Starting /dee2/code/volunteer_pipeline.sh SRR18694358 current disk space = 1525878341632 free memory = 1570629784 SRR18694358 SRAfilesize eeac43a1ca22658ec9d0180476a630eb SRR18694358.sra SRR18694358.sra file validated SRR18694358 is paired end SRR18694358 is conventional basespace SRR18694358 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694358_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0585 37.0 37.0 37.0 37.0 37.0 2 36.11875 37.0 37.0 37.0 37.0 37.0 3 36.466 37.0 37.0 37.0 37.0 37.0 4 36.522 37.0 37.0 37.0 37.0 37.0 5 36.593 37.0 37.0 37.0 37.0 37.0 6 36.527 37.0 37.0 37.0 37.0 37.0 7 36.585 37.0 37.0 37.0 37.0 37.0 8 36.619 37.0 37.0 37.0 37.0 37.0 9 36.632 37.0 37.0 37.0 37.0 37.0 10-14 36.6292 37.0 37.0 37.0 37.0 37.0 15-19 36.6258 37.0 37.0 37.0 37.0 37.0 20-24 36.669200000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.558499999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.5082 37.0 37.0 37.0 37.0 37.0 35-39 36.6585 37.0 37.0 37.0 37.0 37.0 40-44 36.5983 37.0 37.0 37.0 37.0 37.0 45-49 36.42 37.0 37.0 37.0 37.0 37.0 50-54 36.501999999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.528999999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.505100000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.2987 37.0 37.0 37.0 37.0 37.0 70-74 36.3996 37.0 37.0 37.0 37.0 37.0 75-79 36.4837 37.0 37.0 37.0 37.0 37.0 80-84 36.362399999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.1599 37.0 37.0 37.0 37.0 37.0 90-94 35.389300000000006 37.0 37.0 37.0 29.8 37.0 95-99 36.11990000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.1179 37.0 37.0 37.0 37.0 37.0 105-109 36.1284 37.0 37.0 37.0 37.0 37.0 110-114 36.16799999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.4837 37.0 37.0 37.0 37.0 37.0 120-124 36.534499999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.5142 37.0 37.0 37.0 37.0 37.0 130-134 36.4388 37.0 37.0 37.0 37.0 37.0 135-139 36.3887 37.0 37.0 37.0 37.0 37.0 140-144 36.198699999999995 37.0 37.0 37.0 37.0 37.0 145-149 36.182900000000004 37.0 37.0 37.0 37.0 37.0 150-151 33.783500000000004 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 0.0 25 1.0 26 3.0 27 3.0 28 2.0 29 5.0 30 13.0 31 12.0 32 20.0 33 54.0 34 128.0 35 342.0 36 3264.0 37 151.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.975 9.975000000000001 5.225 44.824999999999996 2 19.4785660566558 10.930057658561044 39.583855602907995 30.007520681875157 3 19.0 14.524999999999999 23.9 42.575 4 26.424999999999997 19.675 21.575 32.324999999999996 5 26.825 27.575 23.200000000000003 22.400000000000002 6 22.05 30.675 24.625 22.650000000000002 7 18.7 25.2 38.35 17.75 8 18.95 23.150000000000002 32.0 25.900000000000002 9 19.35 21.25 34.525 24.875 10-14 22.345000000000002 27.455000000000002 25.805 24.395 15-19 22.835 25.564999999999998 25.97 25.629999999999995 20-24 22.68 25.785000000000004 26.455000000000002 25.080000000000002 25-29 22.785 25.580000000000002 26.029999999999998 25.605 30-34 22.29 24.92 26.39 26.400000000000002 35-39 22.314999999999998 25.055 26.834999999999997 25.795 40-44 22.255 25.525 26.090000000000003 26.13 45-49 22.615 24.945 26.369999999999997 26.07 50-54 22.919999999999998 25.905 25.795 25.380000000000003 55-59 22.759999999999998 25.335 26.045 25.86 60-64 22.33 25.88 26.19 25.6 65-69 22.400000000000002 25.275 26.935 25.39 70-74 23.35 25.345000000000002 26.095000000000002 25.21 75-79 22.405 25.495 25.835 26.265 80-84 22.470000000000002 25.290000000000003 26.07 26.169999999999998 85-89 22.43 26.115 26.33 25.124999999999996 90-94 22.68 25.655 25.905 25.759999999999998 95-99 22.770000000000003 25.855 25.8 25.575 100-104 22.85 25.88 25.650000000000002 25.619999999999997 105-109 22.68 25.5 26.619999999999997 25.2 110-114 22.965 25.72 25.455 25.86 115-119 23.369999999999997 25.205 25.515 25.91 120-124 22.884999999999998 25.905 25.595000000000002 25.615 125-129 23.415 25.41 25.105 26.07 130-134 22.935 25.424999999999997 25.885 25.755 135-139 23.47 25.474999999999998 25.88 25.174999999999997 140-144 23.305 24.834999999999997 26.32 25.540000000000003 145-149 23.555 25.85 25.085 25.509999999999998 150-151 23.275000000000002 26.337500000000002 24.5 25.887500000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 2.5 28 2.0 29 2.5 30 3.0 31 4.5 32 12.0 33 19.5 34 18.5 35 27.0 36 43.5 37 58.5 38 74.5 39 98.0 40 119.5 41 147.5 42 174.0 43 171.5 44 189.0 45 219.5 46 226.5 47 217.5 48 219.5 49 214.5 50 193.5 51 176.5 52 162.0 53 144.5 54 119.5 55 117.0 56 116.0 57 106.5 58 88.0 59 64.5 60 58.5 61 60.5 62 54.0 63 55.0 64 50.5 65 40.0 66 36.0 67 21.5 68 18.5 69 16.0 70 9.0 71 5.5 72 4.0 73 7.0 74 6.0 75 2.5 76 1.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 87.0874348581355 75.2 2 10.62536189924725 18.35 3 1.8239722061378112 4.725 4 0.37637521713954836 1.3 5 0.028951939779965255 0.125 6 0.05790387955993051 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAACCCTGGACGTTTCAGTGACCATACCGTCACTTGTTGTTTCAACCTG 6 0.15 No Hit GTCCTTCTTCCGGTTCTTCTTTGATGGTTTTTCAGATTTTTCAGTCCTGT 6 0.15 No Hit CCTAATGTAAGATAATACAAAGGTGCCTGGGTGCTCATGAGATATGCCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.7875 0.0 0.0 0.0 0.0 118-119 2.1375 0.0 0.0 0.0 0.0 120-121 2.4124999999999996 0.0 0.0 0.0 0.0 122-123 2.7 0.0 0.0 0.0 0.0 124-125 2.9000000000000004 0.0 0.0 0.0 0.0 126-127 3.3 0.0 0.0 0.0 0.0 128-129 3.825 0.0 0.0 0.0 0.0 130-131 4.199999999999999 0.0 0.0 0.0 0.0 132-133 4.5625 0.0 0.0 0.0 0.0 134-135 4.925 0.0 0.0 0.0 0.0 136-137 5.425000000000001 0.0 0.0 0.0 0.0 138-139 5.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTATCTG 10 0.006830828 145.0 4 >>END_MODULE SRR18694358 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694358_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.1075 37.0 37.0 37.0 25.0 37.0 2 35.0495 37.0 37.0 37.0 25.0 37.0 3 35.0015 37.0 37.0 37.0 25.0 37.0 4 35.0835 37.0 37.0 37.0 25.0 37.0 5 35.0965 37.0 37.0 37.0 25.0 37.0 6 35.1855 37.0 37.0 37.0 25.0 37.0 7 35.2915 37.0 37.0 37.0 25.0 37.0 8 35.4925 37.0 37.0 37.0 37.0 37.0 9 35.3835 37.0 37.0 37.0 37.0 37.0 10-14 35.5362 37.0 37.0 37.0 37.0 37.0 15-19 35.5894 37.0 37.0 37.0 37.0 37.0 20-24 35.395100000000006 37.0 37.0 37.0 34.6 37.0 25-29 35.559200000000004 37.0 37.0 37.0 32.2 37.0 30-34 35.7573 37.0 37.0 37.0 37.0 37.0 35-39 35.6003 37.0 37.0 37.0 34.6 37.0 40-44 35.3332 37.0 37.0 37.0 29.8 37.0 45-49 35.4862 37.0 37.0 37.0 32.2 37.0 50-54 35.006600000000006 37.0 37.0 37.0 32.2 37.0 55-59 34.3157 37.0 37.0 37.0 25.0 37.0 60-64 35.048700000000004 37.0 37.0 37.0 27.4 37.0 65-69 34.263099999999994 37.0 34.6 37.0 27.4 37.0 70-74 33.1026 37.0 29.8 37.0 22.2 37.0 75-79 33.5551 37.0 34.6 37.0 22.2 37.0 80-84 34.5993 37.0 37.0 37.0 25.0 37.0 85-89 32.7488 37.0 32.2 37.0 19.4 37.0 90-94 34.1597 37.0 37.0 37.0 25.0 37.0 95-99 33.954699999999995 37.0 37.0 37.0 25.0 37.0 100-104 33.448899999999995 37.0 37.0 37.0 25.0 37.0 105-109 34.186 37.0 37.0 37.0 25.0 37.0 110-114 34.538 37.0 37.0 37.0 25.0 37.0 115-119 34.4498 37.0 37.0 37.0 25.0 37.0 120-124 34.126 37.0 37.0 37.0 25.0 37.0 125-129 34.0822 37.0 37.0 37.0 25.0 37.0 130-134 33.6837 37.0 34.6 37.0 25.0 37.0 135-139 32.208000000000006 37.0 25.0 37.0 13.8 37.0 140-144 31.7074 37.0 25.0 37.0 11.0 37.0 145-149 31.337899999999998 37.0 25.0 37.0 13.8 37.0 150-151 30.8965 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 4.0 20 2.0 21 3.0 22 2.0 23 5.0 24 2.0 25 3.0 26 13.0 27 12.0 28 23.0 29 43.0 30 96.0 31 152.0 32 273.0 33 587.0 34 1156.0 35 1417.0 36 206.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.775000000000006 20.65 9.275 33.300000000000004 2 28.7 23.674999999999997 29.65 17.974999999999998 3 22.175 26.174999999999997 28.975 22.675 4 26.875 31.05 20.3 21.775 5 27.825 33.675 18.925 19.575 6 21.75 36.6 20.1 21.55 7 22.775000000000002 20.8 34.375 22.05 8 23.325000000000003 21.5 27.175 28.000000000000004 9 24.099999999999998 22.425 27.325 26.150000000000002 10-14 25.46 26.174999999999997 24.435000000000002 23.93 15-19 25.540000000000003 25.965 24.285 24.21 20-24 25.805 26.56 24.355 23.28 25-29 25.385 25.729999999999997 25.095 23.79 30-34 25.900000000000002 25.96 25.064999999999998 23.075000000000003 35-39 25.324999999999996 25.75 25.195 23.73 40-44 25.569999999999997 25.905 24.884999999999998 23.64 45-49 25.025 25.46 25.39 24.125 50-54 24.715 25.96 25.765 23.56 55-59 24.845 25.900000000000002 25.264999999999997 23.990000000000002 60-64 26.265 25.835 25.11 22.79 65-69 26.245 26.095000000000002 24.705 22.955000000000002 70-74 25.775 25.590000000000003 24.81 23.825 75-79 27.894999999999996 23.97 25.669999999999998 22.465 80-84 25.465 25.82 25.635 23.080000000000002 85-89 23.305 28.285 25.41 23.0 90-94 26.14 26.075 24.81 22.975 95-99 25.569999999999997 26.515 25.119999999999997 22.795 100-104 26.115 26.19 25.1 22.595000000000002 105-109 26.045 25.480000000000004 25.7 22.775000000000002 110-114 25.935000000000002 26.064999999999998 24.915000000000003 23.085 115-119 26.395000000000003 25.64 24.855 23.11 120-124 26.340000000000003 26.125 25.180000000000003 22.355 125-129 25.82 25.88 25.055 23.244999999999997 130-134 26.125 26.0 25.275 22.6 135-139 26.27 26.41 25.585 21.735 140-144 26.88 26.35 24.525 22.245 145-149 26.584999999999997 26.474999999999998 24.740000000000002 22.2 150-151 25.124999999999996 26.337500000000002 27.275 21.2625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.5 27 2.5 28 3.0 29 6.5 30 8.0 31 6.5 32 8.5 33 13.0 34 19.5 35 28.0 36 39.0 37 53.5 38 76.0 39 105.0 40 137.0 41 157.5 42 164.5 43 184.0 44 194.5 45 195.5 46 214.0 47 215.0 48 200.5 49 194.0 50 174.5 51 149.0 52 148.0 53 139.0 54 122.0 55 117.5 56 106.5 57 91.5 58 82.5 59 82.0 60 72.5 61 71.0 62 68.0 63 53.5 64 53.0 65 49.0 66 36.5 67 34.5 68 32.0 69 26.0 70 21.5 71 14.0 72 7.5 73 4.5 74 2.5 75 1.5 76 4.0 77 3.0 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.45 #Duplication Level Percentage of deduplicated Percentage of total 1 88.7078330474557 77.575 2 9.033733562035449 15.8 3 1.7438536306460835 4.575 4 0.37164093767867357 1.3 5 0.08576329331046312 0.375 6 0.02858776443682104 0.15 7 0.0 0.0 8 0.0 0.0 9 0.02858776443682104 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 9 0.22499999999999998 No Hit ATTGCTTTCAGGGTGAACTTGAAGTTGTTAAAGAAATTCACAGGAAGCAT 6 0.15 No Hit GCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATT 5 0.125 No Hit TGAAAAGCATGCTGTCTTATCGCAAATTCAGGAAAGGGTTAAAAGGTGAA 5 0.125 No Hit CTGCAGTCTATTTTTCTGGAGTAATGGTACGGCTTATGCTTGTCCTCGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1625 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.9 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.3 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.7875 0.0 0.0 0.0 0.0 118-119 2.1375 0.0 0.0 0.0 0.0 120-121 2.4124999999999996 0.0 0.0 0.0 0.0 122-123 2.7 0.0 0.0 0.0 0.0 124-125 2.9000000000000004 0.0 0.0 0.0 0.0 126-127 3.2874999999999996 0.0 0.0 0.0 0.0 128-129 3.7875 0.0 0.0 0.0 0.0 130-131 4.15 0.0 0.0 0.0 0.0 132-133 4.5125 0.0 0.0 0.0 0.0 134-135 4.875 0.0 0.0 0.0 0.0 136-137 5.3875 0.0 0.0 0.0 0.0 138-139 5.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 565434 spots for SRR18694358.sra Written 565434 spots for SRR18694358.sra Read 565434 spots for SRR18694358.sra Written 565434 spots for SRR18694358.sra Read 565434 spots for SRR18694358.sra Written 565434 spots for SRR18694358.sra Read 565434 spots for SRR18694358.sra Written 565434 spots for SRR18694358.sra Read 565434 spots for SRR18694358.sra Written 565434 spots for SRR18694358.sra Read 565434 spots for SRR18694358.sra Written 565434 spots for SRR18694358.sra Read 565434 spots for SRR18694358.sra Written 565434 spots for SRR18694358.sra Read 565434 spots for SRR18694358.sra Written 565434 spots for SRR18694358.sra Read 565434 spots for SRR18694358.sra Written 565434 spots for SRR18694358.sra Read 565434 spots for SRR18694358.sra Written 565434 spots for SRR18694358.sra Read 565434 spots for SRR18694358.sra Written 565434 spots for SRR18694358.sra Read 565434 spots for SRR18694358.sra Written 565434 spots for SRR18694358.sra Read 565451 spots for SRR18694358.sra Written 565451 spots for SRR18694358.sra Read 565434 spots for SRR18694358.sra Written 565434 spots for SRR18694358.sra Read 565434 spots for SRR18694358.sra Written 565434 spots for SRR18694358.sra Read 565434 spots for SRR18694358.sra Written 565434 spots for SRR18694358.sra Read 565434 spots for SRR18694358.sra Written 565434 spots for SRR18694358.sra Read 565434 spots for SRR18694358.sra Written 565434 spots for SRR18694358.sra Read 565434 spots for SRR18694358.sra Written 565434 spots for SRR18694358.sra Read 565434 spots for SRR18694358.sra Written 565434 spots for SRR18694358.sra SRR ids: ['SRR18694358.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y02ohymy SRR18694358.sra spots: 11308697 blocks: [[1, 565434], [565435, 1130868], [1130869, 1696302], [1696303, 2261736], [2261737, 2827170], [2827171, 3392604], [3392605, 3958038], [3958039, 4523472], [4523473, 5088906], [5088907, 5654340], [5654341, 6219774], [6219775, 6785208], [6785209, 7350642], [7350643, 7916076], [7916077, 8481510], [8481511, 9046944], [9046945, 9612378], [9612379, 10177812], [10177813, 10743246], [10743247, 11308697]] SRR18694358 file size 3821489 SRR18694358 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694358 SRR18694358_1.fastq SRR18694358_2.fastq Input file: SRR18694358_1.fastq Paired file: SRR18694358_2.fastq trimmed: SRR18694358-trimmed-pair1.fastq, SRR18694358-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:55:48 2024 >> started Tue Dec 10 05:56:01 2024 >> done (13.069s) 11308697 read pairs processed; of these: 102 ( 0.00%) short read pairs filtered out after trimming by size control 1442 ( 0.01%) empty read pairs filtered out after trimming by size control 11307153 (99.99%) read pairs available; of these: 1047705 ( 9.27%) trimmed read pairs available after processing 10259448 (90.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 11 0.00% 20 10 0.00% 21 3 0.00% 22 8 0.00% 23 17 0.00% 24 16 0.00% 25 10 0.00% 26 12 0.00% 27 15 0.00% 28 26 0.00% 29 15 0.00% 30 21 0.00% 31 23 0.00% 32 16 0.00% 33 28 0.00% 34 28 0.00% 35 28 0.00% 36 21 0.00% 37 34 0.00% 38 20 0.00% 39 28 0.00% 40 37 0.00% 41 30 0.00% 42 27 0.00% 43 47 0.00% 44 26 0.00% 45 55 0.00% 46 38 0.00% 47 51 0.00% 48 52 0.00% 49 54 0.00% 50 42 0.00% 51 79 0.00% 52 67 0.00% 53 84 0.00% 54 88 0.00% 55 104 0.00% 56 87 0.00% 57 79 0.00% 58 100 0.00% 59 135 0.00% 60 121 0.00% 61 165 0.00% 62 167 0.00% 63 183 0.00% 64 226 0.00% 65 191 0.00% 66 277 0.00% 67 224 0.00% 68 329 0.00% 69 341 0.00% 70 356 0.00% 71 437 0.00% 72 492 0.00% 73 554 0.00% 74 608 0.01% 75 723 0.01% 76 778 0.01% 77 833 0.01% 78 887 0.01% 79 1141 0.01% 80 1142 0.01% 81 1389 0.01% 82 1479 0.01% 83 1555 0.01% 84 1846 0.02% 85 2063 0.02% 86 2284 0.02% 87 2392 0.02% 88 2774 0.02% 89 2912 0.03% 90 3063 0.03% 91 3399 0.03% 92 3674 0.03% 93 4023 0.04% 94 4241 0.04% 95 4689 0.04% 96 4799 0.04% 97 5298 0.05% 98 5501 0.05% 99 5874 0.05% 100 6350 0.06% 101 6379 0.06% 102 6898 0.06% 103 7248 0.06% 104 7504 0.07% 105 7890 0.07% 106 8258 0.07% 107 8823 0.08% 108 8884 0.08% 109 9498 0.08% 110 9898 0.09% 111 10733 0.09% 112 11380 0.10% 113 11427 0.10% 114 11941 0.11% 115 12674 0.11% 116 13024 0.12% 117 13614 0.12% 118 13691 0.12% 119 14410 0.13% 120 15917 0.14% 121 15872 0.14% 122 16345 0.14% 123 17794 0.16% 124 17825 0.16% 125 18727 0.17% 126 19040 0.17% 127 19590 0.17% 128 19626 0.17% 129 21067 0.19% 130 21369 0.19% 131 21906 0.19% 132 22897 0.20% 133 23334 0.21% 134 23521 0.21% 135 24589 0.22% 136 25644 0.23% 137 25918 0.23% 138 26238 0.23% 139 27459 0.24% 140 28129 0.25% 141 28566 0.25% 142 29611 0.26% 143 30041 0.27% 144 31309 0.28% 145 31139 0.28% 146 31761 0.28% 147 33497 0.30% 148 33952 0.30% 149 34136 0.30% 150 35249 0.31% 151 10259448 90.73% 11307153 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=5.42 fanout-score-rank=22 prefix-density=0.19 prefix-fanout=4.2 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=12 fanout-score=415.76 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=33.7 sequence=CTTCTTCTTGAT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=34 prefix-density=0.17 prefix-fanout=2.0 sequence=CGAATTGTAGTCT criterion=fanout-score sequence-density=0.04 sequence-density-rank=32 fanout-score=148.30 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=11.5 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATG SRR18694358 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:58:49 Started mapping on | Dec 10 05:58:54 Finished on | Dec 10 06:02:23 Mapping speed, Million of reads per hour | 194.76 Number of input reads | 11307153 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 9307683 Uniquely mapped reads % | 82.32% Average mapped length | 296.49 Number of splices: Total | 10621542 Number of splices: Annotated (sjdb) | 10033851 Number of splices: GT/AG | 10482664 Number of splices: GC/AG | 118223 Number of splices: AT/AC | 6959 Number of splices: Non-canonical | 13696 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.01% Deletion average length | 2.41 Insertion rate per base | 0.01% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 132310 % of reads mapped to multiple loci | 1.17% Number of reads mapped to too many loci | 83057 % of reads mapped to too many loci | 0.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.63% % of reads unmapped: other | 8.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1867160 1867160 1867160 N_multimapping 132310 132310 132310 N_noFeature 332552 9084725 397547 N_ambiguous 185870 1187 28476 UnstrandedReadsAssigned:8789261 PositiveStrandReadsAssigned:221771 NegativeStrandReadsAssigned:8881660 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694358 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694358-trimmed-pair1.fastq SRR18694358-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,307,153 reads, 9,036,837 reads pseudoaligned [quant] estimated average fragment length: 265.386 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52973 SRR18694358.ke.tsv 35125 SRR18694358.se.tsv 88098 total ==> SRR18694358.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 672.267 0 0 PNS24247 1044 779.614 44.2933 9.87239 PNS24249 1928 1663.61 31.6584 3.30674 PNS24246 1044 779.614 44.2933 9.87239 PNS24248 1044 779.614 44.2933 9.87239 PNS24244 1471 1206.61 76.4617 11.0113 PNS24243 293 91.1041 0 0 KQK14069 1603 1338.61 1986.43 257.858 KQK14071 474 232.802 20.7272 15.471 ==> SRR18694358.se.tsv <== BRADI_1g14170v3 2126 BRADI_1g53295v3 44 BRADI_1g59795v3 190 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 463 BRADI_1g74790v3 110 BRADI_1g09890v3 0 BRADI_1g77505v3 91 BRADI_1g48960v3 0 SRR18694358 completed mapping pipeline successfully