Starting /dee2/code/volunteer_pipeline.sh SRR18694356 current disk space = 1525879914496 free memory = 1556563492 SRR18694356 SRAfilesize fe294c31f5fa4c398512e9fdca7a7091 SRR18694356.sra SRR18694356.sra file validated SRR18694356 is paired end SRR18694356 is conventional basespace SRR18694356 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694356_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2475 37.0 37.0 37.0 37.0 37.0 2 36.03425 37.0 37.0 37.0 37.0 37.0 3 36.482 37.0 37.0 37.0 37.0 37.0 4 36.5645 37.0 37.0 37.0 37.0 37.0 5 36.5425 37.0 37.0 37.0 37.0 37.0 6 36.5655 37.0 37.0 37.0 37.0 37.0 7 36.548 37.0 37.0 37.0 37.0 37.0 8 36.562 37.0 37.0 37.0 37.0 37.0 9 36.701 37.0 37.0 37.0 37.0 37.0 10-14 36.6222 37.0 37.0 37.0 37.0 37.0 15-19 36.666000000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.6808 37.0 37.0 37.0 37.0 37.0 25-29 36.5909 37.0 37.0 37.0 37.0 37.0 30-34 36.579600000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.7176 37.0 37.0 37.0 37.0 37.0 40-44 36.657799999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.508799999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.5789 37.0 37.0 37.0 37.0 37.0 55-59 36.565999999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.5642 37.0 37.0 37.0 37.0 37.0 65-69 36.34069999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.44 37.0 37.0 37.0 37.0 37.0 75-79 36.5373 37.0 37.0 37.0 37.0 37.0 80-84 36.463 37.0 37.0 37.0 37.0 37.0 85-89 36.249199999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.461400000000005 37.0 37.0 37.0 29.8 37.0 95-99 36.1791 37.0 37.0 37.0 37.0 37.0 100-104 36.177400000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.1969 37.0 37.0 37.0 37.0 37.0 110-114 36.263 37.0 37.0 37.0 37.0 37.0 115-119 36.4956 37.0 37.0 37.0 37.0 37.0 120-124 36.6259 37.0 37.0 37.0 37.0 37.0 125-129 36.5799 37.0 37.0 37.0 37.0 37.0 130-134 36.564499999999995 37.0 37.0 37.0 37.0 37.0 135-139 36.5163 37.0 37.0 37.0 37.0 37.0 140-144 36.32899999999999 37.0 37.0 37.0 37.0 37.0 145-149 36.2721 37.0 37.0 37.0 37.0 37.0 150-151 33.688 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 1.0 26 2.0 27 0.0 28 1.0 29 3.0 30 4.0 31 14.0 32 28.0 33 52.0 34 104.0 35 295.0 36 3291.0 37 202.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.3 9.125 5.325 36.25 2 21.720591923752195 10.107850514171055 37.12064208678204 31.050915475294712 3 20.549999999999997 13.125 25.674999999999997 40.65 4 27.325 21.775 21.625 29.275000000000002 5 26.825 26.05 24.675 22.45 6 24.975 28.849999999999998 22.575 23.599999999999998 7 18.05 24.349999999999998 39.85 17.75 8 20.275000000000002 23.275000000000002 31.15 25.3 9 19.1 20.7 33.550000000000004 26.650000000000002 10-14 22.49 26.255 26.345000000000002 24.91 15-19 23.28 24.85 26.16 25.71 20-24 23.205000000000002 24.715 26.325 25.755 25-29 23.135 25.27 25.895000000000003 25.7 30-34 23.799999999999997 24.82 25.09 26.290000000000003 35-39 23.21 24.555 26.205000000000002 26.029999999999998 40-44 22.605 25.115 26.005 26.275 45-49 22.66 25.235000000000003 25.25 26.855 50-54 23.294999999999998 25.245 25.669999999999998 25.790000000000003 55-59 23.595 25.319999999999997 25.185000000000002 25.900000000000002 60-64 23.494999999999997 25.05 25.525 25.929999999999996 65-69 23.115 24.925 25.919999999999998 26.040000000000003 70-74 24.0 25.34 25.040000000000003 25.619999999999997 75-79 23.599999999999998 24.65 25.035 26.715 80-84 22.745 25.569999999999997 26.090000000000003 25.595000000000002 85-89 24.01 24.44 25.765 25.785000000000004 90-94 23.61 25.145 24.785 26.46 95-99 23.285 25.324999999999996 25.765 25.624999999999996 100-104 23.75 25.055 25.46 25.735000000000003 105-109 24.07 24.7 25.490000000000002 25.740000000000002 110-114 23.990000000000002 24.825 25.7 25.485000000000003 115-119 23.53 25.380000000000003 25.615 25.474999999999998 120-124 23.785 25.205 24.98 26.029999999999998 125-129 23.52 25.319999999999997 25.155 26.005 130-134 24.285 24.965 24.94 25.81 135-139 24.169999999999998 24.79 25.790000000000003 25.25 140-144 23.905 25.575 24.725 25.795 145-149 23.845 25.869999999999997 24.565 25.72 150-151 23.8875 24.9875 25.112499999999997 26.0125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 2.0 26 2.0 27 2.5 28 4.5 29 4.0 30 6.0 31 10.0 32 12.5 33 10.5 34 14.0 35 29.5 36 39.5 37 54.0 38 76.0 39 90.5 40 105.5 41 136.0 42 166.5 43 172.0 44 173.0 45 187.5 46 209.0 47 217.5 48 195.0 49 175.5 50 159.5 51 139.0 52 127.5 53 137.5 54 134.0 55 116.5 56 126.5 57 123.0 58 120.5 59 109.5 60 88.0 61 77.5 62 72.5 63 63.0 64 56.0 65 52.5 66 46.0 67 40.0 68 34.0 69 26.0 70 16.0 71 12.5 72 9.5 73 7.0 74 2.0 75 1.5 76 2.5 77 1.5 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.625 #Duplication Level Percentage of deduplicated Percentage of total 1 84.75627769571639 71.72500000000001 2 12.821270310192023 21.7 3 2.06794682422452 5.25 4 0.2658788774002954 0.8999999999999999 5 0.059084194977843424 0.25 6 0.0 0.0 7 0.029542097488921712 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACGGAGCCAAAAGATCATTGAATAATGACCAAGTGACATCAACAAACTT 7 0.17500000000000002 No Hit CTCACATTGGAAGGATTTTCCTTGACCCTTGCCTCCCCAGATACCCAAGA 5 0.125 No Hit GTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCGGAACCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.48750000000000004 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.8875 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.8125 0.0 0.0 0.0 0.0 118-119 3.2874999999999996 0.0 0.0 0.0 0.0 120-121 3.5875000000000004 0.0 0.0 0.0 0.0 122-123 3.825 0.0 0.0 0.0 0.0 124-125 4.0875 0.0 0.0 0.0 0.0 126-127 4.4875 0.0 0.0 0.0 0.0 128-129 4.8375 0.0 0.0 0.0 0.0 130-131 5.3125 0.0 0.0 0.0 0.0 132-133 5.9 0.0 0.0 0.0 0.0 134-135 6.9125 0.0 0.0 0.0 0.0 136-137 7.7375 0.0 0.0 0.0 0.0 138-139 8.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCATC 10 0.006830828 145.0 7 AATACAT 10 0.006830828 145.0 7 >>END_MODULE SRR18694356 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694356_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.332 37.0 37.0 37.0 25.0 37.0 2 35.385 37.0 37.0 37.0 37.0 37.0 3 35.3435 37.0 37.0 37.0 25.0 37.0 4 35.4575 37.0 37.0 37.0 37.0 37.0 5 35.4955 37.0 37.0 37.0 37.0 37.0 6 35.607 37.0 37.0 37.0 37.0 37.0 7 35.519 37.0 37.0 37.0 37.0 37.0 8 35.6355 37.0 37.0 37.0 37.0 37.0 9 35.723 37.0 37.0 37.0 37.0 37.0 10-14 35.6373 37.0 37.0 37.0 37.0 37.0 15-19 35.7269 37.0 37.0 37.0 37.0 37.0 20-24 35.614 37.0 37.0 37.0 37.0 37.0 25-29 35.602000000000004 37.0 37.0 37.0 34.6 37.0 30-34 35.9291 37.0 37.0 37.0 37.0 37.0 35-39 35.726099999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.48459999999999 37.0 37.0 37.0 37.0 37.0 45-49 35.6169 37.0 37.0 37.0 37.0 37.0 50-54 35.0861 37.0 37.0 37.0 32.2 37.0 55-59 34.471199999999996 37.0 37.0 37.0 25.0 37.0 60-64 35.194100000000006 37.0 37.0 37.0 27.4 37.0 65-69 34.3804 37.0 34.6 37.0 29.8 37.0 70-74 33.056 37.0 29.8 37.0 25.0 37.0 75-79 33.5789 37.0 34.6 37.0 22.2 37.0 80-84 34.638400000000004 37.0 37.0 37.0 25.0 37.0 85-89 32.7229 37.0 32.2 37.0 19.4 37.0 90-94 34.18169999999999 37.0 37.0 37.0 25.0 37.0 95-99 34.005399999999995 37.0 37.0 37.0 25.0 37.0 100-104 33.517900000000004 37.0 37.0 37.0 25.0 37.0 105-109 34.269400000000005 37.0 37.0 37.0 25.0 37.0 110-114 34.6071 37.0 37.0 37.0 25.0 37.0 115-119 34.5553 37.0 37.0 37.0 25.0 37.0 120-124 34.28340000000001 37.0 37.0 37.0 25.0 37.0 125-129 34.130199999999995 37.0 37.0 37.0 25.0 37.0 130-134 33.9205 37.0 34.6 37.0 25.0 37.0 135-139 32.3912 37.0 27.4 37.0 13.8 37.0 140-144 31.793 37.0 25.0 37.0 11.0 37.0 145-149 31.365299999999998 37.0 25.0 37.0 13.8 37.0 150-151 31.150000000000002 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 3.0 18 4.0 19 3.0 20 2.0 21 2.0 22 2.0 23 3.0 24 5.0 25 11.0 26 10.0 27 14.0 28 25.0 29 31.0 30 55.0 31 126.0 32 236.0 33 545.0 34 1170.0 35 1515.0 36 237.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.65 20.849999999999998 7.725 27.775 2 29.425 22.225 28.475 19.875 3 22.15 23.9 30.075000000000003 23.875 4 28.275 30.725 20.375 20.625 5 29.25 32.375 18.85 19.525000000000002 6 22.725 35.225 19.8 22.25 7 22.35 21.15 33.525 22.975 8 23.0 24.075 26.0 26.924999999999997 9 25.05 21.375 27.35 26.224999999999998 10-14 26.540000000000003 26.69 23.02 23.75 15-19 26.169999999999998 24.97 24.349999999999998 24.51 20-24 26.775 25.635 23.94 23.65 25-29 25.555 25.535000000000004 24.310000000000002 24.6 30-34 26.155 25.445 24.104999999999997 24.295 35-39 25.11 25.919999999999998 24.205 24.765 40-44 26.605 25.509999999999998 24.11 23.775 45-49 25.77 24.81 24.825 24.595 50-54 24.675 25.715 25.495 24.115000000000002 55-59 26.265 24.93 24.695 24.11 60-64 25.77 25.545 24.575 24.11 65-69 25.94 26.27 23.905 23.885 70-74 26.3 25.255 24.055 24.39 75-79 27.02 24.035 24.59 24.355 80-84 25.290000000000003 25.765 24.560000000000002 24.385 85-89 23.49 27.939999999999998 24.575 23.995 90-94 25.419999999999998 25.775 24.779999999999998 24.025 95-99 25.36 25.635 25.11 23.895 100-104 26.26 25.145 24.92 23.674999999999997 105-109 25.82 25.5 25.195 23.485 110-114 26.495 25.95 24.065 23.49 115-119 26.765 25.795 24.154999999999998 23.285 120-124 26.355 25.88 24.545 23.22 125-129 26.735 26.025 24.415 22.825 130-134 27.02 25.485000000000003 24.695 22.8 135-139 27.200000000000003 26.16 24.709999999999997 21.93 140-144 27.97 26.72 23.61 21.7 145-149 27.565 26.02 24.54 21.875 150-151 25.8625 26.424999999999997 25.5625 22.15 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 0.5 25 0.5 26 0.5 27 2.0 28 2.5 29 4.0 30 5.0 31 6.5 32 12.0 33 20.5 34 28.0 35 25.0 36 31.5 37 56.0 38 80.5 39 101.0 40 109.0 41 119.0 42 145.5 43 159.0 44 181.0 45 184.5 46 178.5 47 182.0 48 167.0 49 176.5 50 161.0 51 140.5 52 145.5 53 134.0 54 130.0 55 127.5 56 116.0 57 112.5 58 114.0 59 115.5 60 111.0 61 98.5 62 89.0 63 80.5 64 66.5 65 57.0 66 49.0 67 39.0 68 35.0 69 27.5 70 18.5 71 13.0 72 8.5 73 6.0 74 6.0 75 4.5 76 2.0 77 1.0 78 0.0 79 0.5 80 1.5 81 1.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.275 #Duplication Level Percentage of deduplicated Percentage of total 1 86.81541582150102 74.9 2 11.185163720660677 19.3 3 1.5068096203998842 3.9 4 0.34772529701535787 1.2 5 0.08693132425383947 0.375 6 0.028977108084613158 0.15 7 0.028977108084613158 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGTGGACTATCTTGATTTCCAAAAATCTTATAAACAAGCTGCAGGATCT 7 0.17500000000000002 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 6 0.15 No Hit CCAGGCCATTGTCACCGGCAAGGGCCCCCTCGAGAACCTTGCCGACCACC 5 0.125 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.1749999999999998 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.5875000000000004 0.0 0.0 0.0 0.0 118-119 3.0625 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.5999999999999996 0.0 0.0 0.0 0.0 124-125 3.875 0.0 0.0 0.0 0.0 126-127 4.2625 0.0 0.0 0.0 0.0 128-129 4.6125 0.0 0.0 0.0 0.0 130-131 5.0875 0.0 0.0 0.0 0.0 132-133 5.6875 0.0 0.0 0.0 0.0 134-135 6.6875 0.0 0.0 0.0 0.0 136-137 7.5 0.0 0.0 0.0 0.0 138-139 8.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCAACG 10 0.006830828 145.0 7 >>END_MODULE Read 433296 spots for SRR18694356.sra Written 433296 spots for SRR18694356.sra Read 433296 spots for SRR18694356.sra Written 433296 spots for SRR18694356.sra Read 433296 spots for SRR18694356.sra Written 433296 spots for SRR18694356.sra Read 433296 spots for SRR18694356.sra Written 433296 spots for SRR18694356.sra Read 433296 spots for SRR18694356.sra Written 433296 spots for SRR18694356.sra Read 433296 spots for SRR18694356.sra Written 433296 spots for SRR18694356.sra Read 433296 spots for SRR18694356.sra Written 433296 spots for SRR18694356.sra Read 433311 spots for SRR18694356.sra Written 433311 spots for SRR18694356.sra Read 433296 spots for SRR18694356.sra Written 433296 spots for SRR18694356.sra Read 433296 spots for SRR18694356.sra Written 433296 spots for SRR18694356.sra Read 433296 spots for SRR18694356.sra Written 433296 spots for SRR18694356.sra Read 433296 spots for SRR18694356.sra Written 433296 spots for SRR18694356.sra Read 433296 spots for SRR18694356.sra Written 433296 spots for SRR18694356.sra Read 433296 spots for SRR18694356.sra Written 433296 spots for SRR18694356.sra Read 433296 spots for SRR18694356.sra Written 433296 spots for SRR18694356.sra Read 433296 spots for SRR18694356.sra Written 433296 spots for SRR18694356.sra Read 433296 spots for SRR18694356.sra Written 433296 spots for SRR18694356.sra Read 433296 spots for SRR18694356.sra Written 433296 spots for SRR18694356.sra Read 433296 spots for SRR18694356.sra Written 433296 spots for SRR18694356.sra Read 433296 spots for SRR18694356.sra Written 433296 spots for SRR18694356.sra SRR ids: ['SRR18694356.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j51h13sj SRR18694356.sra spots: 8665935 blocks: [[1, 433296], [433297, 866592], [866593, 1299888], [1299889, 1733184], [1733185, 2166480], [2166481, 2599776], [2599777, 3033072], [3033073, 3466368], [3466369, 3899664], [3899665, 4332960], [4332961, 4766256], [4766257, 5199552], [5199553, 5632848], [5632849, 6066144], [6066145, 6499440], [6499441, 6932736], [6932737, 7366032], [7366033, 7799328], [7799329, 8232624], [8232625, 8665935]] SRR18694356 file size 2925969 SRR18694356 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694356 SRR18694356_1.fastq SRR18694356_2.fastq Input file: SRR18694356_1.fastq Paired file: SRR18694356_2.fastq trimmed: SRR18694356-trimmed-pair1.fastq, SRR18694356-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:49:21 2024 >> started Tue Dec 10 05:49:32 2024 >> done (10.179s) 8665935 read pairs processed; of these: 108 ( 0.00%) short read pairs filtered out after trimming by size control 474 ( 0.01%) empty read pairs filtered out after trimming by size control 8665353 (99.99%) read pairs available; of these: 1081029 (12.48%) trimmed read pairs available after processing 7584324 (87.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 11 0.00% 20 17 0.00% 21 12 0.00% 22 16 0.00% 23 9 0.00% 24 6 0.00% 25 9 0.00% 26 12 0.00% 27 15 0.00% 28 20 0.00% 29 15 0.00% 30 14 0.00% 31 7 0.00% 32 17 0.00% 33 12 0.00% 34 18 0.00% 35 31 0.00% 36 25 0.00% 37 21 0.00% 38 23 0.00% 39 19 0.00% 40 25 0.00% 41 20 0.00% 42 23 0.00% 43 34 0.00% 44 31 0.00% 45 36 0.00% 46 40 0.00% 47 26 0.00% 48 56 0.00% 49 56 0.00% 50 57 0.00% 51 44 0.00% 52 63 0.00% 53 85 0.00% 54 72 0.00% 55 75 0.00% 56 75 0.00% 57 87 0.00% 58 115 0.00% 59 121 0.00% 60 148 0.00% 61 158 0.00% 62 189 0.00% 63 222 0.00% 64 217 0.00% 65 270 0.00% 66 282 0.00% 67 316 0.00% 68 337 0.00% 69 403 0.00% 70 420 0.00% 71 488 0.01% 72 554 0.01% 73 687 0.01% 74 751 0.01% 75 844 0.01% 76 865 0.01% 77 1002 0.01% 78 1118 0.01% 79 1207 0.01% 80 1459 0.02% 81 1505 0.02% 82 1751 0.02% 83 1948 0.02% 84 2142 0.02% 85 2399 0.03% 86 2595 0.03% 87 2727 0.03% 88 2968 0.03% 89 3199 0.04% 90 3518 0.04% 91 3992 0.05% 92 4295 0.05% 93 4491 0.05% 94 5120 0.06% 95 5276 0.06% 96 5535 0.06% 97 5865 0.07% 98 6106 0.07% 99 6751 0.08% 100 6932 0.08% 101 7349 0.08% 102 7788 0.09% 103 8403 0.10% 104 8818 0.10% 105 8899 0.10% 106 9464 0.11% 107 9807 0.11% 108 10388 0.12% 109 11008 0.13% 110 11174 0.13% 111 11722 0.14% 112 12601 0.15% 113 12832 0.15% 114 13824 0.16% 115 14116 0.16% 116 14610 0.17% 117 15023 0.17% 118 15361 0.18% 119 15863 0.18% 120 16771 0.19% 121 16972 0.20% 122 17290 0.20% 123 18753 0.22% 124 19026 0.22% 125 19818 0.23% 126 19961 0.23% 127 20638 0.24% 128 20896 0.24% 129 21931 0.25% 130 22057 0.25% 131 21721 0.25% 132 23592 0.27% 133 24210 0.28% 134 23782 0.27% 135 25467 0.29% 136 25787 0.30% 137 25738 0.30% 138 25494 0.29% 139 26964 0.31% 140 27137 0.31% 141 27228 0.31% 142 28507 0.33% 143 28908 0.33% 144 30384 0.35% 145 30956 0.36% 146 30568 0.35% 147 31975 0.37% 148 31803 0.37% 149 32101 0.37% 150 33014 0.38% 151 7584324 87.52% 8665353 reads passed initial QC criterion=sequence-density sequence-density=1.10 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=12 prefix-density=1.14 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.20 sequence-density-rank=20 fanout-score=11.81 fanout-score-rank=1 prefix-density=1.13 prefix-fanout=2.1 sequence=TGTTGTCGAAGTCGTACTTCCTTAGGCCCTGGCTGATGTACTCTTGGGAGCTGAGGACGGCCACGTGGGTACCGTCGCCCATGGGCGCCTGGAAGAGCGAGTCGACGATACCCTTCCCCCTGGTGATGTCCTGCTGGTCGTCGGAGATATCGTAGGCGAGGCCCTTCCACCTGTCCTGGTCAGTCTGCTTTGACTCGTCCACCTCCTTGGCCATGACTGTGAATCTGTTGGCCTTGGTGCTCTTGCCATGGTAGTTCACGGCCGAGGTCACCTGCTTCTTGAGCTTCTTCCCAAGGAAGCTGGTTGGCGTAGAAGCCGGAGCTCCGACGGTGGACGAGAAGGTAGCAGACATCTCTGCTCTGCTTGGTCTGATCTGGATTAAGATTTTTCAGATGATCAAGTAATGGCTG criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=3.49 fanout-score-rank=12 prefix-density=0.91 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=38.77 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=10.4 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR18694356 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:50:17 Started mapping on | Dec 10 05:50:18 Finished on | Dec 10 05:51:10 Mapping speed, Million of reads per hour | 599.91 Number of input reads | 8665353 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 7846354 Uniquely mapped reads % | 90.55% Average mapped length | 294.93 Number of splices: Total | 8423821 Number of splices: Annotated (sjdb) | 7927412 Number of splices: GT/AG | 8309382 Number of splices: GC/AG | 98263 Number of splices: AT/AC | 3063 Number of splices: Non-canonical | 13113 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.01% Deletion average length | 2.35 Insertion rate per base | 0.01% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 267996 % of reads mapped to multiple loci | 3.09% Number of reads mapped to too many loci | 38833 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.28% % of reads unmapped: other | 3.63% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 551003 551003 551003 N_multimapping 267996 267996 267996 N_noFeature 441001 7647645 495855 N_ambiguous 172766 949 29318 UnstrandedReadsAssigned:7232587 PositiveStrandReadsAssigned:197760 NegativeStrandReadsAssigned:7321181 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694356 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694356-trimmed-pair1.fastq SRR18694356-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,665,353 reads, 7,465,339 reads pseudoaligned [quant] estimated average fragment length: 250.036 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,047 rounds 52973 SRR18694356.ke.tsv 35125 SRR18694356.se.tsv 88098 total ==> SRR18694356.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 687.456 0 0 PNS24247 1044 794.964 16.3517 3.99458 PNS24249 1928 1678.96 13.1965 1.52642 PNS24246 1044 794.964 16.3517 3.99458 PNS24248 1044 794.964 16.3517 3.99458 PNS24244 1471 1221.96 47.7486 7.58854 PNS24243 293 98.2516 0 0 KQK14069 1603 1353.96 602.451 86.4113 KQK14071 474 244.857 0 0 ==> SRR18694356.se.tsv <== BRADI_1g14170v3 635 BRADI_1g53295v3 31 BRADI_1g59795v3 239 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 148 BRADI_1g74790v3 52 BRADI_1g09890v3 0 BRADI_1g77505v3 89 BRADI_1g48960v3 0 SRR18694356 completed mapping pipeline successfully