Starting /dee2/code/volunteer_pipeline.sh SRR1797575 current disk space = 1525699940352 free memory = 1576087764 SRR1797575 SRAfilesize 225da58e333e9b99037b7ad7490e5cc5 SRR1797575.sra SRR1797575.sra file validated SRR1797575 is paired end SRR1797575 is conventional basespace SRR1797575 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1797575_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.14125 34.0 34.0 34.0 31.0 34.0 2 32.78675 34.0 34.0 34.0 31.0 34.0 3 33.28125 34.0 34.0 34.0 31.0 34.0 4 36.6855 37.0 37.0 37.0 35.0 37.0 5 36.69725 37.0 37.0 37.0 35.0 37.0 6 36.7565 37.0 37.0 37.0 37.0 37.0 7 36.74325 37.0 37.0 37.0 37.0 37.0 8 36.76375 37.0 37.0 37.0 37.0 37.0 9 38.68825 39.0 39.0 39.0 39.0 39.0 10-14 38.876999999999995 39.4 39.2 39.4 38.0 39.4 15-19 40.17395 41.0 40.0 41.0 38.6 41.0 20-24 39.9784 41.0 40.0 41.0 38.0 41.0 25-29 39.661649999999995 41.0 40.0 41.0 37.2 41.0 30-34 39.5859 41.0 40.0 41.0 36.2 41.0 35-39 39.2569 41.0 39.0 41.0 35.0 41.0 40-44 38.6631 40.4 37.6 41.0 35.0 41.0 45-49 38.12304999999999 40.0 36.0 41.0 34.4 41.0 50-54 37.4168 39.2 35.0 41.0 33.0 41.0 55-59 36.7551 37.8 35.0 40.8 33.0 41.0 60-64 35.9828 36.4 35.0 39.8 31.8 41.0 65-69 35.57965 35.2 35.0 38.8 32.8 40.8 70-74 34.74625 35.0 34.8 36.8 31.6 39.4 75-79 33.78005 35.0 33.6 35.2 30.6 37.4 80-84 33.45285 35.0 34.0 35.0 30.2 36.4 85-89 33.12685 35.0 33.4 35.0 29.6 35.6 90-94 32.7447 35.0 33.0 35.0 29.0 35.0 95-99 32.37065 35.0 33.0 35.0 27.6 35.0 100-104 31.92705 35.0 32.8 35.0 26.6 35.0 105-109 31.3625 34.4 32.0 35.0 24.0 35.0 110-114 30.8805 34.0 31.0 35.0 23.2 35.0 115-119 30.101999999999997 34.0 30.2 35.0 18.8 35.0 120-124 28.818 33.4 28.2 35.0 9.0 35.0 125-129 27.820600000000002 33.0 26.6 35.0 2.6 35.0 130-134 26.5888 32.2 24.2 34.6 2.0 35.0 135-139 25.42865 31.2 20.6 34.0 2.0 35.0 140-144 23.998150000000003 31.0 12.6 34.0 2.0 35.0 145-149 21.78435 30.2 2.0 34.0 2.0 35.0 150 14.334 15.0 2.0 27.0 2.0 32.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 3.0 7 4.0 8 3.0 9 2.0 10 5.0 11 3.0 12 7.0 13 5.0 14 7.0 15 13.0 16 9.0 17 7.0 18 10.0 19 18.0 20 16.0 21 18.0 22 24.0 23 29.0 24 48.0 25 48.0 26 68.0 27 79.0 28 92.0 29 116.0 30 156.0 31 150.0 32 224.0 33 261.0 34 453.0 35 679.0 36 986.0 37 455.0 38 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.424836601307188 11.816993464052288 12.758169934640524 44.0 2 31.225 11.05 22.95 34.775 3 25.45 11.774999999999999 15.475 47.3 4 30.975 15.925 16.85 36.25 5 30.65 20.9 22.275 26.174999999999997 6 33.15 21.8 19.35 25.7 7 21.425 28.1 29.849999999999998 20.625 8 23.9 22.900000000000002 27.200000000000003 26.0 9 23.974999999999998 19.35 28.575 28.1 10-14 24.632463246324633 25.03750375037504 24.202420242024203 26.127612761276126 15-19 25.97695390781563 23.74248496993988 23.246492985971944 27.034068136272545 20-24 25.81 23.235 23.5 27.455000000000002 25-29 25.485000000000003 23.61 22.88 28.025 30-34 26.255 22.855 23.275000000000002 27.615000000000002 35-39 25.740000000000002 23.11 23.0 28.15 40-44 26.27 23.47 22.445 27.815 45-49 26.419999999999998 23.674999999999997 22.3 27.605 50-54 26.525 23.07 21.935 28.470000000000002 55-59 26.0 23.150000000000002 22.645 28.205000000000002 60-64 26.584999999999997 22.875 21.625 28.915000000000003 65-69 26.450000000000003 22.2 22.99 28.360000000000003 70-74 26.825 22.705000000000002 22.415 28.055000000000003 75-79 26.779999999999998 22.384999999999998 22.515 28.32 80-84 26.345000000000002 22.345000000000002 22.6 28.71 85-89 26.86 22.865 21.82 28.455000000000002 90-94 26.86 22.56 22.09 28.49 95-99 27.025 22.41 21.895 28.67 100-104 27.250000000000004 21.875 21.995 28.88 105-109 28.215 22.134999999999998 21.654999999999998 27.994999999999997 110-114 27.51 22.335 21.515 28.64 115-119 28.075 21.625 21.990000000000002 28.310000000000002 120-124 28.46 21.145 21.4 28.994999999999997 125-129 28.33 21.13 21.195 29.345 130-134 28.105000000000004 21.805 21.775 28.315 135-139 28.82 21.615000000000002 21.075 28.49 140-144 28.965000000000003 21.3 20.655 29.080000000000002 145-149 28.754999999999995 21.425 20.93 28.89 150 29.349999999999998 20.45 17.625 32.574999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.5 27 1.0 28 1.5 29 2.5 30 3.5 31 4.0 32 8.0 33 15.0 34 14.0 35 18.0 36 30.5 37 36.0 38 47.5 39 69.5 40 79.5 41 92.5 42 104.0 43 110.5 44 127.5 45 137.0 46 150.0 47 151.0 48 136.0 49 133.5 50 129.5 51 125.5 52 139.0 53 131.5 54 117.5 55 116.5 56 105.5 57 86.5 58 82.5 59 85.5 60 80.0 61 83.0 62 88.0 63 85.5 64 84.5 65 82.5 66 78.5 67 80.0 68 82.5 69 85.5 70 75.0 71 63.5 72 63.0 73 63.0 74 54.0 75 44.0 76 45.5 77 41.5 78 26.5 79 19.5 80 17.5 81 14.0 82 12.0 83 11.5 84 7.5 85 3.5 86 3.0 87 3.0 88 2.0 89 2.0 90 1.5 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.2 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0125 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.30000000000000004 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.5 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.675 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 1.1875 0.0 0.0 0.0 0.0 132-133 1.5875 0.0 0.0 0.0 0.0 134-135 2.0375 0.0 0.0 0.0 0.0 136-137 2.525 0.0 0.0 0.0 0.0 138 2.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCATGT 10 0.006227462 149.48051 1 CCGGATA 10 0.006991776 143.875 4 CCATGTT 10 0.006991776 143.875 2 GGGGGGG 155 0.0032763004 8.3540325 110-114 >>END_MODULE SRR1797575 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1797575_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 56 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76725 34.0 33.0 34.0 31.0 34.0 2 33.2465 34.0 33.0 34.0 31.0 34.0 3 33.41475 34.0 34.0 34.0 31.0 34.0 4 36.7095 37.0 37.0 37.0 37.0 37.0 5 36.6635 37.0 37.0 37.0 37.0 37.0 6 36.6885 37.0 37.0 37.0 37.0 37.0 7 36.66425 37.0 37.0 37.0 37.0 37.0 8 36.72475 37.0 37.0 37.0 37.0 37.0 9 38.6515 39.0 39.0 39.0 38.0 39.0 10-14 38.93195 39.4 39.4 39.4 38.2 39.4 15-19 40.21485 41.0 40.4 41.0 38.8 41.0 20-24 39.88865 41.0 40.0 41.0 38.0 41.0 25-29 39.4807 41.0 39.6 41.0 36.8 41.0 30-34 39.02329999999999 40.2 38.8 41.0 35.2 41.0 35-39 38.88405 41.0 38.4 41.0 35.0 41.0 40-44 38.098299999999995 40.0 36.0 41.0 34.2 41.0 45-49 37.4019 39.4 35.0 41.0 33.0 41.0 50-54 36.33665 37.8 34.8 40.2 32.4 40.8 55-59 36.031800000000004 36.4 35.0 40.0 32.2 41.0 60-64 35.4336 35.0 35.0 39.2 31.6 41.0 65-69 35.04555 35.0 35.0 38.0 32.2 40.8 70-74 34.2653 35.0 35.0 36.4 31.0 39.0 75-79 33.70655 35.0 34.4 35.2 31.0 37.0 80-84 33.0976 35.0 34.0 35.0 29.6 36.0 85-89 32.5783 35.0 33.4 35.0 28.6 35.2 90-94 31.939 35.0 33.0 35.0 26.0 35.0 95-99 31.463900000000002 35.0 32.6 35.0 24.0 35.0 100-104 30.92355 34.4 31.6 35.0 22.0 35.0 105-109 30.660649999999997 34.0 31.0 35.0 20.4 35.0 110-114 29.787650000000003 34.0 29.8 35.0 16.6 35.0 115-119 29.421550000000003 34.0 29.4 35.0 10.6 35.0 120-124 28.581 33.6 28.2 35.0 3.8 35.0 125-129 28.05235 33.0 27.0 35.0 2.0 35.0 130-134 27.0137 32.8 25.4 34.8 2.0 35.0 135-139 25.501450000000002 31.4 21.6 34.2 2.0 35.0 140-144 24.344050000000003 31.0 15.6 34.0 2.0 35.0 145-149 22.16885 30.4 2.0 34.0 2.0 35.0 150 15.83975 18.0 2.0 29.0 2.0 33.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 2.0 5 4.0 6 1.0 7 7.0 8 6.0 9 3.0 10 4.0 11 11.0 12 9.0 13 11.0 14 12.0 15 11.0 16 17.0 17 13.0 18 18.0 19 23.0 20 26.0 21 23.0 22 37.0 23 44.0 24 42.0 25 39.0 26 57.0 27 56.0 28 87.0 29 107.0 30 124.0 31 151.0 32 226.0 33 292.0 34 445.0 35 715.0 36 943.0 37 428.0 38 2.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.974552784076597 18.316956412194507 11.438649533887629 41.269841269841265 2 34.825 23.400000000000002 18.25 23.525 3 24.575 25.525 20.325 29.575000000000003 4 30.175 23.925 19.425 26.474999999999998 5 31.974999999999998 26.150000000000002 18.224999999999998 23.65 6 25.35 30.925000000000004 18.224999999999998 25.5 7 25.374999999999996 16.125 29.575000000000003 28.925 8 27.0 22.125 20.075000000000003 30.8 9 26.575 20.4 24.45 28.575 10-14 28.505000000000003 23.325000000000003 20.18 27.99 15-19 27.725 22.884999999999998 21.12 28.27 20-24 27.950000000000003 22.935 21.015 28.1 25-29 28.775000000000002 22.215 21.335 27.675 30-34 28.23 22.6 21.315 27.855 35-39 28.53 22.27 21.17 28.03 40-44 29.265 21.94 20.765 28.03 45-49 28.26 22.34 21.759999999999998 27.639999999999997 50-54 28.34 22.17 21.529999999999998 27.96 55-59 29.09 21.9 21.715 27.295 60-64 28.194999999999997 22.045 21.54 28.22 65-69 28.955 22.18 21.465 27.400000000000002 70-74 28.875 21.345 21.88 27.900000000000002 75-79 28.52 21.915000000000003 21.67 27.894999999999996 80-84 28.975 22.16 21.645 27.22 85-89 28.74 21.925 21.705 27.63 90-94 28.83 22.055 21.555 27.560000000000002 95-99 28.95 21.925 22.125 27.0 100-104 28.825 21.94 21.73 27.505000000000003 105-109 28.59 22.33 21.98 27.1 110-114 29.065 22.115000000000002 21.785 27.034999999999997 115-119 28.77 22.06 21.47 27.700000000000003 120-124 28.735 22.1 22.53 26.634999999999998 125-129 29.62 22.09 22.025 26.265 130-134 29.630000000000003 21.584999999999997 21.9 26.884999999999998 135-139 29.32 22.615 21.2 26.865 140-144 29.705 22.2 21.279999999999998 26.815 145-149 30.31 21.654999999999998 21.195 26.840000000000003 150 30.525000000000002 21.375 18.55 29.549999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 1.5 29 1.5 30 1.5 31 1.0 32 3.5 33 6.5 34 11.0 35 15.5 36 19.5 37 29.0 38 39.5 39 52.5 40 66.0 41 81.5 42 102.5 43 106.5 44 111.0 45 116.0 46 118.5 47 126.0 48 127.5 49 143.0 50 139.0 51 113.5 52 107.0 53 114.0 54 100.0 55 85.0 56 95.5 57 93.5 58 98.0 59 106.5 60 99.5 61 100.0 62 97.0 63 90.0 64 97.5 65 97.0 66 98.5 67 107.5 68 103.5 69 99.0 70 91.0 71 85.0 72 80.0 73 73.5 74 63.5 75 58.5 76 53.0 77 41.5 78 29.0 79 14.5 80 15.0 81 15.5 82 10.5 83 9.0 84 7.5 85 6.5 86 5.0 87 5.0 88 3.0 89 1.0 90 2.0 91 2.0 92 0.5 93 0.0 94 0.5 95 0.5 96 0.0 97 0.5 98 1.0 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0125 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.0875 0.0 0.0 0.0 0.0 112-113 0.1 0.0 0.0 0.0 0.0 114-115 0.1 0.0 0.0 0.0 0.0 116-117 0.15000000000000002 0.0 0.0 0.0 0.0 118-119 0.275 0.0 0.0 0.0 0.0 120-121 0.3375 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.525 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.7875 0.0 0.0 0.0 0.0 130-131 1.1875 0.0 0.0 0.0 0.0 132-133 1.5750000000000002 0.0 0.0 0.0 0.0 134-135 2.0375 0.0 0.0 0.0 0.0 136-137 2.55 0.0 0.0 0.0 0.0 138 2.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1321996 spots for SRR1797575.sra Written 1321996 spots for SRR1797575.sra Read 1321985 spots for SRR1797575.sra Written 1321985 spots for SRR1797575.sra Read 1321985 spots for SRR1797575.sra Written 1321985 spots for SRR1797575.sra Read 1321985 spots for SRR1797575.sra Written 1321985 spots for SRR1797575.sra Read 1321985 spots for SRR1797575.sra Written 1321985 spots for SRR1797575.sra Read 1321985 spots for SRR1797575.sra Written 1321985 spots for SRR1797575.sra Read 1321985 spots for SRR1797575.sra Written 1321985 spots for SRR1797575.sra Read 1321985 spots for SRR1797575.sra Written 1321985 spots for SRR1797575.sra Read 1321985 spots for SRR1797575.sra Written 1321985 spots for SRR1797575.sra Read 1321985 spots for SRR1797575.sra Written 1321985 spots for SRR1797575.sra Read 1321985 spots for SRR1797575.sra Written 1321985 spots for SRR1797575.sra Read 1321985 spots for SRR1797575.sra Written 1321985 spots for SRR1797575.sra Read 1321985 spots for SRR1797575.sra Written 1321985 spots for SRR1797575.sra Read 1321985 spots for SRR1797575.sra Written 1321985 spots for SRR1797575.sra Read 1321985 spots for SRR1797575.sra Written 1321985 spots for SRR1797575.sra Read 1321985 spots for SRR1797575.sra Written 1321985 spots for SRR1797575.sra Read 1321985 spots for SRR1797575.sra Written 1321985 spots for SRR1797575.sra Read 1321985 spots for SRR1797575.sra Written 1321985 spots for SRR1797575.sra Read 1321985 spots for SRR1797575.sra Written 1321985 spots for SRR1797575.sra Read 1321985 spots for SRR1797575.sra Written 1321985 spots for SRR1797575.sra SRR ids: ['SRR1797575.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__pj2mg9i SRR1797575.sra spots: 26439711 blocks: [[1, 1321985], [1321986, 2643970], [2643971, 3965955], [3965956, 5287940], [5287941, 6609925], [6609926, 7931910], [7931911, 9253895], [9253896, 10575880], [10575881, 11897865], [11897866, 13219850], [13219851, 14541835], [14541836, 15863820], [15863821, 17185805], [17185806, 18507790], [18507791, 19829775], [19829776, 21151760], [21151761, 22473745], [22473746, 23795730], [23795731, 25117715], [25117716, 26439711]] SRR1797575 file size 8886210 SRR1797575 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1797575 SRR1797575_1.fastq SRR1797575_2.fastq Input file: SRR1797575_1.fastq Paired file: SRR1797575_2.fastq trimmed: SRR1797575-trimmed-pair1.fastq, SRR1797575-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 12:59:00 2024 >> started Mon Dec 9 13:00:04 2024 >> done (64.243s) 26439711 read pairs processed; of these: 55805 ( 0.21%) short read pairs filtered out after trimming by size control 29512 ( 0.11%) empty read pairs filtered out after trimming by size control 26354394 (99.68%) read pairs available; of these: 20269978 (76.91%) trimmed read pairs available after processing 6084416 (23.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 28 0.00% 19 36 0.00% 20 71 0.00% 21 93 0.00% 22 180 0.00% 23 235 0.00% 24 298 0.00% 25 400 0.00% 26 482 0.00% 27 520 0.00% 28 648 0.00% 29 814 0.00% 30 889 0.00% 31 1007 0.00% 32 1136 0.00% 33 1315 0.00% 34 1390 0.01% 35 1539 0.01% 36 1689 0.01% 37 1825 0.01% 38 1969 0.01% 39 2070 0.01% 40 2182 0.01% 41 2267 0.01% 42 2446 0.01% 43 2624 0.01% 44 2568 0.01% 45 2850 0.01% 46 2940 0.01% 47 2968 0.01% 48 3110 0.01% 49 3318 0.01% 50 3386 0.01% 51 3686 0.01% 52 3731 0.01% 53 3977 0.02% 54 4229 0.02% 55 4389 0.02% 56 4480 0.02% 57 4807 0.02% 58 5005 0.02% 59 5173 0.02% 60 5411 0.02% 61 5634 0.02% 62 5875 0.02% 63 6127 0.02% 64 6244 0.02% 65 6675 0.03% 66 6985 0.03% 67 7465 0.03% 68 7810 0.03% 69 8160 0.03% 70 8494 0.03% 71 8741 0.03% 72 9430 0.04% 73 10046 0.04% 74 10599 0.04% 75 11417 0.04% 76 12164 0.05% 77 12548 0.05% 78 13469 0.05% 79 14296 0.05% 80 15189 0.06% 81 16240 0.06% 82 17481 0.07% 83 19247 0.07% 84 22923 0.09% 85 24121 0.09% 86 25381 0.10% 87 26584 0.10% 88 27395 0.10% 89 28721 0.11% 90 29673 0.11% 91 30489 0.12% 92 31896 0.12% 93 32263 0.12% 94 33767 0.13% 95 35098 0.13% 96 36574 0.14% 97 37610 0.14% 98 38496 0.15% 99 39459 0.15% 100 40229 0.15% 101 41142 0.16% 102 42821 0.16% 103 45151 0.17% 104 47103 0.18% 105 48933 0.19% 106 52275 0.20% 107 55744 0.21% 108 59097 0.22% 109 63099 0.24% 110 65999 0.25% 111 67725 0.26% 112 71377 0.27% 113 74912 0.28% 114 79976 0.30% 115 90670 0.34% 116 95424 0.36% 117 101242 0.38% 118 105817 0.40% 119 112019 0.43% 120 121045 0.46% 121 130475 0.50% 122 141359 0.54% 123 145579 0.55% 124 153272 0.58% 125 166977 0.63% 126 178137 0.68% 127 203563 0.77% 128 216483 0.82% 129 229282 0.87% 130 250933 0.95% 131 273680 1.04% 132 297123 1.13% 133 321260 1.22% 134 338856 1.29% 135 362421 1.38% 136 390530 1.48% 137 420128 1.59% 138 454031 1.72% 139 491447 1.86% 140 535740 2.03% 141 583768 2.22% 142 642242 2.44% 143 710599 2.70% 144 804409 3.05% 145 942008 3.57% 146 1143105 4.34% 147 1483928 5.63% 148 2021145 7.67% 149 3920731 14.88% 150 6084416 23.09% 26354394 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=69.22 fanout-score-rank=4 prefix-density=0.53 prefix-fanout=18.4 sequence=CGCCGGCGCCGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=244.78 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=27.2 sequence=CGGCGGCGGCGCC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=10.11 fanout-score-rank=18 prefix-density=0.38 prefix-fanout=6.4 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTA criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=218.75 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=25.0 sequence=CCGCCGCCGCCATC SRR1797575 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 13:03:22 Started mapping on | Dec 09 13:03:22 Finished on | Dec 09 13:06:53 Mapping speed, Million of reads per hour | 449.65 Number of input reads | 26354394 Average input read length | 281 UNIQUE READS: Uniquely mapped reads number | 25233842 Uniquely mapped reads % | 95.75% Average mapped length | 280.67 Number of splices: Total | 19657920 Number of splices: Annotated (sjdb) | 18657209 Number of splices: GT/AG | 19418362 Number of splices: GC/AG | 194847 Number of splices: AT/AC | 15922 Number of splices: Non-canonical | 28789 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.35 Insertion rate per base | 0.01% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 291386 % of reads mapped to multiple loci | 1.11% Number of reads mapped to too many loci | 73189 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.09% % of reads unmapped: other | 1.78% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 854556 854556 854556 N_multimapping 291386 291386 291386 N_noFeature 489331 24482694 877631 N_ambiguous 426887 3465 67605 UnstrandedReadsAssigned:24317624 PositiveStrandReadsAssigned:747683 NegativeStrandReadsAssigned:24288606 Dataset is classified negative stranded MeadianReadLen=149 20thPercentileLength=138 echo kmer=133 SRR1797575 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR1797575-trimmed-pair1.fastq SRR1797575-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,354,394 reads, 24,427,769 reads pseudoaligned [quant] estimated average fragment length: 207.707 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,248 rounds 52973 SRR1797575.ke.tsv 35125 SRR1797575.se.tsv 88098 total ==> SRR1797575.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 729.431 13.9537 1.1053 PNS24247 1044 837.293 17.1217 1.18153 PNS24249 1928 1721.29 236.681 7.94482 PNS24246 1044 837.293 17.1217 1.18153 PNS24248 1044 837.293 17.1217 1.18153 PNS24244 1471 1264.29 0 0 PNS24243 293 95.7317 0 0 KQK14069 1603 1396.29 34.6841 1.43526 KQK14071 474 269.085 0.3159 0.0678323 ==> SRR1797575.se.tsv <== BRADI_1g14170v3 34 BRADI_1g53295v3 13 BRADI_1g59795v3 209 BRADI_1g07683v3 0 BRADI_1g00485v3 381 BRADI_1g20270v3 6471 BRADI_1g74790v3 30 BRADI_1g09890v3 21 BRADI_1g77505v3 132 BRADI_1g48960v3 0 SRR1797575 completed mapping pipeline successfully