total ==> SRR17229376.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 626.675 0 0 PNS24247 1044 734.1 70.9842 2.86349 PNS24249 1928 1618.1 334.243 6.1171 PNS24246 1044 734.1 70.9842 2.86349 PNS24248 1044 734.1 70.9842 2.86349 PNS24244 1471 1161.1 299.805 7.64642 PNS24243 293 65.7937 0 0 KQK14069 1603 1293.1 19615.3 449.214 KQK14071 474 186.591 290.033 46.0305 ==> SRR17229376.se.tsv <== BRADI_1g14170v3 31077 BRADI_1g53295v3 240 BRADI_1g59795v3 1866 BRADI_1g07683v3 1 BRADI_1g00485v3 20 BRADI_1g20270v3 372 BRADI_1g74790v3 455 BRADI_1g09890v3 0 BRADI_1g77505v3 725 BRADI_1g48960v3 0 SRR17229376 completed mapping pipeline successfully