Starting /dee2/code/volunteer_pipeline.sh SRR18694360 current disk space = 1525873385472 free memory = 1559599700 SRR18694360 SRAfilesize 4061da6137bd5cc9d58787f2b5039a53 SRR18694360.sra SRR18694360.sra file validated SRR18694360 is paired end SRR18694360 is conventional basespace SRR18694360 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694360_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.193 37.0 37.0 37.0 37.0 37.0 2 36.06075 37.0 37.0 37.0 37.0 37.0 3 36.3365 37.0 37.0 37.0 37.0 37.0 4 36.556 37.0 37.0 37.0 37.0 37.0 5 36.546 37.0 37.0 37.0 37.0 37.0 6 36.515 37.0 37.0 37.0 37.0 37.0 7 36.497 37.0 37.0 37.0 37.0 37.0 8 36.5985 37.0 37.0 37.0 37.0 37.0 9 36.574 37.0 37.0 37.0 37.0 37.0 10-14 36.649800000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.628600000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.660999999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.5733 37.0 37.0 37.0 37.0 37.0 30-34 36.519 37.0 37.0 37.0 37.0 37.0 35-39 36.68579999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.5822 37.0 37.0 37.0 37.0 37.0 45-49 36.448899999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.5135 37.0 37.0 37.0 37.0 37.0 55-59 36.5292 37.0 37.0 37.0 37.0 37.0 60-64 36.516 37.0 37.0 37.0 37.0 37.0 65-69 36.337399999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.4371 37.0 37.0 37.0 37.0 37.0 75-79 36.4708 37.0 37.0 37.0 37.0 37.0 80-84 36.3661 37.0 37.0 37.0 37.0 37.0 85-89 36.211 37.0 37.0 37.0 37.0 37.0 90-94 35.5017 37.0 37.0 37.0 29.8 37.0 95-99 36.109 37.0 37.0 37.0 37.0 37.0 100-104 36.144600000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.1576 37.0 37.0 37.0 37.0 37.0 110-114 36.209199999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.478899999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.571000000000005 37.0 37.0 37.0 37.0 37.0 125-129 36.534200000000006 37.0 37.0 37.0 37.0 37.0 130-134 36.509499999999996 37.0 37.0 37.0 37.0 37.0 135-139 36.457100000000004 37.0 37.0 37.0 37.0 37.0 140-144 36.2358 37.0 37.0 37.0 37.0 37.0 145-149 36.2481 37.0 37.0 37.0 37.0 37.0 150-151 33.698499999999996 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 2.0 25 1.0 26 1.0 27 3.0 28 3.0 29 9.0 30 9.0 31 11.0 32 22.0 33 55.0 34 99.0 35 343.0 36 3271.0 37 170.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 54.825 9.15 4.775 31.25 2 23.752194632555806 9.505894156007024 35.44018058690745 31.30173062452972 3 19.8 14.649999999999999 26.125 39.425 4 27.224999999999998 21.175 21.525 30.075000000000003 5 27.250000000000004 27.200000000000003 22.6 22.95 6 23.875 31.775 21.75 22.6 7 18.5 24.7 39.425 17.375 8 19.575 21.875 32.85 25.7 9 19.725 21.65 32.324999999999996 26.3 10-14 23.49 26.275 26.240000000000002 23.995 15-19 22.86 24.8 26.88 25.46 20-24 22.705000000000002 25.655 25.955000000000002 25.685000000000002 25-29 23.3 25.195 25.564999999999998 25.94 30-34 22.875 25.035 25.21 26.88 35-39 22.58 25.419999999999998 26.14 25.86 40-44 23.25 25.285000000000004 25.03 26.435 45-49 22.939999999999998 25.89 25.19 25.979999999999997 50-54 22.55 25.485000000000003 25.779999999999998 26.185000000000002 55-59 22.31 25.779999999999998 26.44 25.47 60-64 23.189999999999998 25.729999999999997 24.610000000000003 26.47 65-69 22.515 25.89 24.955 26.640000000000004 70-74 22.75 25.445 25.22 26.584999999999997 75-79 23.1 24.959999999999997 25.295 26.645000000000003 80-84 22.555 24.785 26.029999999999998 26.63 85-89 23.235 25.629999999999995 25.66 25.474999999999998 90-94 23.355 25.705 25.195 25.745 95-99 23.09 25.045 25.869999999999997 25.995 100-104 23.22 25.679999999999996 24.915000000000003 26.185000000000002 105-109 23.815 25.955000000000002 24.84 25.39 110-114 23.41 24.93 25.929999999999996 25.729999999999997 115-119 23.47 25.7 24.87 25.96 120-124 24.11 25.105 24.93 25.855 125-129 23.064999999999998 25.825 25.324999999999996 25.785000000000004 130-134 24.295 25.779999999999998 24.845 25.080000000000002 135-139 24.11 25.61 24.33 25.95 140-144 23.82 25.52 24.945 25.715 145-149 23.56 25.045 24.815 26.58 150-151 23.849999999999998 25.5625 25.4625 25.124999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 2.0 25 2.0 26 0.5 27 1.0 28 3.5 29 2.5 30 5.5 31 12.5 32 15.0 33 16.5 34 19.5 35 31.0 36 31.5 37 42.5 38 72.0 39 97.5 40 119.5 41 131.0 42 160.0 43 170.0 44 180.5 45 197.0 46 207.5 47 225.0 48 214.5 49 202.0 50 179.5 51 175.0 52 179.5 53 151.5 54 121.5 55 101.5 56 99.5 57 94.0 58 84.5 59 75.5 60 68.5 61 64.5 62 52.0 63 49.5 64 48.5 65 45.0 66 39.0 67 40.5 68 43.5 69 30.0 70 18.0 71 17.5 72 21.5 73 16.0 74 6.0 75 2.5 76 2.5 77 3.5 78 3.5 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.5 #Duplication Level Percentage of deduplicated Percentage of total 1 85.50295857988166 72.25 2 12.071005917159763 20.4 3 1.9230769230769231 4.875 4 0.20710059171597633 0.7000000000000001 5 0.14792899408284024 0.625 6 0.02958579881656805 0.15 7 0.0 0.0 8 0.02958579881656805 0.2 9 0.0591715976331361 0.44999999999999996 >10 0.02958579881656805 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCGAAATATTCGAATACAAATACATGGAGAAACTAGAAAAGATCCGAGC 14 0.35000000000000003 No Hit CCTTGATCCTGCCCAACTTTCAATGCCTCCATCTCCTTGGTTGCCGCATC 9 0.22499999999999998 No Hit CCCATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAGGCT 9 0.22499999999999998 No Hit GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 8 0.2 No Hit CTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTATTAATCATTACT 6 0.15 No Hit CATACATAAAATGCTTTTACAGCCTTCGCTGTGGTTGCAGCTGCGAAGGG 5 0.125 No Hit CTCGTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAATT 5 0.125 No Hit GGCTTGTAGGTAGGCACCTCATGACCCGCTCCATGGACAGTAGCAATACC 5 0.125 No Hit CCTCGCGGTACTTGTTCGCTATCGGTCTCTCGCCTGTATTTAGCCTTGGA 5 0.125 No Hit GCCGCAGGCTCCACGCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.2 0.0 0.0 0.0 0.0 112-113 1.35 0.0 0.0 0.0 0.0 114-115 1.525 0.0 0.0 0.0 0.0 116-117 1.7375 0.0 0.0 0.0 0.0 118-119 1.9125 0.0 0.0 0.0 0.0 120-121 2.0875 0.0 0.0 0.0 0.0 122-123 2.3625 0.0 0.0 0.0 0.0 124-125 2.6500000000000004 0.0 0.0 0.0 0.0 126-127 3.05 0.0 0.0 0.0 0.0 128-129 3.3875 0.0 0.0 0.0 0.0 130-131 3.75 0.0 0.0 0.0 0.0 132-133 4.0125 0.0 0.0 0.0 0.0 134-135 4.35 0.0 0.0 0.0 0.0 136-137 4.75 0.0 0.0 0.0 0.0 138-139 5.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18694360 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694360_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.9535 37.0 37.0 37.0 25.0 37.0 2 35.1395 37.0 37.0 37.0 25.0 37.0 3 35.0655 37.0 37.0 37.0 25.0 37.0 4 35.1225 37.0 37.0 37.0 25.0 37.0 5 35.061 37.0 37.0 37.0 25.0 37.0 6 35.3855 37.0 37.0 37.0 37.0 37.0 7 35.174 37.0 37.0 37.0 25.0 37.0 8 35.452 37.0 37.0 37.0 37.0 37.0 9 35.484 37.0 37.0 37.0 37.0 37.0 10-14 35.4838 37.0 37.0 37.0 37.0 37.0 15-19 35.541999999999994 37.0 37.0 37.0 37.0 37.0 20-24 35.3694 37.0 37.0 37.0 32.2 37.0 25-29 35.5029 37.0 37.0 37.0 32.2 37.0 30-34 35.701699999999995 37.0 37.0 37.0 34.6 37.0 35-39 35.5454 37.0 37.0 37.0 34.6 37.0 40-44 35.3143 37.0 37.0 37.0 29.8 37.0 45-49 35.5399 37.0 37.0 37.0 34.6 37.0 50-54 34.9011 37.0 37.0 37.0 29.8 37.0 55-59 34.359300000000005 37.0 37.0 37.0 25.0 37.0 60-64 35.0219 37.0 37.0 37.0 27.4 37.0 65-69 34.13449999999999 37.0 34.6 37.0 27.4 37.0 70-74 32.9825 37.0 29.8 37.0 22.2 37.0 75-79 33.59930000000001 37.0 34.6 37.0 22.2 37.0 80-84 34.509 37.0 37.0 37.0 25.0 37.0 85-89 32.6365 37.0 32.2 37.0 19.4 37.0 90-94 34.1034 37.0 37.0 37.0 25.0 37.0 95-99 33.9343 37.0 37.0 37.0 25.0 37.0 100-104 33.461200000000005 37.0 37.0 37.0 25.0 37.0 105-109 34.1589 37.0 37.0 37.0 25.0 37.0 110-114 34.4669 37.0 37.0 37.0 25.0 37.0 115-119 34.3752 37.0 37.0 37.0 25.0 37.0 120-124 34.008 37.0 37.0 37.0 25.0 37.0 125-129 33.908500000000004 37.0 37.0 37.0 25.0 37.0 130-134 33.6158 37.0 34.6 37.0 25.0 37.0 135-139 32.074400000000004 37.0 25.0 37.0 13.8 37.0 140-144 31.531899999999997 37.0 25.0 37.0 11.0 37.0 145-149 31.0678 37.0 25.0 37.0 13.8 37.0 150-151 30.688000000000002 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 3.0 16 3.0 17 3.0 18 3.0 19 5.0 20 4.0 21 3.0 22 5.0 23 6.0 24 1.0 25 7.0 26 5.0 27 15.0 28 23.0 29 39.0 30 87.0 31 164.0 32 291.0 33 525.0 34 1208.0 35 1427.0 36 173.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.2 21.625 6.325 22.85 2 31.35 19.35 29.325000000000003 19.975 3 22.575 23.849999999999998 31.025000000000002 22.55 4 26.875 30.975 20.175 21.975 5 28.449999999999996 33.675 18.7 19.175 6 24.125 34.849999999999994 20.200000000000003 20.825 7 23.3 20.674999999999997 33.85 22.175 8 23.7 22.225 24.9 29.175 9 25.174999999999997 22.95 27.05 24.825 10-14 26.235000000000003 26.009999999999998 23.13 24.625 15-19 26.455000000000002 24.73 24.345 24.47 20-24 25.674999999999997 25.509999999999998 24.665 24.15 25-29 25.490000000000002 25.56 24.845 24.104999999999997 30-34 25.369999999999997 25.35 25.590000000000003 23.69 35-39 26.08 26.095000000000002 24.48 23.345 40-44 26.41 25.34 24.240000000000002 24.01 45-49 26.840000000000003 25.345000000000002 24.11 23.705000000000002 50-54 24.52 25.569999999999997 25.96 23.95 55-59 25.040000000000003 25.924999999999997 24.69 24.345 60-64 26.32 25.31 24.665 23.705000000000002 65-69 26.51 25.424999999999997 24.62 23.445 70-74 26.334999999999997 24.665 25.424999999999997 23.575 75-79 27.860000000000003 23.135 24.895 24.11 80-84 27.07 25.365 24.19 23.375 85-89 23.68 27.295 24.9 24.125 90-94 25.965 24.855 25.56 23.62 95-99 26.119999999999997 26.08 24.43 23.369999999999997 100-104 26.26 25.069999999999997 24.735 23.935000000000002 105-109 25.94 25.509999999999998 25.319999999999997 23.23 110-114 26.47 25.395 25.16 22.975 115-119 26.6 25.66 24.345 23.395 120-124 25.590000000000003 25.635 25.679999999999996 23.095 125-129 26.965 25.224999999999998 24.759999999999998 23.05 130-134 27.32 25.61 24.779999999999998 22.29 135-139 27.165 25.205 24.345 23.285 140-144 26.400000000000002 26.200000000000003 24.62 22.78 145-149 27.18 26.040000000000003 24.11 22.67 150-151 24.5375 26.637499999999996 26.875 21.95 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 0.0 27 0.5 28 1.5 29 3.0 30 3.0 31 9.5 32 17.5 33 21.0 34 26.0 35 29.5 36 40.0 37 51.5 38 68.0 39 95.5 40 125.5 41 139.0 42 152.0 43 169.5 44 174.5 45 175.5 46 196.5 47 212.5 48 202.0 49 189.5 50 164.5 51 147.0 52 135.0 53 122.0 54 116.0 55 102.0 56 82.0 57 82.5 58 93.0 59 89.0 60 84.5 61 81.5 62 76.0 63 71.5 64 62.5 65 52.0 66 50.0 67 52.0 68 53.5 69 44.5 70 33.5 71 28.5 72 19.5 73 13.5 74 10.5 75 5.5 76 3.0 77 4.0 78 2.0 79 1.5 80 1.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.15 #Duplication Level Percentage of deduplicated Percentage of total 1 87.28961114335462 75.2 2 10.679048171793383 18.4 3 1.5380150899593732 3.975 4 0.20313406848520024 0.7000000000000001 5 0.11607661056297155 0.5 6 0.05803830528148578 0.3 7 0.02901915264074289 0.17500000000000002 8 0.0 0.0 9 0.02901915264074289 0.22499999999999998 >10 0.05803830528148578 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCGCCCCAGCGGCAGGGTGCCTTCTAGACACCCGCCTTCTTCCGGTTCC 11 0.27499999999999997 No Hit GGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCA 10 0.25 No Hit GCCAGCCGTCAGCCCCCTTCTCACCAAGCGGCGAATACTCTCGGCGTTGG 9 0.22499999999999998 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 7 0.17500000000000002 No Hit GCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATT 6 0.15 No Hit GCCATGCATGTGCAAGTATGAACTAATTTGAACTGTGAAACTGCGAATGG 6 0.15 No Hit AGAGGAACTCCAGATTCGCTCCCAGATTCTGGCCCTGCGGATGAATATCG 5 0.125 No Hit CTTAGTTGGTGGAGCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACC 5 0.125 No Hit ACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTTGAT 5 0.125 No Hit CGTGCTTGGCTCATCAACTATTTGATTGATGGCTTCAAGGAGATGCATGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.48750000000000004 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.8375 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.3 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 1.8624999999999998 0.0 0.0 0.0 0.0 120-121 2.0375 0.0 0.0 0.0 0.0 122-123 2.3125 0.0 0.0 0.0 0.0 124-125 2.5999999999999996 0.0 0.0 0.0 0.0 126-127 3.0 0.0 0.0 0.0 0.0 128-129 3.3375000000000004 0.0 0.0 0.0 0.0 130-131 3.7 0.0 0.0 0.0 0.0 132-133 3.9625000000000004 0.0 0.0 0.0 0.0 134-135 4.2875 0.0 0.0 0.0 0.0 136-137 4.65 0.0 0.0 0.0 0.0 138-139 4.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 597531 spots for SRR18694360.sra Written 597531 spots for SRR18694360.sra Read 597531 spots for SRR18694360.sra Written 597531 spots for SRR18694360.sra Read 597531 spots for SRR18694360.sra Written 597531 spots for SRR18694360.sra Read 597531 spots for SRR18694360.sra Written 597531 spots for SRR18694360.sra Read 597531 spots for SRR18694360.sra Written 597531 spots for SRR18694360.sra Read 597531 spots for SRR18694360.sra Written 597531 spots for SRR18694360.sra Read 597531 spots for SRR18694360.sra Written 597531 spots for SRR18694360.sra Read 597531 spots for SRR18694360.sra Written 597531 spots for SRR18694360.sra Read 597531 spots for SRR18694360.sra Written 597531 spots for SRR18694360.sra Read 597534 spots for SRR18694360.sra Written 597534 spots for SRR18694360.sra Read 597531 spots for SRR18694360.sra Written 597531 spots for SRR18694360.sra Read 597531 spots for SRR18694360.sra Written 597531 spots for SRR18694360.sra Read 597531 spots for SRR18694360.sra Written 597531 spots for SRR18694360.sra Read 597531 spots for SRR18694360.sra Written 597531 spots for SRR18694360.sra Read 597531 spots for SRR18694360.sra Written 597531 spots for SRR18694360.sra Read 597531 spots for SRR18694360.sra Written 597531 spots for SRR18694360.sra Read 597531 spots for SRR18694360.sra Written 597531 spots for SRR18694360.sra Read 597531 spots for SRR18694360.sra Written 597531 spots for SRR18694360.sra Read 597531 spots for SRR18694360.sra Written 597531 spots for SRR18694360.sra Read 597531 spots for SRR18694360.sra Written 597531 spots for SRR18694360.sra SRR ids: ['SRR18694360.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oqiuz96y SRR18694360.sra spots: 11950623 blocks: [[1, 597531], [597532, 1195062], [1195063, 1792593], [1792594, 2390124], [2390125, 2987655], [2987656, 3585186], [3585187, 4182717], [4182718, 4780248], [4780249, 5377779], [5377780, 5975310], [5975311, 6572841], [6572842, 7170372], [7170373, 7767903], [7767904, 8365434], [8365435, 8962965], [8962966, 9560496], [9560497, 10158027], [10158028, 10755558], [10755559, 11353089], [11353090, 11950623]] SRR18694360 file size 4039644 SRR18694360 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694360 SRR18694360_1.fastq SRR18694360_2.fastq Input file: SRR18694360_1.fastq Paired file: SRR18694360_2.fastq trimmed: SRR18694360-trimmed-pair1.fastq, SRR18694360-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:55:50 2024 >> started Tue Dec 10 05:56:03 2024 >> done (13.356s) 11950623 read pairs processed; of these: 105 ( 0.00%) short read pairs filtered out after trimming by size control 1290 ( 0.01%) empty read pairs filtered out after trimming by size control 11949228 (99.99%) read pairs available; of these: 940706 ( 7.87%) trimmed read pairs available after processing 11008522 (92.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 14 0.00% 20 11 0.00% 21 10 0.00% 22 8 0.00% 23 11 0.00% 24 14 0.00% 25 19 0.00% 26 20 0.00% 27 19 0.00% 28 27 0.00% 29 24 0.00% 30 34 0.00% 31 29 0.00% 32 25 0.00% 33 21 0.00% 34 15 0.00% 35 23 0.00% 36 25 0.00% 37 38 0.00% 38 27 0.00% 39 32 0.00% 40 29 0.00% 41 37 0.00% 42 39 0.00% 43 28 0.00% 44 39 0.00% 45 38 0.00% 46 53 0.00% 47 29 0.00% 48 41 0.00% 49 56 0.00% 50 38 0.00% 51 70 0.00% 52 60 0.00% 53 59 0.00% 54 64 0.00% 55 80 0.00% 56 75 0.00% 57 98 0.00% 58 138 0.00% 59 123 0.00% 60 145 0.00% 61 175 0.00% 62 169 0.00% 63 191 0.00% 64 216 0.00% 65 204 0.00% 66 257 0.00% 67 298 0.00% 68 332 0.00% 69 362 0.00% 70 379 0.00% 71 454 0.00% 72 503 0.00% 73 556 0.00% 74 700 0.01% 75 670 0.01% 76 775 0.01% 77 881 0.01% 78 938 0.01% 79 1120 0.01% 80 1308 0.01% 81 1236 0.01% 82 1469 0.01% 83 1635 0.01% 84 1832 0.02% 85 1953 0.02% 86 2196 0.02% 87 2510 0.02% 88 2488 0.02% 89 2576 0.02% 90 2674 0.02% 91 3118 0.03% 92 3290 0.03% 93 3628 0.03% 94 4063 0.03% 95 4231 0.04% 96 4478 0.04% 97 4642 0.04% 98 4785 0.04% 99 5187 0.04% 100 5633 0.05% 101 5733 0.05% 102 6132 0.05% 103 6429 0.05% 104 6781 0.06% 105 6999 0.06% 106 7372 0.06% 107 7802 0.07% 108 8159 0.07% 109 8483 0.07% 110 8722 0.07% 111 9263 0.08% 112 9620 0.08% 113 10014 0.08% 114 10550 0.09% 115 11076 0.09% 116 11518 0.10% 117 12044 0.10% 118 12066 0.10% 119 12511 0.10% 120 13415 0.11% 121 13661 0.11% 122 14292 0.12% 123 15245 0.13% 124 15376 0.13% 125 16097 0.13% 126 16785 0.14% 127 17086 0.14% 128 17807 0.15% 129 18632 0.16% 130 18771 0.16% 131 19451 0.16% 132 20404 0.17% 133 20705 0.17% 134 21201 0.18% 135 22208 0.19% 136 23289 0.19% 137 23151 0.19% 138 23707 0.20% 139 24308 0.20% 140 25198 0.21% 141 25652 0.21% 142 26937 0.23% 143 27179 0.23% 144 28704 0.24% 145 29206 0.24% 146 29903 0.25% 147 30846 0.26% 148 30693 0.26% 149 31419 0.26% 150 32193 0.27% 151 11008522 92.13% 11949228 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.69 fanout-score-rank=32 prefix-density=0.17 prefix-fanout=3.0 sequence=CCACCAAGATCTGCACTAGAGGCCATTCCACGCAGGCTCACGCCCAGACGCTTCGCAATGGACCTCCACGCCCTCCTAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=25 fanout-score=293.15 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=29.0 sequence=TCTTCTTCTTGTC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=29 prefix-density=0.21 prefix-fanout=2.3 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=597.47 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=16.8 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR18694360 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:58:01 Started mapping on | Dec 10 05:58:01 Finished on | Dec 10 06:01:43 Mapping speed, Million of reads per hour | 193.77 Number of input reads | 11949228 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 9528854 Uniquely mapped reads % | 79.74% Average mapped length | 296.83 Number of splices: Total | 10392507 Number of splices: Annotated (sjdb) | 9816500 Number of splices: GT/AG | 10251456 Number of splices: GC/AG | 118447 Number of splices: AT/AC | 6860 Number of splices: Non-canonical | 15744 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.46 Insertion rate per base | 0.01% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 125854 % of reads mapped to multiple loci | 1.05% Number of reads mapped to too many loci | 87965 % of reads mapped to too many loci | 0.74% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.24% % of reads unmapped: other | 8.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2294520 2294520 2294520 N_multimapping 125854 125854 125854 N_noFeature 345623 9293364 418857 N_ambiguous 191840 1159 30308 UnstrandedReadsAssigned:8991391 PositiveStrandReadsAssigned:234331 NegativeStrandReadsAssigned:9079689 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694360 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694360-trimmed-pair1.fastq SRR18694360-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,949,228 reads, 9,286,861 reads pseudoaligned [quant] estimated average fragment length: 267.608 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52973 SRR18694360.ke.tsv 35125 SRR18694360.se.tsv 88098 total ==> SRR18694360.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 669.934 0 0 PNS24247 1044 777.392 37.0521 7.86115 PNS24249 1928 1661.39 28.0422 2.7839 PNS24246 1044 777.392 37.0521 7.86115 PNS24248 1044 777.392 37.0521 7.86115 PNS24244 1471 1204.39 97.8014 13.3934 PNS24243 293 88.8794 1 1.85572 KQK14069 1603 1336.39 2431.09 300.041 KQK14071 474 229.081 11.0136 7.92966 ==> SRR18694360.se.tsv <== BRADI_1g14170v3 2581 BRADI_1g53295v3 40 BRADI_1g59795v3 168 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 328 BRADI_1g74790v3 92 BRADI_1g09890v3 0 BRADI_1g77505v3 76 BRADI_1g48960v3 0 SRR18694360 completed mapping pipeline successfully