Starting /dee2/code/volunteer_pipeline.sh SRR1797579 current disk space = 1524983091200 free memory = 1585707680 SRR1797579 SRAfilesize 710cccda9c6d2559595ededdd5b4ae26 SRR1797579.sra SRR1797579.sra file validated SRR1797579 is paired end SRR1797579 is conventional basespace SRR1797579 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1797579_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.24625 34.0 34.0 34.0 31.0 34.0 2 32.9345 34.0 34.0 34.0 31.0 34.0 3 33.3965 34.0 34.0 34.0 31.0 34.0 4 36.7315 37.0 37.0 37.0 35.0 37.0 5 36.75275 37.0 37.0 37.0 37.0 37.0 6 36.75775 37.0 37.0 37.0 37.0 37.0 7 36.77525 37.0 37.0 37.0 37.0 37.0 8 36.772 37.0 37.0 37.0 37.0 37.0 9 38.63 39.0 39.0 39.0 38.0 39.0 10-14 38.99405 39.4 39.4 39.4 38.2 39.4 15-19 40.2706 41.0 40.2 41.0 38.8 41.0 20-24 39.9919 41.0 40.0 41.0 38.0 41.0 25-29 39.7039 41.0 39.8 41.0 37.2 41.0 30-34 39.5099 41.0 39.8 41.0 35.4 41.0 35-39 39.128550000000004 41.0 38.6 41.0 35.0 41.0 40-44 38.4886 40.0 37.0 41.0 35.0 41.0 45-49 37.9991 40.0 35.2 41.0 34.2 41.0 50-54 37.35515 38.8 35.0 41.0 33.4 41.0 55-59 36.52295 37.4 35.0 40.6 32.8 41.0 60-64 35.952 35.8 35.0 39.8 32.0 41.0 65-69 35.440349999999995 35.0 35.0 38.8 32.4 40.8 70-74 34.67895 35.0 34.6 36.8 31.0 39.4 75-79 33.64755 35.0 33.4 35.2 29.8 37.4 80-84 33.3955 35.0 34.0 35.0 30.0 36.4 85-89 32.5257 35.0 33.0 35.0 27.2 35.4 90-94 32.16715000000001 35.0 33.0 35.0 26.6 35.0 95-99 31.596600000000002 34.8 32.2 35.0 24.8 35.0 100-104 31.21855 34.4 31.6 35.0 23.8 35.0 105-109 30.65025 34.0 31.0 35.0 21.0 35.0 110-114 30.14405 34.0 30.4 35.0 19.0 35.0 115-119 29.3986 34.0 29.4 35.0 13.8 35.0 120-124 27.93305 33.0 26.2 35.0 3.2 35.0 125-129 26.84405 32.2 24.6 35.0 2.0 35.0 130-134 25.67275 31.4 21.4 34.2 2.0 35.0 135-139 24.56825 31.0 17.4 34.0 2.0 35.0 140-144 23.194799999999997 30.2 5.4 34.0 2.0 35.0 145-149 20.55895 28.6 2.0 34.0 2.0 35.0 150 13.4365 2.0 2.0 25.0 2.0 31.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 2.0 8 6.0 9 4.0 10 6.0 11 1.0 12 4.0 13 7.0 14 7.0 15 7.0 16 6.0 17 15.0 18 19.0 19 18.0 20 25.0 21 24.0 22 43.0 23 37.0 24 44.0 25 67.0 26 71.0 27 84.0 28 116.0 29 121.0 30 135.0 31 189.0 32 254.0 33 328.0 34 472.0 35 617.0 36 811.0 37 454.0 38 5.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.12610734757686 10.969254820218865 13.053673788431475 43.8509640437728 2 30.475 10.925 22.925 35.675000000000004 3 25.825 11.25 17.299999999999997 45.625 4 29.275000000000002 15.775 15.975 38.975 5 30.9 22.475 19.900000000000002 26.724999999999998 6 34.025 21.025 18.8 26.150000000000002 7 20.75 28.425 28.9 21.925 8 22.25 24.224999999999998 28.599999999999998 24.925 9 24.675 19.775000000000002 27.85 27.700000000000003 10-14 24.546227311365566 24.7912395619781 23.661183059152957 27.001350067503378 15-19 25.924628396977127 22.786647314949203 23.312146539212254 27.97657774886142 20-24 25.665 22.745 23.294999999999998 28.294999999999998 25-29 26.07 22.994999999999997 23.35 27.584999999999997 30-34 25.645 22.445 23.435 28.475 35-39 26.02 22.994999999999997 22.6 28.384999999999998 40-44 25.419999999999998 22.814999999999998 23.11 28.655 45-49 26.105 22.32 22.715 28.860000000000003 50-54 26.105 22.470000000000002 22.33 29.095 55-59 25.96 22.825 22.7 28.515 60-64 26.369999999999997 22.23 22.61 28.79 65-69 26.855 22.395 22.38 28.37 70-74 26.555 22.405 22.41 28.63 75-79 27.02 21.625 22.41 28.945 80-84 26.755000000000003 22.189999999999998 21.98 29.075 85-89 27.455000000000002 21.740000000000002 22.115000000000002 28.689999999999998 90-94 27.425 21.705 22.175 28.694999999999997 95-99 27.185 21.47 22.525000000000002 28.82 100-104 26.895000000000003 21.985 22.195 28.925 105-109 27.655 21.825 21.995 28.525 110-114 27.639999999999997 21.575 22.27 28.515 115-119 27.48 21.349999999999998 21.675 29.494999999999997 120-124 28.199999999999996 21.26 21.365000000000002 29.175 125-129 27.985 21.235 21.61 29.17 130-134 28.294999999999998 21.13 21.48 29.095 135-139 28.89 21.36 21.029999999999998 28.720000000000002 140-144 28.689999999999998 21.279999999999998 20.61 29.42 145-149 28.465 22.34 19.71 29.485 150 28.825 21.675 15.925 33.575 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.5 7 0.5 8 0.5 9 1.5 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 0.5 28 0.0 29 1.5 30 4.5 31 7.5 32 10.0 33 11.5 34 14.5 35 20.5 36 27.0 37 36.5 38 50.0 39 65.0 40 71.5 41 97.0 42 109.5 43 115.5 44 137.5 45 135.0 46 135.5 47 141.0 48 149.0 49 137.0 50 115.0 51 113.0 52 111.5 53 107.5 54 101.5 55 86.0 56 80.5 57 80.0 58 81.0 59 91.5 60 83.0 61 79.0 62 90.5 63 88.0 64 90.0 65 98.0 66 88.0 67 92.0 68 104.0 69 101.5 70 95.5 71 84.5 72 76.0 73 67.0 74 56.0 75 50.0 76 50.5 77 38.5 78 26.5 79 24.0 80 17.0 81 14.5 82 14.0 83 10.0 84 5.5 85 2.5 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.095 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0625 0.0 0.0 0.0 0.0 118-119 0.1375 0.0 0.0 0.0 0.0 120-121 0.175 0.0 0.0 0.0 0.0 122-123 0.3625 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.6375 0.0 0.0 0.0 0.0 128-129 0.85 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.2625 0.0 0.0 0.0 0.0 134-135 1.8125 0.0 0.0 0.0 0.0 136-137 2.3875 0.0 0.0 0.0 0.0 138 2.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGATAA 10 0.0069808904 143.95 4 TTTTTTT 20 0.006149672 28.79 50-54 >>END_MODULE SRR1797579 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR1797579_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 56 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.899 34.0 33.0 34.0 31.0 34.0 2 33.22275 34.0 33.0 34.0 31.0 34.0 3 33.31075 34.0 34.0 34.0 31.0 34.0 4 36.52625 37.0 37.0 37.0 35.0 37.0 5 36.64725 37.0 37.0 37.0 35.0 37.0 6 36.71 37.0 37.0 37.0 37.0 37.0 7 36.73375 37.0 37.0 37.0 37.0 37.0 8 36.70325 37.0 37.0 37.0 37.0 37.0 9 38.5775 39.0 39.0 39.0 38.0 39.0 10-14 38.81614999999999 39.4 39.2 39.4 38.0 39.4 15-19 40.06375 41.0 40.0 41.0 38.4 41.0 20-24 39.823249999999994 41.0 40.0 41.0 38.0 41.0 25-29 39.54425 41.0 39.6 41.0 37.0 41.0 30-34 38.8329 40.0 38.4 41.0 35.0 41.0 35-39 38.5243 40.0 37.6 41.0 35.0 41.0 40-44 37.95175 40.0 35.6 41.0 34.4 41.0 45-49 37.16985 39.2 35.0 41.0 33.0 41.0 50-54 36.1327 37.2 34.8 40.0 32.0 40.8 55-59 35.61355 35.6 34.8 40.0 31.4 41.0 60-64 35.3047 35.0 35.0 39.2 31.6 41.0 65-69 34.73745 35.0 35.0 37.6 31.0 40.6 70-74 33.9129 35.0 34.0 36.2 30.0 39.0 75-79 33.22985 35.0 33.8 35.0 28.8 37.0 80-84 32.4192 35.0 33.0 35.0 27.4 36.0 85-89 31.9498 35.0 33.0 35.0 26.2 35.0 90-94 31.27805 34.8 31.8 35.0 24.0 35.0 95-99 31.01945 34.6 31.6 35.0 22.2 35.0 100-104 30.499000000000002 34.0 30.8 35.0 20.2 35.0 105-109 29.93365 34.0 30.0 35.0 17.8 35.0 110-114 28.732999999999997 33.4 27.8 35.0 9.2 35.0 115-119 28.428800000000003 33.0 27.4 35.0 4.2 35.0 120-124 27.8093 33.0 26.2 35.0 2.0 35.0 125-129 26.385550000000002 32.2 23.8 35.0 2.0 35.0 130-134 25.3624 31.8 20.6 34.6 2.0 35.0 135-139 23.74615 30.8 12.0 34.0 2.0 35.0 140-144 21.985400000000002 29.4 2.0 34.0 2.0 35.0 145-149 19.96695 28.2 2.0 33.8 2.0 35.0 150 14.1015 2.0 2.0 27.0 2.0 32.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 6.0 5 2.0 6 5.0 7 1.0 8 6.0 9 7.0 10 7.0 11 11.0 12 5.0 13 10.0 14 16.0 15 11.0 16 20.0 17 14.0 18 24.0 19 39.0 20 28.0 21 25.0 22 42.0 23 29.0 24 54.0 25 56.0 26 69.0 27 94.0 28 104.0 29 141.0 30 186.0 31 187.0 32 278.0 33 304.0 34 503.0 35 656.0 36 702.0 37 350.0 38 5.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.793579132179588 17.05543014798094 10.18309505894156 43.96789566089792 2 36.875 22.475 16.85 23.799999999999997 3 23.775 25.974999999999998 21.375 28.875 4 29.95 22.875 19.625 27.55 5 31.05 26.775 18.85 23.325000000000003 6 26.825 31.35 16.925 24.9 7 26.575 16.625 29.575000000000003 27.224999999999998 8 28.175 20.175 21.15 30.5 9 25.974999999999998 20.0 24.55 29.475 10-14 29.03 23.244999999999997 20.32 27.405 15-19 28.65 22.259999999999998 21.58 27.51 20-24 28.125 22.75 21.560000000000002 27.565 25-29 28.910000000000004 22.095000000000002 20.880000000000003 28.115000000000002 30-34 28.77 22.535 21.634999999999998 27.060000000000002 35-39 29.080000000000002 21.959999999999997 21.154999999999998 27.805000000000003 40-44 29.555 21.545 21.065 27.834999999999997 45-49 28.705000000000002 22.189999999999998 21.64 27.465 50-54 29.765000000000004 21.805 21.279999999999998 27.150000000000002 55-59 29.709999999999997 21.84 20.875 27.575 60-64 28.73 21.98 21.48 27.810000000000002 65-69 28.76 22.33 21.43 27.48 70-74 29.154999999999998 22.2 21.135 27.51 75-79 28.7 21.535 21.55 28.215 80-84 29.054999999999996 22.345000000000002 21.2 27.400000000000002 85-89 29.154999999999998 21.38 21.765 27.700000000000003 90-94 29.425 21.9 21.560000000000002 27.115000000000002 95-99 29.34 22.085 21.22 27.355 100-104 29.185 21.875 21.48 27.46 105-109 29.104999999999997 22.49 21.29 27.115000000000002 110-114 29.354999999999997 22.759999999999998 21.27 26.615 115-119 29.29 22.220000000000002 20.95 27.54 120-124 29.03 22.29 21.625 27.055 125-129 29.794999999999998 22.615 20.835 26.755000000000003 130-134 29.770000000000003 22.025 20.974999999999998 27.229999999999997 135-139 30.305 22.455 21.23 26.009999999999998 140-144 30.415 22.509999999999998 20.495 26.58 145-149 31.545 22.82 20.07 25.564999999999998 150 32.125 22.45 17.275 28.15 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 0.5 28 2.5 29 3.5 30 5.0 31 7.0 32 7.0 33 8.5 34 11.5 35 18.5 36 25.5 37 28.0 38 39.0 39 51.5 40 63.5 41 86.0 42 97.0 43 98.5 44 110.5 45 113.5 46 126.0 47 126.0 48 104.5 49 108.0 50 117.5 51 108.5 52 99.5 53 99.5 54 102.5 55 100.0 56 95.5 57 86.5 58 87.5 59 96.0 60 98.5 61 95.5 62 92.0 63 101.5 64 105.5 65 112.5 66 108.5 67 117.5 68 119.5 69 95.5 70 90.5 71 92.5 72 88.0 73 82.0 74 75.0 75 65.5 76 51.0 77 41.0 78 33.5 79 22.0 80 12.0 81 11.5 82 15.0 83 11.5 84 6.5 85 4.0 86 3.0 87 3.0 88 3.0 89 1.0 90 0.5 91 1.0 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.0875 0.0 0.0 0.0 0.0 118-119 0.16249999999999998 0.0 0.0 0.0 0.0 120-121 0.2 0.0 0.0 0.0 0.0 122-123 0.375 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.6625 0.0 0.0 0.0 0.0 128-129 0.9 0.0 0.0 0.0 0.0 130-131 1.025 0.0 0.0 0.0 0.0 132-133 1.35 0.0 0.0 0.0 0.0 134-135 1.8625 0.0 0.0 0.0 0.0 136-137 2.4375 0.0 0.0 0.0 0.0 138 3.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCACAT 10 0.006973645 144.0 1 >>END_MODULE Read 1167391 spots for SRR1797579.sra Written 1167391 spots for SRR1797579.sra Read 1167391 spots for SRR1797579.sra Written 1167391 spots for SRR1797579.sra Read 1167391 spots for SRR1797579.sra Written 1167391 spots for SRR1797579.sra Read 1167391 spots for SRR1797579.sra Written 1167391 spots for SRR1797579.sra Read 1167391 spots for SRR1797579.sra Written 1167391 spots for SRR1797579.sra Read 1167392 spots for SRR1797579.sra Written 1167392 spots for SRR1797579.sra Read 1167391 spots for SRR1797579.sra Written 1167391 spots for SRR1797579.sra Read 1167391 spots for SRR1797579.sra Written 1167391 spots for SRR1797579.sra Read 1167391 spots for SRR1797579.sra Written 1167391 spots for SRR1797579.sra Read 1167391 spots for SRR1797579.sra Written 1167391 spots for SRR1797579.sra Read 1167391 spots for SRR1797579.sra Written 1167391 spots for SRR1797579.sra Read 1167391 spots for SRR1797579.sra Written 1167391 spots for SRR1797579.sra Read 1167391 spots for SRR1797579.sra Written 1167391 spots for SRR1797579.sra Read 1167391 spots for SRR1797579.sra Written 1167391 spots for SRR1797579.sra Read 1167391 spots for SRR1797579.sra Written 1167391 spots for SRR1797579.sra Read 1167391 spots for SRR1797579.sra Written 1167391 spots for SRR1797579.sra Read 1167391 spots for SRR1797579.sra Written 1167391 spots for SRR1797579.sra Read 1167391 spots for SRR1797579.sra Written 1167391 spots for SRR1797579.sra Read 1167391 spots for SRR1797579.sra Written 1167391 spots for SRR1797579.sra Read 1167391 spots for SRR1797579.sra Written 1167391 spots for SRR1797579.sra SRR ids: ['SRR1797579.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pli_v4oq SRR1797579.sra spots: 23347821 blocks: [[1, 1167391], [1167392, 2334782], [2334783, 3502173], [3502174, 4669564], [4669565, 5836955], [5836956, 7004346], [7004347, 8171737], [8171738, 9339128], [9339129, 10506519], [10506520, 11673910], [11673911, 12841301], [12841302, 14008692], [14008693, 15176083], [15176084, 16343474], [16343475, 17510865], [17510866, 18678256], [18678257, 19845647], [19845648, 21013038], [21013039, 22180429], [22180430, 23347821]] SRR1797579 file size 7844508 SRR1797579 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR1797579 SRR1797579_1.fastq SRR1797579_2.fastq Input file: SRR1797579_1.fastq Paired file: SRR1797579_2.fastq trimmed: SRR1797579-trimmed-pair1.fastq, SRR1797579-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 13:42:11 2024 >> started Mon Dec 9 13:43:55 2024 >> done (103.628s) 23347821 read pairs processed; of these: 46106 ( 0.20%) short read pairs filtered out after trimming by size control 28635 ( 0.12%) empty read pairs filtered out after trimming by size control 23273080 (99.68%) read pairs available; of these: 18693162 (80.32%) trimmed read pairs available after processing 4579918 (19.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 32 0.00% 20 50 0.00% 21 90 0.00% 22 139 0.00% 23 190 0.00% 24 217 0.00% 25 279 0.00% 26 338 0.00% 27 422 0.00% 28 548 0.00% 29 655 0.00% 30 686 0.00% 31 823 0.00% 32 988 0.00% 33 1028 0.00% 34 1175 0.01% 35 1302 0.01% 36 1399 0.01% 37 1463 0.01% 38 1641 0.01% 39 1704 0.01% 40 1880 0.01% 41 1927 0.01% 42 2043 0.01% 43 2217 0.01% 44 2352 0.01% 45 2426 0.01% 46 2663 0.01% 47 2804 0.01% 48 2872 0.01% 49 2978 0.01% 50 3154 0.01% 51 3366 0.01% 52 3467 0.01% 53 3694 0.02% 54 3834 0.02% 55 4108 0.02% 56 4331 0.02% 57 4455 0.02% 58 4809 0.02% 59 4917 0.02% 60 5141 0.02% 61 5326 0.02% 62 5691 0.02% 63 6029 0.03% 64 6430 0.03% 65 6632 0.03% 66 7089 0.03% 67 7504 0.03% 68 7771 0.03% 69 8284 0.04% 70 8627 0.04% 71 9177 0.04% 72 9718 0.04% 73 10261 0.04% 74 11038 0.05% 75 11518 0.05% 76 12477 0.05% 77 13212 0.06% 78 13851 0.06% 79 14784 0.06% 80 15958 0.07% 81 17082 0.07% 82 18227 0.08% 83 19485 0.08% 84 23485 0.10% 85 24865 0.11% 86 25859 0.11% 87 27529 0.12% 88 28855 0.12% 89 30143 0.13% 90 30886 0.13% 91 32721 0.14% 92 33599 0.14% 93 34826 0.15% 94 36240 0.16% 95 37968 0.16% 96 39950 0.17% 97 40927 0.18% 98 42705 0.18% 99 44708 0.19% 100 46234 0.20% 101 48317 0.21% 102 50702 0.22% 103 53076 0.23% 104 55586 0.24% 105 59744 0.26% 106 64024 0.28% 107 68556 0.29% 108 73793 0.32% 109 77330 0.33% 110 81609 0.35% 111 85665 0.37% 112 88815 0.38% 113 93683 0.40% 114 102131 0.44% 115 113974 0.49% 116 120418 0.52% 117 127269 0.55% 118 130822 0.56% 119 138437 0.59% 120 147481 0.63% 121 167193 0.72% 122 177401 0.76% 123 187068 0.80% 124 191437 0.82% 125 199158 0.86% 126 228373 0.98% 127 237111 1.02% 128 247943 1.07% 129 257000 1.10% 130 290609 1.25% 131 313732 1.35% 132 335297 1.44% 133 358607 1.54% 134 370699 1.59% 135 386715 1.66% 136 410285 1.76% 137 433778 1.86% 138 459634 1.97% 139 491948 2.11% 140 522109 2.24% 141 556273 2.39% 142 596018 2.56% 143 638594 2.74% 144 704674 3.03% 145 792583 3.41% 146 923288 3.97% 147 1138284 4.89% 148 1500549 6.45% 149 2883069 12.39% 150 4579918 19.68% 23273080 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=4.05 fanout-score-rank=18 prefix-density=0.34 prefix-fanout=3.7 sequence=TGCCGCACTTGCAG criterion=fanout-score sequence-density=0.17 sequence-density-rank=8 fanout-score=129.10 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=23.7 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=37 prefix-density=0.33 prefix-fanout=2.6 sequence=GGGCGCCGTCGA criterion=fanout-score sequence-density=0.15 sequence-density-rank=28 fanout-score=243.14 fanout-score-rank=1 prefix-density=1.75 prefix-fanout=21.0 sequence=CGGCGGCGGCGCC SRR1797579 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 13:47:26 Started mapping on | Dec 09 13:47:26 Finished on | Dec 09 13:52:45 Mapping speed, Million of reads per hour | 262.64 Number of input reads | 23273080 Average input read length | 276 UNIQUE READS: Uniquely mapped reads number | 22258388 Uniquely mapped reads % | 95.64% Average mapped length | 276.34 Number of splices: Total | 16707813 Number of splices: Annotated (sjdb) | 15769538 Number of splices: GT/AG | 16489399 Number of splices: GC/AG | 181828 Number of splices: AT/AC | 8420 Number of splices: Non-canonical | 28166 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.64 Insertion rate per base | 0.01% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 336040 % of reads mapped to multiple loci | 1.44% Number of reads mapped to too many loci | 64490 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.88% % of reads unmapped: other | 1.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 702322 702322 702322 N_multimapping 336040 336040 336040 N_noFeature 560868 21469929 995914 N_ambiguous 418939 2759 67530 UnstrandedReadsAssigned:21278581 PositiveStrandReadsAssigned:785700 NegativeStrandReadsAssigned:21194944 Dataset is classified negative stranded MeadianReadLen=149 20thPercentileLength=135 echo kmer=131 SRR1797579 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR1797579-trimmed-pair1.fastq SRR1797579-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,273,080 reads, 21,332,701 reads pseudoaligned [quant] estimated average fragment length: 207.487 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52973 SRR1797579.ke.tsv 35125 SRR1797579.se.tsv 88098 total ==> SRR1797579.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 729.728 0 0 PNS24247 1044 837.513 20.9221 1.55343 PNS24249 1928 1721.51 287.751 10.3941 PNS24246 1044 837.513 20.9221 1.55343 PNS24248 1044 837.513 20.9221 1.55343 PNS24244 1471 1264.51 63.4827 3.12184 PNS24243 293 95.714 0 0 KQK14069 1603 1396.51 3864.03 172.058 KQK14071 474 269.165 197.328 45.5878 ==> SRR1797579.se.tsv <== BRADI_1g14170v3 4162 BRADI_1g53295v3 105 BRADI_1g59795v3 308 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 373 BRADI_1g74790v3 392 BRADI_1g09890v3 0 BRADI_1g77505v3 275 BRADI_1g48960v3 3 SRR1797579 completed mapping pipeline successfully