Starting /dee2/code/volunteer_pipeline.sh SRR18694359 current disk space = 1525878243328 free memory = 1559522772 SRR18694359 SRAfilesize 3efcc29c78def9727f77a9ba46e63b7e SRR18694359.sra SRR18694359.sra file validated SRR18694359 is paired end SRR18694359 is conventional basespace SRR18694359 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694359_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.357 37.0 37.0 37.0 37.0 37.0 2 36.0855 37.0 37.0 37.0 37.0 37.0 3 36.454 37.0 37.0 37.0 37.0 37.0 4 36.561 37.0 37.0 37.0 37.0 37.0 5 36.5945 37.0 37.0 37.0 37.0 37.0 6 36.604 37.0 37.0 37.0 37.0 37.0 7 36.519 37.0 37.0 37.0 37.0 37.0 8 36.6265 37.0 37.0 37.0 37.0 37.0 9 36.6455 37.0 37.0 37.0 37.0 37.0 10-14 36.64649999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.6054 37.0 37.0 37.0 37.0 37.0 20-24 36.665 37.0 37.0 37.0 37.0 37.0 25-29 36.596199999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.5413 37.0 37.0 37.0 37.0 37.0 35-39 36.7 37.0 37.0 37.0 37.0 37.0 40-44 36.6281 37.0 37.0 37.0 37.0 37.0 45-49 36.478899999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.5546 37.0 37.0 37.0 37.0 37.0 55-59 36.575 37.0 37.0 37.0 37.0 37.0 60-64 36.5678 37.0 37.0 37.0 37.0 37.0 65-69 36.3489 37.0 37.0 37.0 37.0 37.0 70-74 36.463 37.0 37.0 37.0 37.0 37.0 75-79 36.53060000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.434000000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.2811 37.0 37.0 37.0 37.0 37.0 90-94 35.4605 37.0 37.0 37.0 29.8 37.0 95-99 36.1765 37.0 37.0 37.0 37.0 37.0 100-104 36.2312 37.0 37.0 37.0 37.0 37.0 105-109 36.149699999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.288199999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.4944 37.0 37.0 37.0 37.0 37.0 120-124 36.581599999999995 37.0 37.0 37.0 37.0 37.0 125-129 36.587599999999995 37.0 37.0 37.0 37.0 37.0 130-134 36.552099999999996 37.0 37.0 37.0 37.0 37.0 135-139 36.4808 37.0 37.0 37.0 37.0 37.0 140-144 36.2623 37.0 37.0 37.0 37.0 37.0 145-149 36.2598 37.0 37.0 37.0 37.0 37.0 150-151 33.655 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 0.0 25 0.0 26 0.0 27 2.0 28 5.0 29 4.0 30 8.0 31 9.0 32 17.0 33 50.0 34 101.0 35 309.0 36 3315.0 37 179.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.300000000000004 10.2 4.425 34.075 2 22.230576441102755 10.075187969924812 33.383458646616546 34.31077694235589 3 19.025 15.299999999999999 26.025 39.65 4 25.825 19.900000000000002 23.799999999999997 30.475 5 28.075 25.1 24.675 22.15 6 25.575 29.95 21.575 22.900000000000002 7 19.575 23.425 38.725 18.275 8 19.525000000000002 23.674999999999997 30.475 26.325 9 19.650000000000002 20.849999999999998 35.05 24.45 10-14 23.425 25.56 25.69 25.324999999999996 15-19 23.935000000000002 24.610000000000003 25.94 25.515 20-24 23.64 24.6 25.005 26.755000000000003 25-29 23.21 25.45 25.16 26.179999999999996 30-34 23.46 24.685000000000002 25.869999999999997 25.985000000000003 35-39 23.575 24.135 25.805 26.484999999999996 40-44 23.880000000000003 24.285 25.365 26.47 45-49 23.335 24.955 25.415 26.295 50-54 23.785 25.15 24.66 26.405 55-59 23.57 24.195 25.655 26.58 60-64 23.73 24.9 25.05 26.32 65-69 23.835 24.89 25.615 25.66 70-74 23.95 24.855 24.985 26.21 75-79 24.01 25.119999999999997 25.455 25.415 80-84 23.11 25.64 24.315 26.935 85-89 24.310000000000002 24.79 24.9 26.0 90-94 24.39 24.759999999999998 25.03 25.82 95-99 23.68 24.215 25.95 26.155 100-104 23.945 24.91 25.085 26.06 105-109 24.07 25.21 24.67 26.05 110-114 24.035 24.985 24.765 26.215 115-119 24.64 24.26 24.77 26.33 120-124 24.62 24.845 24.610000000000003 25.924999999999997 125-129 24.085 25.34 24.495 26.08 130-134 24.15 24.985 24.89 25.974999999999998 135-139 24.375 24.6 24.08 26.945000000000004 140-144 23.91 25.105 24.625 26.36 145-149 24.62 24.755 24.565 26.06 150-151 23.925 24.5375 24.6875 26.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 1.0 25 1.5 26 1.0 27 1.0 28 3.0 29 6.0 30 9.0 31 10.5 32 9.0 33 13.0 34 23.0 35 24.5 36 35.5 37 56.0 38 64.0 39 75.0 40 103.0 41 131.5 42 153.5 43 176.5 44 193.5 45 195.0 46 198.5 47 201.5 48 182.5 49 177.0 50 167.5 51 140.0 52 135.0 53 134.5 54 125.0 55 112.5 56 102.0 57 102.5 58 97.0 59 85.5 60 84.5 61 80.5 62 71.0 63 70.0 64 62.0 65 58.5 66 62.5 67 54.0 68 41.0 69 34.0 70 35.0 71 30.0 72 20.0 73 17.0 74 13.0 75 6.0 76 4.0 77 2.0 78 1.0 79 2.0 80 1.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.975 #Duplication Level Percentage of deduplicated Percentage of total 1 86.76940971212562 74.6 2 10.671706891538237 18.35 3 2.209944751381215 5.7 4 0.23262576330328583 0.8 5 0.05815644082582146 0.25 6 0.05815644082582146 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAGGCTGATCCTGAGCTGCCATCCACGCACGAATACCCTCGTTTAAAAGA 6 0.15 No Hit GTCTTGCTGGCAACAACGTGACTTCAATTCTGTGGGAAGCATTTGACATA 6 0.15 No Hit CCTCGTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAAT 5 0.125 No Hit TCTGGGATTTCCATCACGGTCACCACCCATCCAAGACGAAAACTGAATGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.1375 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 2.0875 0.0 0.0 0.0 0.0 112-113 2.3875 0.0 0.0 0.0 0.0 114-115 2.675 0.0 0.0 0.0 0.0 116-117 3.0250000000000004 0.0 0.0 0.0 0.0 118-119 3.3875 0.0 0.0 0.0 0.0 120-121 3.9375 0.0 0.0 0.0 0.0 122-123 4.275 0.0 0.0 0.0 0.0 124-125 4.625 0.0 0.0 0.0 0.0 126-127 5.15 0.0 0.0 0.0 0.0 128-129 5.6125 0.0 0.0 0.0 0.0 130-131 5.9625 0.0 0.0 0.0 0.0 132-133 6.2875 0.0 0.0 0.0 0.0 134-135 6.725 0.0 0.0 0.0 0.0 136-137 7.45 0.0 0.0 0.0 0.0 138-139 8.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18694359 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694359_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.306 37.0 37.0 37.0 25.0 37.0 2 35.523 37.0 37.0 37.0 37.0 37.0 3 35.546 37.0 37.0 37.0 37.0 37.0 4 35.55 37.0 37.0 37.0 37.0 37.0 5 35.581 37.0 37.0 37.0 37.0 37.0 6 35.6615 37.0 37.0 37.0 37.0 37.0 7 35.4415 37.0 37.0 37.0 37.0 37.0 8 35.7525 37.0 37.0 37.0 37.0 37.0 9 35.658 37.0 37.0 37.0 37.0 37.0 10-14 35.6409 37.0 37.0 37.0 37.0 37.0 15-19 35.6873 37.0 37.0 37.0 37.0 37.0 20-24 35.5487 37.0 37.0 37.0 34.6 37.0 25-29 35.7504 37.0 37.0 37.0 37.0 37.0 30-34 35.8989 37.0 37.0 37.0 37.0 37.0 35-39 35.83140000000001 37.0 37.0 37.0 37.0 37.0 40-44 35.41330000000001 37.0 37.0 37.0 32.2 37.0 45-49 35.596799999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.1542 37.0 37.0 37.0 32.2 37.0 55-59 34.5304 37.0 37.0 37.0 25.0 37.0 60-64 35.193 37.0 37.0 37.0 29.8 37.0 65-69 34.2449 37.0 34.6 37.0 27.4 37.0 70-74 32.9488 37.0 29.8 37.0 22.2 37.0 75-79 33.5399 37.0 34.6 37.0 22.2 37.0 80-84 34.625299999999996 37.0 37.0 37.0 25.0 37.0 85-89 32.75849999999999 37.0 32.2 37.0 19.4 37.0 90-94 34.125099999999996 37.0 37.0 37.0 25.0 37.0 95-99 33.970800000000004 37.0 37.0 37.0 25.0 37.0 100-104 33.4585 37.0 37.0 37.0 25.0 37.0 105-109 34.374500000000005 37.0 37.0 37.0 25.0 37.0 110-114 34.5883 37.0 37.0 37.0 25.0 37.0 115-119 34.5576 37.0 37.0 37.0 25.0 37.0 120-124 34.2273 37.0 37.0 37.0 25.0 37.0 125-129 34.0339 37.0 37.0 37.0 25.0 37.0 130-134 33.8444 37.0 37.0 37.0 25.0 37.0 135-139 32.2359 37.0 25.0 37.0 13.8 37.0 140-144 31.7077 37.0 25.0 37.0 11.0 37.0 145-149 31.2147 37.0 25.0 37.0 13.8 37.0 150-151 30.7335 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 3.0 16 0.0 17 2.0 18 2.0 19 2.0 20 2.0 21 3.0 22 6.0 23 7.0 24 5.0 25 8.0 26 6.0 27 18.0 28 14.0 29 41.0 30 72.0 31 121.0 32 231.0 33 544.0 34 1183.0 35 1492.0 36 237.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.825 20.05 7.1 25.025 2 29.575000000000003 21.45 27.700000000000003 21.275 3 23.375 23.549999999999997 29.325000000000003 23.75 4 27.125 30.3 20.3 22.275 5 29.525000000000002 31.075000000000003 18.9 20.5 6 24.65 33.5 19.05 22.8 7 24.474999999999998 20.474999999999998 32.550000000000004 22.5 8 23.45 21.875 25.775 28.9 9 23.150000000000002 21.9 27.775 27.175 10-14 26.395000000000003 24.884999999999998 23.305 25.415 15-19 26.35 24.39 24.6 24.66 20-24 25.765 25.28 24.33 24.625 25-29 26.045 25.245 23.875 24.834999999999997 30-34 26.32 25.014999999999997 24.365000000000002 24.3 35-39 26.275 24.62 24.2 24.905 40-44 26.365 24.845 23.57 25.22 45-49 26.265 25.06 24.065 24.610000000000003 50-54 25.47 24.925 25.15 24.455 55-59 25.814999999999998 25.474999999999998 23.75 24.959999999999997 60-64 25.755 25.240000000000002 24.505 24.5 65-69 26.384999999999998 24.67 24.42 24.525 70-74 26.755000000000003 24.5 24.185000000000002 24.560000000000002 75-79 27.800000000000004 24.095 24.5 23.605 80-84 25.82 25.19 23.810000000000002 25.180000000000003 85-89 24.27 27.55 23.84 24.34 90-94 26.384999999999998 25.240000000000002 23.78 24.595 95-99 25.765 25.72 24.169999999999998 24.345 100-104 26.205000000000002 25.445 24.19 24.16 105-109 26.240000000000002 25.105 24.295 24.36 110-114 26.8 25.224999999999998 23.794999999999998 24.18 115-119 26.58 24.65 24.335 24.435000000000002 120-124 26.355 24.865000000000002 24.945 23.835 125-129 26.779999999999998 25.650000000000002 24.485 23.085 130-134 27.834999999999997 25.064999999999998 23.845 23.255 135-139 27.41 25.405 24.165 23.02 140-144 27.865000000000002 25.324999999999996 23.990000000000002 22.82 145-149 27.115000000000002 26.174999999999997 23.724999999999998 22.985 150-151 26.1625 24.837500000000002 25.974999999999998 23.025000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 1.5 26 2.5 27 4.0 28 2.5 29 2.0 30 5.5 31 7.0 32 10.0 33 16.5 34 20.5 35 24.0 36 33.5 37 53.5 38 71.0 39 82.0 40 108.5 41 132.0 42 153.5 43 172.0 44 170.5 45 177.0 46 177.5 47 164.5 48 160.0 49 169.5 50 159.0 51 139.5 52 139.5 53 128.5 54 111.5 55 100.5 56 93.5 57 93.5 58 95.0 59 114.5 60 117.0 61 92.5 62 94.0 63 91.0 64 77.5 65 69.5 66 57.5 67 44.5 68 43.0 69 44.5 70 44.0 71 36.5 72 24.5 73 18.0 74 14.0 75 10.5 76 5.5 77 3.0 78 1.5 79 1.5 80 1.0 81 1.5 82 2.0 83 1.0 84 0.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.15 #Duplication Level Percentage of deduplicated Percentage of total 1 88.06655192197361 76.75 2 9.81067125645439 17.1 3 1.6351118760757317 4.275 4 0.34423407917383825 1.2 5 0.08605851979345956 0.375 6 0.05737234652897303 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAAGT 6 0.15 No Hit CTCTGAACTTACGTGCCTATGACTTTGTTTCCCAGGAAATCCGTGCAGCG 6 0.15 No Hit GCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATT 5 0.125 No Hit GACAATTGGTTCTGAATCTGGCAACAGCAGAAGTCTCAATGGTCGTGTAC 5 0.125 No Hit AACACAGAATACTCCTCCCTACAGCTCTCCCTTCGTCCCTCCACGGGGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.675 0.0 0.0 0.0 0.0 110-111 1.9874999999999998 0.0 0.0 0.0 0.0 112-113 2.2875 0.0 0.0 0.0 0.0 114-115 2.575 0.0 0.0 0.0 0.0 116-117 2.925 0.0 0.0 0.0 0.0 118-119 3.2874999999999996 0.0 0.0 0.0 0.0 120-121 3.8375 0.0 0.0 0.0 0.0 122-123 4.175 0.0 0.0 0.0 0.0 124-125 4.525 0.0 0.0 0.0 0.0 126-127 5.05 0.0 0.0 0.0 0.0 128-129 5.5375 0.0 0.0 0.0 0.0 130-131 5.8875 0.0 0.0 0.0 0.0 132-133 6.2125 0.0 0.0 0.0 0.0 134-135 6.65 0.0 0.0 0.0 0.0 136-137 7.375 0.0 0.0 0.0 0.0 138-139 8.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCACACC 10 0.006830828 145.0 3 >>END_MODULE Read 502393 spots for SRR18694359.sra Written 502393 spots for SRR18694359.sra Read 502393 spots for SRR18694359.sra Written 502393 spots for SRR18694359.sra Read 502393 spots for SRR18694359.sra Written 502393 spots for SRR18694359.sra Read 502393 spots for SRR18694359.sra Written 502393 spots for SRR18694359.sra Read 502393 spots for SRR18694359.sra Written 502393 spots for SRR18694359.sra Read 502393 spots for SRR18694359.sra Written 502393 spots for SRR18694359.sra Read 502393 spots for SRR18694359.sra Written 502393 spots for SRR18694359.sra Read 502393 spots for SRR18694359.sra Written 502393 spots for SRR18694359.sra Read 502393 spots for SRR18694359.sra Written 502393 spots for SRR18694359.sra Read 502393 spots for SRR18694359.sra Written 502393 spots for SRR18694359.sra Read 502393 spots for SRR18694359.sra Written 502393 spots for SRR18694359.sra Read 502393 spots for SRR18694359.sra Written 502393 spots for SRR18694359.sra Read 502393 spots for SRR18694359.sra Written 502393 spots for SRR18694359.sra Read 502393 spots for SRR18694359.sra Written 502393 spots for SRR18694359.sra Read 502393 spots for SRR18694359.sra Written 502393 spots for SRR18694359.sra Read 502410 spots for SRR18694359.sra Written 502410 spots for SRR18694359.sra Read 502393 spots for SRR18694359.sra Written 502393 spots for SRR18694359.sra Read 502393 spots for SRR18694359.sra Written 502393 spots for SRR18694359.sra Read 502393 spots for SRR18694359.sra Written 502393 spots for SRR18694359.sra Read 502393 spots for SRR18694359.sra Written 502393 spots for SRR18694359.sra SRR ids: ['SRR18694359.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uemnqrw7 SRR18694359.sra spots: 10047877 blocks: [[1, 502393], [502394, 1004786], [1004787, 1507179], [1507180, 2009572], [2009573, 2511965], [2511966, 3014358], [3014359, 3516751], [3516752, 4019144], [4019145, 4521537], [4521538, 5023930], [5023931, 5526323], [5526324, 6028716], [6028717, 6531109], [6531110, 7033502], [7033503, 7535895], [7535896, 8038288], [8038289, 8540681], [8540682, 9043074], [9043075, 9545467], [9545468, 10047877]] SRR18694359 file size 3393007 SRR18694359 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694359 SRR18694359_1.fastq SRR18694359_2.fastq Input file: SRR18694359_1.fastq Paired file: SRR18694359_2.fastq trimmed: SRR18694359-trimmed-pair1.fastq, SRR18694359-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:55:52 2024 >> started Tue Dec 10 05:56:03 2024 >> done (11.103s) 10047877 read pairs processed; of these: 101 ( 0.00%) short read pairs filtered out after trimming by size control 3995 ( 0.04%) empty read pairs filtered out after trimming by size control 10043781 (99.96%) read pairs available; of these: 1237266 (12.32%) trimmed read pairs available after processing 8806515 (87.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 11 0.00% 20 6 0.00% 21 10 0.00% 22 8 0.00% 23 17 0.00% 24 13 0.00% 25 16 0.00% 26 19 0.00% 27 14 0.00% 28 24 0.00% 29 15 0.00% 30 8 0.00% 31 31 0.00% 32 35 0.00% 33 32 0.00% 34 20 0.00% 35 23 0.00% 36 33 0.00% 37 31 0.00% 38 33 0.00% 39 31 0.00% 40 27 0.00% 41 32 0.00% 42 35 0.00% 43 48 0.00% 44 30 0.00% 45 39 0.00% 46 42 0.00% 47 43 0.00% 48 56 0.00% 49 61 0.00% 50 59 0.00% 51 57 0.00% 52 66 0.00% 53 96 0.00% 54 103 0.00% 55 95 0.00% 56 107 0.00% 57 100 0.00% 58 124 0.00% 59 168 0.00% 60 184 0.00% 61 194 0.00% 62 235 0.00% 63 273 0.00% 64 290 0.00% 65 286 0.00% 66 327 0.00% 67 386 0.00% 68 416 0.00% 69 507 0.01% 70 525 0.01% 71 621 0.01% 72 716 0.01% 73 819 0.01% 74 897 0.01% 75 967 0.01% 76 1040 0.01% 77 1112 0.01% 78 1356 0.01% 79 1557 0.02% 80 1659 0.02% 81 1893 0.02% 82 2222 0.02% 83 2441 0.02% 84 2614 0.03% 85 2910 0.03% 86 3043 0.03% 87 3336 0.03% 88 3411 0.03% 89 3774 0.04% 90 4062 0.04% 91 4459 0.04% 92 4850 0.05% 93 5287 0.05% 94 5842 0.06% 95 6284 0.06% 96 6238 0.06% 97 6783 0.07% 98 7140 0.07% 99 7491 0.07% 100 7976 0.08% 101 8332 0.08% 102 8971 0.09% 103 9538 0.09% 104 9891 0.10% 105 10290 0.10% 106 10605 0.11% 107 11197 0.11% 108 11593 0.12% 109 12078 0.12% 110 12518 0.12% 111 13301 0.13% 112 14194 0.14% 113 14617 0.15% 114 15440 0.15% 115 15919 0.16% 116 16425 0.16% 117 16881 0.17% 118 17164 0.17% 119 17850 0.18% 120 19259 0.19% 121 19374 0.19% 122 19724 0.20% 123 21028 0.21% 124 21770 0.22% 125 22044 0.22% 126 22878 0.23% 127 23330 0.23% 128 23515 0.23% 129 24656 0.25% 130 24623 0.25% 131 25393 0.25% 132 26734 0.27% 133 27277 0.27% 134 27657 0.28% 135 29236 0.29% 136 29449 0.29% 137 29293 0.29% 138 30139 0.30% 139 30398 0.30% 140 31164 0.31% 141 31429 0.31% 142 32679 0.33% 143 33464 0.33% 144 34960 0.35% 145 35896 0.36% 146 35903 0.36% 147 37038 0.37% 148 36752 0.37% 149 37383 0.37% 150 37766 0.38% 151 8806515 87.68% 10043781 reads passed initial QC criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=13 prefix-density=0.96 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.15 sequence-density-rank=25 fanout-score=12.97 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=2.1 sequence=TGTTGTCGAAGTCGTACTTCCTTAGGCCCTGGCTGATGTACTCTTGGGAGCTGAGGACGGCCACGTGGGTACCGTCGCCCATGGGCGCCTGGAAGAGCGAGTCGACGATACCCTTCCCCCTGGTGATGTCCTGCTGGTCGTCGGAGATATCGTAGGCGAGGCCCTTCCACCTGTCCTGGTCAGTCTGCTTTGACTCGTCCACCTCCTTGGCCATGACTGTGAATCTGTTGGCCTTGGTGCTCTTGCCATGGTAGTTCACGGCCGAGGTCACCTGCTTCTTGAGCTTCTTCCCAAGGAAGCTGGTTGGCGTAGAAGCCGGAGCTCCGACGGTGGACGAGAAGGTAGCAGACATCTCTGCTCTGCTTGGTCTGATCTGGATTAAGATTTTTCAGATGATCAAGTAATGGCTG criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=3.57 fanout-score-rank=13 prefix-density=0.70 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=49.27 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=9.2 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR18694359 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:56:52 Started mapping on | Dec 10 05:56:54 Finished on | Dec 10 05:57:55 Mapping speed, Million of reads per hour | 592.75 Number of input reads | 10043781 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 9036955 Uniquely mapped reads % | 89.98% Average mapped length | 294.92 Number of splices: Total | 9520968 Number of splices: Annotated (sjdb) | 8957756 Number of splices: GT/AG | 9392908 Number of splices: GC/AG | 108109 Number of splices: AT/AC | 3992 Number of splices: Non-canonical | 15959 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 2.35 Insertion rate per base | 0.01% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 229045 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 50553 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.10% % of reads unmapped: other | 4.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 777781 777781 777781 N_multimapping 229045 229045 229045 N_noFeature 428168 8806632 494892 N_ambiguous 196816 1163 33614 UnstrandedReadsAssigned:8411971 PositiveStrandReadsAssigned:229160 NegativeStrandReadsAssigned:8508449 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694359 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694359-trimmed-pair1.fastq SRR18694359-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,043,781 reads, 8,649,453 reads pseudoaligned [quant] estimated average fragment length: 249.554 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52973 SRR18694359.ke.tsv 35125 SRR18694359.se.tsv 88098 total ==> SRR18694359.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 687.895 0 0 PNS24247 1044 795.446 21.9879 4.68024 PNS24249 1928 1679.45 34.4298 3.47107 PNS24246 1044 795.446 21.9879 4.68024 PNS24248 1044 795.446 21.9879 4.68024 PNS24244 1471 1222.45 27.6064 3.82362 PNS24243 293 98.2446 0 0 KQK14069 1603 1354.45 1125.69 140.719 KQK14071 474 244.003 12.0535 8.36394 ==> SRR18694359.se.tsv <== BRADI_1g14170v3 1161 BRADI_1g53295v3 40 BRADI_1g59795v3 269 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 288 BRADI_1g74790v3 62 BRADI_1g09890v3 0 BRADI_1g77505v3 80 BRADI_1g48960v3 0 SRR18694359 completed mapping pipeline successfully