Starting /dee2/code/volunteer_pipeline.sh SRR18694357 current disk space = 1525879894016 free memory = 1602398376 SRR18694357 SRAfilesize e06c0c3fe6ff8da0ce76db37332f62f5 SRR18694357.sra SRR18694357.sra file validated SRR18694357 is paired end SRR18694357 is conventional basespace SRR18694357 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694357_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.981 37.0 37.0 37.0 37.0 37.0 2 36.26375 37.0 37.0 37.0 37.0 37.0 3 36.5165 37.0 37.0 37.0 37.0 37.0 4 36.671 37.0 37.0 37.0 37.0 37.0 5 36.6185 37.0 37.0 37.0 37.0 37.0 6 36.5615 37.0 37.0 37.0 37.0 37.0 7 36.5745 37.0 37.0 37.0 37.0 37.0 8 36.658 37.0 37.0 37.0 37.0 37.0 9 36.645 37.0 37.0 37.0 37.0 37.0 10-14 36.6742 37.0 37.0 37.0 37.0 37.0 15-19 36.6557 37.0 37.0 37.0 37.0 37.0 20-24 36.6764 37.0 37.0 37.0 37.0 37.0 25-29 36.6068 37.0 37.0 37.0 37.0 37.0 30-34 36.5612 37.0 37.0 37.0 37.0 37.0 35-39 36.6914 37.0 37.0 37.0 37.0 37.0 40-44 36.6428 37.0 37.0 37.0 37.0 37.0 45-49 36.4918 37.0 37.0 37.0 37.0 37.0 50-54 36.5536 37.0 37.0 37.0 37.0 37.0 55-59 36.5823 37.0 37.0 37.0 37.0 37.0 60-64 36.51989999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.332100000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.450900000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.5168 37.0 37.0 37.0 37.0 37.0 80-84 36.4564 37.0 37.0 37.0 37.0 37.0 85-89 36.239999999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.443599999999996 37.0 37.0 37.0 29.8 37.0 95-99 36.1693 37.0 37.0 37.0 37.0 37.0 100-104 36.2345 37.0 37.0 37.0 37.0 37.0 105-109 36.2407 37.0 37.0 37.0 37.0 37.0 110-114 36.3052 37.0 37.0 37.0 37.0 37.0 115-119 36.52289999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.61579999999999 37.0 37.0 37.0 37.0 37.0 125-129 36.6126 37.0 37.0 37.0 37.0 37.0 130-134 36.5452 37.0 37.0 37.0 37.0 37.0 135-139 36.4507 37.0 37.0 37.0 37.0 37.0 140-144 36.3234 37.0 37.0 37.0 37.0 37.0 145-149 36.2367 37.0 37.0 37.0 37.0 37.0 150-151 33.699 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 2.0 26 2.0 27 1.0 28 3.0 29 8.0 30 8.0 31 11.0 32 18.0 33 46.0 34 97.0 35 304.0 36 3270.0 37 228.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.375 9.55 5.125 47.949999999999996 2 18.65129105038857 10.002506893958385 40.78716470293307 30.55903735271998 3 17.8 12.375 25.6 44.224999999999994 4 28.749999999999996 19.2 20.225 31.825 5 28.275 25.174999999999997 24.95 21.6 6 23.200000000000003 28.199999999999996 22.55 26.05 7 19.875 25.074999999999996 36.85 18.2 8 20.9 22.5 31.775 24.825 9 18.725 20.8 35.225 25.25 10-14 23.22 25.75 25.69 25.34 15-19 23.64 24.15 25.765 26.445 20-24 23.24 24.705 25.395 26.66 25-29 24.044999999999998 24.104999999999997 25.629999999999995 26.22 30-34 23.27 24.145 25.619999999999997 26.965 35-39 23.064999999999998 24.240000000000002 25.759999999999998 26.935 40-44 24.0 24.224999999999998 25.665 26.11 45-49 23.75 24.16 25.330000000000002 26.76 50-54 22.99 24.6 26.200000000000003 26.21 55-59 23.605 24.54 25.540000000000003 26.314999999999998 60-64 23.515 24.215 26.085 26.185000000000002 65-69 23.71 24.995 25.245 26.05 70-74 24.025 24.86 25.0 26.115 75-79 24.04 24.45 24.529999999999998 26.979999999999997 80-84 23.87 24.39 25.115 26.625 85-89 24.169999999999998 24.875 24.97 25.985000000000003 90-94 24.709999999999997 24.445 25.045 25.8 95-99 23.755000000000003 24.365000000000002 25.490000000000002 26.39 100-104 24.19 25.285000000000004 24.6 25.924999999999997 105-109 24.665 23.765 25.275 26.295 110-114 23.835 25.25 24.815 26.1 115-119 24.59 24.325 25.05 26.035000000000004 120-124 24.575 24.5 24.85 26.075 125-129 24.505 25.074999999999996 24.490000000000002 25.929999999999996 130-134 24.560000000000002 24.775 24.295 26.369999999999997 135-139 24.315 25.05 24.26 26.375 140-144 24.490000000000002 25.169999999999998 24.03 26.31 145-149 24.025 25.165 24.26 26.55 150-151 24.8 25.0375 23.8875 26.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 3.5 28 5.0 29 6.5 30 7.0 31 7.5 32 13.0 33 14.5 34 16.5 35 27.5 36 36.5 37 48.0 38 68.0 39 86.5 40 105.0 41 118.0 42 141.0 43 162.5 44 173.0 45 188.0 46 197.5 47 194.0 48 171.0 49 158.5 50 166.0 51 160.5 52 143.5 53 137.0 54 123.5 55 110.5 56 118.0 57 119.5 58 114.5 59 111.0 60 95.0 61 85.0 62 74.0 63 73.0 64 75.5 65 65.0 66 49.0 67 40.0 68 45.5 69 36.5 70 21.0 71 16.0 72 21.5 73 19.0 74 9.5 75 8.0 76 5.5 77 2.5 78 1.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.675 #Duplication Level Percentage of deduplicated Percentage of total 1 86.28538079953312 73.925 2 11.380215932302304 19.5 3 1.779982491975489 4.575 4 0.46688065363291503 1.6 5 0.05836008170411438 0.25 6 0.02918004085205719 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TATATATTAGCTGGATGAGCATAACTCCATTCCCCTTCTATCAGACGGAT 6 0.15 No Hit CTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTATTAATCATTACT 5 0.125 No Hit CCCTTCTGACGCTTCCCGTTTATCGCATTGGCTCTCAGCTGGCTCAGGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.44999999999999996 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.075 0.0 0.0 0.0 0.0 96-97 1.2625 0.0 0.0 0.0 0.0 98-99 1.4625 0.0 0.0 0.0 0.0 100-101 1.6625 0.0 0.0 0.0 0.0 102-103 1.9375 0.0 0.0 0.0 0.0 104-105 2.3125 0.0 0.0 0.0 0.0 106-107 2.4749999999999996 0.0 0.0 0.0 0.0 108-109 2.8 0.0 0.0 0.0 0.0 110-111 3.175 0.0 0.0 0.0 0.0 112-113 3.5125 0.0 0.0 0.0 0.0 114-115 3.7875 0.0 0.0 0.0 0.0 116-117 4.1875 0.0 0.0 0.0 0.0 118-119 4.6 0.0 0.0 0.0 0.0 120-121 5.1 0.0 0.0 0.0 0.0 122-123 5.475 0.0 0.0 0.0 0.0 124-125 5.925 0.0 0.0 0.0 0.0 126-127 6.6375 0.0 0.0 0.0 0.0 128-129 7.300000000000001 0.0 0.0 0.0 0.0 130-131 8.037500000000001 0.0 0.0 0.0 0.0 132-133 8.8625 0.0 0.0 0.0 0.0 134-135 9.5375 0.0 0.0 0.0 0.0 136-137 10.2375 0.0 0.0 0.0 0.0 138-139 11.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGAAC 10 0.006830828 145.0 5 >>END_MODULE SRR18694357 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694357_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.334 37.0 37.0 37.0 25.0 37.0 2 35.1595 37.0 37.0 37.0 25.0 37.0 3 35.206 37.0 37.0 37.0 25.0 37.0 4 35.579 37.0 37.0 37.0 37.0 37.0 5 35.409 37.0 37.0 37.0 37.0 37.0 6 35.5165 37.0 37.0 37.0 37.0 37.0 7 35.503 37.0 37.0 37.0 37.0 37.0 8 35.745 37.0 37.0 37.0 37.0 37.0 9 35.826 37.0 37.0 37.0 37.0 37.0 10-14 35.82 37.0 37.0 37.0 37.0 37.0 15-19 35.815200000000004 37.0 37.0 37.0 37.0 37.0 20-24 35.6706 37.0 37.0 37.0 37.0 37.0 25-29 35.7485 37.0 37.0 37.0 34.6 37.0 30-34 35.9596 37.0 37.0 37.0 37.0 37.0 35-39 35.82469999999999 37.0 37.0 37.0 37.0 37.0 40-44 35.59140000000001 37.0 37.0 37.0 34.6 37.0 45-49 35.7543 37.0 37.0 37.0 37.0 37.0 50-54 35.2315 37.0 37.0 37.0 32.2 37.0 55-59 34.5546 37.0 37.0 37.0 25.0 37.0 60-64 35.2134 37.0 37.0 37.0 27.4 37.0 65-69 34.407399999999996 37.0 34.6 37.0 29.8 37.0 70-74 33.09320000000001 37.0 29.8 37.0 22.2 37.0 75-79 33.7675 37.0 34.6 37.0 22.2 37.0 80-84 34.771699999999996 37.0 37.0 37.0 25.0 37.0 85-89 32.8365 37.0 32.2 37.0 19.4 37.0 90-94 34.39919999999999 37.0 37.0 37.0 25.0 37.0 95-99 34.273 37.0 37.0 37.0 25.0 37.0 100-104 33.6631 37.0 37.0 37.0 25.0 37.0 105-109 34.41680000000001 37.0 37.0 37.0 25.0 37.0 110-114 34.777 37.0 37.0 37.0 25.0 37.0 115-119 34.7456 37.0 37.0 37.0 25.0 37.0 120-124 34.3481 37.0 37.0 37.0 25.0 37.0 125-129 34.281400000000005 37.0 37.0 37.0 25.0 37.0 130-134 34.0005 37.0 37.0 37.0 25.0 37.0 135-139 32.3561 37.0 27.4 37.0 13.8 37.0 140-144 31.739099999999997 37.0 25.0 37.0 11.0 37.0 145-149 31.2608 37.0 25.0 37.0 13.8 37.0 150-151 31.070500000000003 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 1.0 18 0.0 19 1.0 20 3.0 21 5.0 22 2.0 23 3.0 24 3.0 25 6.0 26 5.0 27 7.0 28 10.0 29 37.0 30 67.0 31 129.0 32 217.0 33 513.0 34 1157.0 35 1568.0 36 264.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.425000000000004 19.875 7.9750000000000005 36.725 2 28.575 22.925 29.825000000000003 18.675 3 20.95 24.575 29.775000000000002 24.7 4 27.450000000000003 29.325000000000003 20.575 22.650000000000002 5 29.299999999999997 32.550000000000004 19.025 19.125 6 22.0 38.0 19.35 20.65 7 23.150000000000002 19.025 34.075 23.75 8 21.425 21.575 26.950000000000003 30.049999999999997 9 23.05 20.7 30.8 25.45 10-14 26.56 25.525 23.05 24.865000000000002 15-19 26.889999999999997 24.565 23.5 25.045 20-24 26.91 25.695 23.32 24.075 25-29 25.979999999999997 25.285000000000004 23.615 25.119999999999997 30-34 26.674999999999997 25.585 23.345 24.395 35-39 25.88 25.595000000000002 23.974999999999998 24.55 40-44 26.695 25.21 23.845 24.25 45-49 27.02 24.77 23.505000000000003 24.705 50-54 25.27 24.87 25.2 24.66 55-59 26.029999999999998 25.045 23.68 25.245 60-64 26.340000000000003 24.45 24.12 25.09 65-69 26.284999999999997 24.610000000000003 24.495 24.610000000000003 70-74 26.240000000000002 24.65 23.765 25.345000000000002 75-79 27.845 23.015 25.195 23.945 80-84 26.495 24.92 24.185000000000002 24.4 85-89 24.37 27.455000000000002 23.525 24.65 90-94 26.5 25.44 23.895 24.165 95-99 26.36 24.68 24.445 24.515 100-104 26.86 25.15 24.145 23.845 105-109 26.424999999999997 25.135 24.52 23.919999999999998 110-114 27.215 25.465 23.830000000000002 23.49 115-119 27.310000000000002 25.285000000000004 23.535 23.87 120-124 26.605 25.96 24.065 23.369999999999997 125-129 27.589999999999996 25.935000000000002 23.150000000000002 23.325000000000003 130-134 27.66 25.380000000000003 23.71 23.25 135-139 27.72 25.509999999999998 23.880000000000003 22.89 140-144 28.244999999999997 25.455 23.244999999999997 23.055 145-149 28.53 25.535000000000004 23.200000000000003 22.735 150-151 27.1375 25.2375 25.25 22.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 1.5 25 0.5 26 2.0 27 2.5 28 4.0 29 4.5 30 5.5 31 9.0 32 10.5 33 11.5 34 14.5 35 30.0 36 39.5 37 49.0 38 65.0 39 81.5 40 101.0 41 124.0 42 141.5 43 149.0 44 168.5 45 174.0 46 172.0 47 178.0 48 168.5 49 163.5 50 148.0 51 135.0 52 140.0 53 122.5 54 121.5 55 129.5 56 118.5 57 121.5 58 109.5 59 102.5 60 109.0 61 101.5 62 102.0 63 93.5 64 75.0 65 67.0 66 65.0 67 54.0 68 51.5 69 45.5 70 32.0 71 23.5 72 15.5 73 10.0 74 8.0 75 8.5 76 6.0 77 3.5 78 1.0 79 1.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.275 #Duplication Level Percentage of deduplicated Percentage of total 1 87.45291219936252 75.44999999999999 2 10.460736018545349 18.05 3 1.4198782961460445 3.675 4 0.4346566212691973 1.5 5 0.028977108084613158 0.125 6 0.08693132425383947 0.44999999999999996 7 0.08693132425383947 0.525 8 0.0 0.0 9 0.028977108084613158 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 9 0.22499999999999998 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 7 0.17500000000000002 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 7 0.17500000000000002 No Hit CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 7 0.17500000000000002 No Hit CAACAACGCCTGGGCCTTCGCCACCAACTTCGTCCCCGGCAAGTGAGCTT 6 0.15 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 6 0.15 No Hit GAACGATGCTCCGAGATCGCATACAGCGAAGAAGAGGAGATGGTGGCCGT 6 0.15 No Hit GTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.8500000000000001 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.6125 0.0 0.0 0.0 0.0 102-103 1.8875000000000002 0.0 0.0 0.0 0.0 104-105 2.2625 0.0 0.0 0.0 0.0 106-107 2.4125 0.0 0.0 0.0 0.0 108-109 2.7375 0.0 0.0 0.0 0.0 110-111 3.125 0.0 0.0 0.0 0.0 112-113 3.4625 0.0 0.0 0.0 0.0 114-115 3.7375 0.0 0.0 0.0 0.0 116-117 4.1125 0.0 0.0 0.0 0.0 118-119 4.525 0.0 0.0 0.0 0.0 120-121 4.9625 0.0 0.0 0.0 0.0 122-123 5.324999999999999 0.0 0.0 0.0 0.0 124-125 5.775 0.0 0.0 0.0 0.0 126-127 6.4625 0.0 0.0 0.0 0.0 128-129 7.112500000000001 0.0 0.0 0.0 0.0 130-131 7.824999999999999 0.0 0.0 0.0 0.0 132-133 8.6375 0.0 0.0 0.0 0.0 134-135 9.3125 0.0 0.0 0.0 0.0 136-137 10.0 0.0 0.0 0.0 0.0 138-139 10.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 423016 spots for SRR18694357.sra Written 423016 spots for SRR18694357.sra Read 423016 spots for SRR18694357.sra Written 423016 spots for SRR18694357.sra Read 423016 spots for SRR18694357.sra Written 423016 spots for SRR18694357.sra Read 423016 spots for SRR18694357.sra Written 423016 spots for SRR18694357.sra Read 423016 spots for SRR18694357.sra Written 423016 spots for SRR18694357.sra Read 423016 spots for SRR18694357.sra Written 423016 spots for SRR18694357.sra Read 423016 spots for SRR18694357.sra Written 423016 spots for SRR18694357.sra Read 423016 spots for SRR18694357.sra Written 423016 spots for SRR18694357.sra Read 423016 spots for SRR18694357.sra Written 423016 spots for SRR18694357.sra Read 423016 spots for SRR18694357.sra Written 423016 spots for SRR18694357.sra Read 423016 spots for SRR18694357.sra Written 423016 spots for SRR18694357.sra Read 423016 spots for SRR18694357.sra Written 423016 spots for SRR18694357.sra Read 423016 spots for SRR18694357.sra Written 423016 spots for SRR18694357.sra Read 423016 spots for SRR18694357.sra Written 423016 spots for SRR18694357.sra Read 423016 spots for SRR18694357.sra Written 423016 spots for SRR18694357.sra Read 423016 spots for SRR18694357.sra Written 423016 spots for SRR18694357.sra Read 423016 spots for SRR18694357.sra Written 423016 spots for SRR18694357.sra Read 423016 spots for SRR18694357.sra Written 423016 spots for SRR18694357.sra Read 423016 spots for SRR18694357.sra Written 423016 spots for SRR18694357.sra Read 423030 spots for SRR18694357.sra Written 423030 spots for SRR18694357.sra SRR ids: ['SRR18694357.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zzivp7va SRR18694357.sra spots: 8460334 blocks: [[1, 423016], [423017, 846032], [846033, 1269048], [1269049, 1692064], [1692065, 2115080], [2115081, 2538096], [2538097, 2961112], [2961113, 3384128], [3384129, 3807144], [3807145, 4230160], [4230161, 4653176], [4653177, 5076192], [5076193, 5499208], [5499209, 5922224], [5922225, 6345240], [6345241, 6768256], [6768257, 7191272], [7191273, 7614288], [7614289, 8037304], [8037305, 8460334]] SRR18694357 file size 2856498 SRR18694357 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694357 SRR18694357_1.fastq SRR18694357_2.fastq Input file: SRR18694357_1.fastq Paired file: SRR18694357_2.fastq trimmed: SRR18694357-trimmed-pair1.fastq, SRR18694357-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:54:28 2024 >> started Tue Dec 10 05:54:38 2024 >> done (9.485s) 8460334 read pairs processed; of these: 84 ( 0.00%) short read pairs filtered out after trimming by size control 1004 ( 0.01%) empty read pairs filtered out after trimming by size control 8459246 (99.99%) read pairs available; of these: 1296378 (15.32%) trimmed read pairs available after processing 7162868 (84.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 3 0.00% 20 9 0.00% 21 10 0.00% 22 10 0.00% 23 11 0.00% 24 7 0.00% 25 7 0.00% 26 12 0.00% 27 21 0.00% 28 9 0.00% 29 13 0.00% 30 15 0.00% 31 15 0.00% 32 12 0.00% 33 20 0.00% 34 11 0.00% 35 16 0.00% 36 18 0.00% 37 29 0.00% 38 29 0.00% 39 17 0.00% 40 24 0.00% 41 29 0.00% 42 32 0.00% 43 29 0.00% 44 21 0.00% 45 27 0.00% 46 22 0.00% 47 41 0.00% 48 29 0.00% 49 47 0.00% 50 49 0.00% 51 59 0.00% 52 86 0.00% 53 89 0.00% 54 85 0.00% 55 103 0.00% 56 122 0.00% 57 116 0.00% 58 174 0.00% 59 160 0.00% 60 203 0.00% 61 232 0.00% 62 292 0.00% 63 280 0.00% 64 342 0.00% 65 354 0.00% 66 409 0.00% 67 496 0.01% 68 543 0.01% 69 594 0.01% 70 665 0.01% 71 793 0.01% 72 935 0.01% 73 1044 0.01% 74 1078 0.01% 75 1213 0.01% 76 1464 0.02% 77 1555 0.02% 78 1690 0.02% 79 1972 0.02% 80 2224 0.03% 81 2381 0.03% 82 2838 0.03% 83 2933 0.03% 84 3270 0.04% 85 3561 0.04% 86 3867 0.05% 87 4170 0.05% 88 4480 0.05% 89 4864 0.06% 90 5092 0.06% 91 5502 0.07% 92 5921 0.07% 93 6288 0.07% 94 6904 0.08% 95 7284 0.09% 96 7588 0.09% 97 8093 0.10% 98 8302 0.10% 99 8782 0.10% 100 9423 0.11% 101 9803 0.12% 102 10113 0.12% 103 10820 0.13% 104 11401 0.13% 105 11653 0.14% 106 12236 0.14% 107 12949 0.15% 108 13281 0.16% 109 13982 0.17% 110 14436 0.17% 111 14565 0.17% 112 15549 0.18% 113 16171 0.19% 114 16627 0.20% 115 17396 0.21% 116 18091 0.21% 117 18316 0.22% 118 18936 0.22% 119 19745 0.23% 120 20620 0.24% 121 20805 0.25% 122 21133 0.25% 123 22223 0.26% 124 22535 0.27% 125 23236 0.27% 126 23559 0.28% 127 24670 0.29% 128 24906 0.29% 129 25577 0.30% 130 25715 0.30% 131 26468 0.31% 132 27787 0.33% 133 28037 0.33% 134 28491 0.34% 135 28778 0.34% 136 29522 0.35% 137 29624 0.35% 138 29849 0.35% 139 31421 0.37% 140 31204 0.37% 141 31781 0.38% 142 32510 0.38% 143 33113 0.39% 144 33868 0.40% 145 34375 0.41% 146 33775 0.40% 147 34979 0.41% 148 35488 0.42% 149 36473 0.43% 150 36219 0.43% 151 7162868 84.68% 8459246 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=12 prefix-density=0.83 prefix-fanout=2.1 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.17 sequence-density-rank=25 fanout-score=13.13 fanout-score-rank=1 prefix-density=1.08 prefix-fanout=2.0 sequence=TGTTGTCGAAGTCGTACTTCCTTAGGCCCTGGCTGATGTACTCTTGGGAGCTGAGGACGGCCACGTGGGTACCGTCGCCCATGGGCGCCTGGAAGAGCGAGTCGACGATACCCTTCCCCCTGGTGATGTCCTGCTGGTCGTCGGAGATATCGTAGGCGAGGCCCTTCCACCTGTCCTGGTCAGTCTGCTTTGACTCGTCCACCTCCTTGGCCATGACTGTGAATCTGTTGGCCTTGGTGCTCTTGCCATGGTAGTTCACGGCCGAGGTCACCTGCTTCTTGAGCTTCTTCCCAAGGAAGCTGGTTGGCGTAGAAGCCGGAGCTCCGACGGTGGACGAGAAGGTAGCAGACATCTCTGCTCTGCTTGGTCTGATCTGGATTAAGATTTTTCAGATGATCAAGTAATGGC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=3.65 fanout-score-rank=10 prefix-density=0.82 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=68.50 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=10.3 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR18694357 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:55:25 Started mapping on | Dec 10 05:55:25 Finished on | Dec 10 05:56:19 Mapping speed, Million of reads per hour | 563.95 Number of input reads | 8459246 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 7628940 Uniquely mapped reads % | 90.18% Average mapped length | 293.30 Number of splices: Total | 8004136 Number of splices: Annotated (sjdb) | 7521729 Number of splices: GT/AG | 7894783 Number of splices: GC/AG | 93380 Number of splices: AT/AC | 3166 Number of splices: Non-canonical | 12807 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 2.32 Insertion rate per base | 0.01% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 275536 % of reads mapped to multiple loci | 3.26% Number of reads mapped to too many loci | 46583 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.99% % of reads unmapped: other | 4.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 554770 554770 554770 N_multimapping 275536 275536 275536 N_noFeature 428049 7433542 483135 N_ambiguous 167874 935 27943 UnstrandedReadsAssigned:7033017 PositiveStrandReadsAssigned:194463 NegativeStrandReadsAssigned:7117862 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694357 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694357-trimmed-pair1.fastq SRR18694357-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,459,246 reads, 7,265,700 reads pseudoaligned [quant] estimated average fragment length: 239.905 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,057 rounds 52973 SRR18694357.ke.tsv 35125 SRR18694357.se.tsv 88098 total ==> SRR18694357.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 697.54 0 0 PNS24247 1044 805.095 22.4099 5.50799 PNS24249 1928 1689.1 27.6823 3.24301 PNS24246 1044 805.095 22.4099 5.50799 PNS24248 1044 805.095 22.4099 5.50799 PNS24244 1471 1232.1 16.0879 2.58377 PNS24243 293 103.359 0 0 KQK14069 1603 1364.1 678.945 98.4896 KQK14071 474 252.302 9.425 7.39198 ==> SRR18694357.se.tsv <== BRADI_1g14170v3 724 BRADI_1g53295v3 36 BRADI_1g59795v3 291 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 143 BRADI_1g74790v3 35 BRADI_1g09890v3 0 BRADI_1g77505v3 89 BRADI_1g48960v3 0 SRR18694357 completed mapping pipeline successfully