Starting /dee2/code/volunteer_pipeline.sh SRR18694361 current disk space = 1525868544000 free memory = 1459218476 SRR18694361 SRAfilesize a5bc37dacbd080ecb5ad6d9d3c62a7dc SRR18694361.sra SRR18694361.sra file validated SRR18694361 is paired end SRR18694361 is conventional basespace SRR18694361 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694361_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1205 37.0 37.0 37.0 37.0 37.0 2 35.98075 37.0 37.0 37.0 37.0 37.0 3 36.3085 37.0 37.0 37.0 37.0 37.0 4 36.5155 37.0 37.0 37.0 37.0 37.0 5 36.482 37.0 37.0 37.0 37.0 37.0 6 36.448 37.0 37.0 37.0 37.0 37.0 7 36.489 37.0 37.0 37.0 37.0 37.0 8 36.5665 37.0 37.0 37.0 37.0 37.0 9 36.628 37.0 37.0 37.0 37.0 37.0 10-14 36.60799999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.5794 37.0 37.0 37.0 37.0 37.0 20-24 36.622 37.0 37.0 37.0 37.0 37.0 25-29 36.5188 37.0 37.0 37.0 37.0 37.0 30-34 36.521699999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.660700000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.5706 37.0 37.0 37.0 37.0 37.0 45-49 36.3503 37.0 37.0 37.0 37.0 37.0 50-54 36.4906 37.0 37.0 37.0 37.0 37.0 55-59 36.4845 37.0 37.0 37.0 37.0 37.0 60-64 36.5185 37.0 37.0 37.0 37.0 37.0 65-69 36.2797 37.0 37.0 37.0 37.0 37.0 70-74 36.4596 37.0 37.0 37.0 37.0 37.0 75-79 36.4496 37.0 37.0 37.0 37.0 37.0 80-84 36.4478 37.0 37.0 37.0 37.0 37.0 85-89 36.25170000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.499 37.0 37.0 37.0 29.8 37.0 95-99 36.1533 37.0 37.0 37.0 37.0 37.0 100-104 36.189800000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1683 37.0 37.0 37.0 37.0 37.0 110-114 36.1917 37.0 37.0 37.0 37.0 37.0 115-119 36.459 37.0 37.0 37.0 37.0 37.0 120-124 36.575900000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.5262 37.0 37.0 37.0 37.0 37.0 130-134 36.5258 37.0 37.0 37.0 37.0 37.0 135-139 36.4229 37.0 37.0 37.0 37.0 37.0 140-144 36.2765 37.0 37.0 37.0 37.0 37.0 145-149 36.2003 37.0 37.0 37.0 37.0 37.0 150-151 33.897999999999996 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 1.0 24 2.0 25 1.0 26 5.0 27 3.0 28 2.0 29 4.0 30 4.0 31 15.0 32 26.0 33 48.0 34 128.0 35 319.0 36 3259.0 37 182.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 53.349999999999994 8.975 5.025 32.65 2 24.166457758836803 10.127851591877663 33.89320631737277 31.81248433191276 3 19.7 13.900000000000002 27.224999999999998 39.175 4 24.3 22.2 23.575 29.925 5 27.0 26.05 22.75 24.2 6 24.8 29.25 22.925 23.025000000000002 7 18.6 23.549999999999997 38.45 19.400000000000002 8 20.375 22.475 31.674999999999997 25.474999999999998 9 20.375 20.625 34.2 24.8 10-14 23.82 25.674999999999997 25.679999999999996 24.825 15-19 23.580000000000002 24.310000000000002 26.145000000000003 25.965 20-24 23.98 24.88 25.355 25.785000000000004 25-29 23.835 25.374999999999996 24.665 26.125 30-34 23.5 24.905 25.295 26.3 35-39 23.04 24.884999999999998 25.285000000000004 26.790000000000003 40-44 24.18 23.935000000000002 25.545 26.340000000000003 45-49 24.33 24.654999999999998 25.355 25.66 50-54 23.21 24.47 25.735000000000003 26.584999999999997 55-59 24.275 24.205 25.525 25.995 60-64 23.56 24.34 25.69 26.41 65-69 23.14 24.87 25.629999999999995 26.36 70-74 23.74 25.235000000000003 24.765 26.26 75-79 24.555 24.959999999999997 24.605 25.88 80-84 23.69 25.369999999999997 24.665 26.275 85-89 24.925 24.875 24.34 25.86 90-94 24.12 24.11 25.665 26.105 95-99 23.585 25.245 25.174999999999997 25.995 100-104 24.645 24.474999999999998 25.064999999999998 25.814999999999998 105-109 24.925 24.975 24.654999999999998 25.445 110-114 23.990000000000002 24.759999999999998 25.064999999999998 26.185000000000002 115-119 24.610000000000003 24.66 24.39 26.340000000000003 120-124 24.185000000000002 24.404999999999998 25.064999999999998 26.345000000000002 125-129 24.415 24.545 24.759999999999998 26.279999999999998 130-134 24.41 25.44 24.66 25.490000000000002 135-139 24.085 25.515 23.875 26.525 140-144 24.375 25.509999999999998 23.990000000000002 26.125 145-149 25.040000000000003 25.230000000000004 23.77 25.96 150-151 22.662499999999998 26.7125 24.25 26.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 2.0 26 1.5 27 0.0 28 2.5 29 3.0 30 5.0 31 8.0 32 8.0 33 19.5 34 27.5 35 24.0 36 36.0 37 51.5 38 65.0 39 86.5 40 104.5 41 123.5 42 138.0 43 153.5 44 161.0 45 174.0 46 195.0 47 184.5 48 190.5 49 206.5 50 186.0 51 166.0 52 160.5 53 141.0 54 126.5 55 120.5 56 108.5 57 99.0 58 101.5 59 98.0 60 80.5 61 76.0 62 76.0 63 70.0 64 64.5 65 63.0 66 58.5 67 50.5 68 39.5 69 31.0 70 24.0 71 23.0 72 21.0 73 14.0 74 8.5 75 6.0 76 5.5 77 3.5 78 2.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.0 #Duplication Level Percentage of deduplicated Percentage of total 1 86.10119047619048 72.32499999999999 2 10.654761904761905 17.9 3 2.2916666666666665 5.775 4 0.625 2.1 5 0.17857142857142858 0.75 6 0.05952380952380953 0.3 7 0.0 0.0 8 0.029761904761904764 0.2 9 0.0 0.0 >10 0.05952380952380953 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAATGGCAATGCTGCCGTTGCACTATAAGCAATAGCAACCGTGTTCAAGA 16 0.4 No Hit CTTCCGTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCGGA 10 0.25 No Hit TGCAAGAGTCCTTCTTGCCGGCCTTGCCGATCTTGTAGACCTTCTTGTTC 8 0.2 No Hit GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 6 0.15 No Hit GTCTATCAGTAGGGTAAAACTAACCTGTCTCACGACGGTCTAAACCCAGC 6 0.15 No Hit AGCCCGCACCTTTTTCTTTCTCCTGACGCGTTGATAAAACACACTCTCTG 5 0.125 No Hit GTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCGGAACCCA 5 0.125 No Hit CGTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCGGAACCC 5 0.125 No Hit CTCAAACTTCCGTCGCCTAAACGGCGATAGTCCCTCTAAGAAGCTAGCTG 5 0.125 No Hit GTCAAGATGAATAGCTCTTATGAACTCAAAGCCTTTCAGCTTCCTTTCCT 5 0.125 No Hit GCCGCAGGCTCCACGCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.07500000000000001 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.4125 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.9 0.0 0.0 0.0 0.0 110-111 1.9875 0.0 0.0 0.0 0.0 112-113 2.15 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.5 0.0 0.0 0.0 0.0 118-119 2.7875 0.0 0.0 0.0 0.0 120-121 3.3375 0.0 0.0 0.0 0.0 122-123 3.8375000000000004 0.0 0.0 0.0 0.0 124-125 4.1875 0.0 0.0 0.0 0.0 126-127 4.6375 0.0 0.0 0.0 0.0 128-129 5.15 0.0 0.0 0.0 0.0 130-131 5.6 0.0 0.0 0.0 0.0 132-133 6.15 0.0 0.0 0.0 0.0 134-135 6.637499999999999 0.0 0.0 0.0 0.0 136-137 7.1875 0.0 0.0 0.0 0.0 138-139 7.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACATAA 10 0.006830828 145.0 4 CCATTTA 10 0.006830828 145.0 4 >>END_MODULE SRR18694361 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694361_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.318 37.0 37.0 37.0 25.0 37.0 2 35.5185 37.0 37.0 37.0 37.0 37.0 3 35.5435 37.0 37.0 37.0 37.0 37.0 4 35.534 37.0 37.0 37.0 37.0 37.0 5 35.412 37.0 37.0 37.0 37.0 37.0 6 35.406 37.0 37.0 37.0 37.0 37.0 7 35.466 37.0 37.0 37.0 37.0 37.0 8 35.607 37.0 37.0 37.0 37.0 37.0 9 35.691 37.0 37.0 37.0 37.0 37.0 10-14 35.7235 37.0 37.0 37.0 37.0 37.0 15-19 35.6777 37.0 37.0 37.0 37.0 37.0 20-24 35.5548 37.0 37.0 37.0 34.6 37.0 25-29 35.6522 37.0 37.0 37.0 34.6 37.0 30-34 35.8208 37.0 37.0 37.0 37.0 37.0 35-39 35.685700000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.4118 37.0 37.0 37.0 29.8 37.0 45-49 35.6036 37.0 37.0 37.0 34.6 37.0 50-54 35.14640000000001 37.0 37.0 37.0 32.2 37.0 55-59 34.379599999999996 37.0 37.0 37.0 25.0 37.0 60-64 35.10340000000001 37.0 37.0 37.0 27.4 37.0 65-69 34.2537 37.0 34.6 37.0 27.4 37.0 70-74 33.001 37.0 29.8 37.0 22.2 37.0 75-79 33.6477 37.0 34.6 37.0 22.2 37.0 80-84 34.669200000000004 37.0 37.0 37.0 25.0 37.0 85-89 32.7077 37.0 32.2 37.0 19.4 37.0 90-94 34.1162 37.0 37.0 37.0 25.0 37.0 95-99 34.0826 37.0 37.0 37.0 25.0 37.0 100-104 33.5565 37.0 37.0 37.0 25.0 37.0 105-109 34.2396 37.0 37.0 37.0 25.0 37.0 110-114 34.604 37.0 37.0 37.0 25.0 37.0 115-119 34.6454 37.0 37.0 37.0 25.0 37.0 120-124 34.1005 37.0 37.0 37.0 25.0 37.0 125-129 34.0382 37.0 37.0 37.0 25.0 37.0 130-134 33.749399999999994 37.0 37.0 37.0 25.0 37.0 135-139 32.134100000000004 37.0 27.4 37.0 13.8 37.0 140-144 31.6718 37.0 25.0 37.0 11.0 37.0 145-149 31.136599999999998 37.0 25.0 37.0 13.8 37.0 150-151 30.928250000000002 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 3.0 18 5.0 19 2.0 20 2.0 21 5.0 22 2.0 23 9.0 24 2.0 25 9.0 26 11.0 27 16.0 28 18.0 29 15.0 30 64.0 31 156.0 32 290.0 33 511.0 34 1163.0 35 1481.0 36 235.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.150000000000006 20.175 7.825 25.85 2 30.599999999999998 20.200000000000003 28.575 20.625 3 23.200000000000003 22.55 30.2 24.05 4 25.324999999999996 31.8 21.25 21.625 5 28.875 33.324999999999996 18.45 19.35 6 24.65 33.85 19.15 22.35 7 21.45 21.675 33.175 23.7 8 23.400000000000002 23.325000000000003 24.55 28.725 9 24.05 21.925 25.974999999999998 28.050000000000004 10-14 25.25 25.724999999999998 23.315 25.71 15-19 26.085 24.66 24.135 25.119999999999997 20-24 25.895000000000003 25.46 24.3 24.345 25-29 26.055 24.349999999999998 25.205 24.39 30-34 25.395 24.64 25.169999999999998 24.795 35-39 25.86 25.115 24.099999999999998 24.925 40-44 25.795 24.88 24.51 24.815 45-49 25.745 25.480000000000004 24.08 24.695 50-54 24.725 25.31 25.47 24.495 55-59 25.669999999999998 25.779999999999998 24.065 24.485 60-64 26.290000000000003 24.585 25.035 24.09 65-69 26.534999999999997 24.135 24.64 24.69 70-74 26.96 24.625 23.97 24.445 75-79 27.24 23.455000000000002 24.93 24.375 80-84 27.084999999999997 25.165 24.154999999999998 23.595 85-89 23.375 27.725 24.365000000000002 24.535 90-94 26.06 25.330000000000002 24.240000000000002 24.37 95-99 26.39 25.34 24.14 24.13 100-104 26.325 25.685000000000002 24.345 23.645 105-109 26.075 24.89 25.145 23.89 110-114 26.775 25.445 24.32 23.46 115-119 26.979999999999997 24.855 24.19 23.974999999999998 120-124 26.76 25.385 24.815 23.04 125-129 26.405 25.669999999999998 24.6 23.325000000000003 130-134 27.045 25.580000000000002 24.125 23.25 135-139 27.284999999999997 25.22 23.985 23.51 140-144 27.735 26.39 23.18 22.695 145-149 27.58 25.929999999999996 23.945 22.545 150-151 26.4625 25.1875 26.474999999999998 21.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.0 25 0.5 26 0.5 27 0.5 28 4.0 29 7.0 30 7.0 31 8.5 32 11.5 33 13.0 34 18.5 35 31.5 36 39.0 37 50.0 38 68.0 39 92.0 40 108.5 41 119.5 42 140.0 43 149.0 44 167.5 45 180.0 46 183.0 47 185.5 48 174.5 49 162.0 50 157.0 51 157.0 52 159.0 53 150.5 54 126.5 55 121.5 56 118.0 57 93.5 58 86.0 59 107.0 60 97.5 61 78.0 62 77.5 63 73.0 64 75.0 65 66.5 66 63.0 67 70.5 68 56.0 69 41.0 70 30.0 71 20.5 72 17.5 73 11.0 74 5.5 75 4.0 76 3.5 77 1.0 78 0.0 79 0.0 80 0.5 81 1.0 82 1.0 83 0.5 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.225 #Duplication Level Percentage of deduplicated Percentage of total 1 87.50366676444705 74.575 2 9.797594602522734 16.7 3 1.96538574361983 5.025 4 0.2933411557641537 1.0 5 0.1760046934584922 0.75 6 0.11733646230566148 0.6 7 0.05866823115283074 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0880023467292461 1.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TCTAACAACCTTTATATTCTTGCTTGCACTTGTTGGAGTATTCTACCCTT 16 0.4 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 14 0.35000000000000003 No Hit AACGAAAGTTGGGGGCTCGAAGACGATCAGATACCGTCCTAGTCTCAACC 10 0.25 No Hit GGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCA 7 0.17500000000000002 No Hit GTGGTGCCAACGTTGCCGCCAAGGTTGACTTCGCCACCGCTCTCTTCGAG 7 0.17500000000000002 No Hit GTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGG 6 0.15 No Hit ACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTTGAT 6 0.15 No Hit CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 6 0.15 No Hit GTTAGTTTTACCCTACTGATGACCGTGCCGCGATAGTAATTCAACCTAGT 6 0.15 No Hit ATTCAAGCTTTCACAGGGAGAATATGTTGCAGTGGAAAATCTAGAGAACG 5 0.125 No Hit ACAAGCACCACAAGGGCATCCAACTGGTCTTTGGGTCAGATTGTTCCAGC 5 0.125 No Hit GTAAGTTTCTGCAATAATCAAGGAGCTGGCCATTGCATTCCTGCAGGTTG 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit GCGAGCCGGATCGCGCAGGAGGTGAAGCACCCGTTCCGGAACCTCCTGCA 5 0.125 No Hit GGAAGAGCACCGCACGTCGCGCGGTGTCCGGTGCGCCCCCGGCGGCCCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.175 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.55 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.925 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.3 0.0 0.0 0.0 0.0 116-117 2.5250000000000004 0.0 0.0 0.0 0.0 118-119 2.8125 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.8875 0.0 0.0 0.0 0.0 124-125 4.237500000000001 0.0 0.0 0.0 0.0 126-127 4.6875 0.0 0.0 0.0 0.0 128-129 5.199999999999999 0.0 0.0 0.0 0.0 130-131 5.65 0.0 0.0 0.0 0.0 132-133 6.2 0.0 0.0 0.0 0.0 134-135 6.6875 0.0 0.0 0.0 0.0 136-137 7.262499999999999 0.0 0.0 0.0 0.0 138-139 7.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTCGAG 10 0.006830828 145.0 5 >>END_MODULE Read 694834 spots for SRR18694361.sra Written 694834 spots for SRR18694361.sra Read 694834 spots for SRR18694361.sra Written 694834 spots for SRR18694361.sra Read 694834 spots for SRR18694361.sra Written 694834 spots for SRR18694361.sra Read 694834 spots for SRR18694361.sra Written 694834 spots for SRR18694361.sra Read 694834 spots for SRR18694361.sra Written 694834 spots for SRR18694361.sra Read 694834 spots for SRR18694361.sra Written 694834 spots for SRR18694361.sra Read 694834 spots for SRR18694361.sra Written 694834 spots for SRR18694361.sra Read 694834 spots for SRR18694361.sra Written 694834 spots for SRR18694361.sra Read 694834 spots for SRR18694361.sra Written 694834 spots for SRR18694361.sra Read 694834 spots for SRR18694361.sra Written 694834 spots for SRR18694361.sra Read 694834 spots for SRR18694361.sra Written 694834 spots for SRR18694361.sra Read 694834 spots for SRR18694361.sra Written 694834 spots for SRR18694361.sra Read 694834 spots for SRR18694361.sra Written 694834 spots for SRR18694361.sra Read 694834 spots for SRR18694361.sra Written 694834 spots for SRR18694361.sra Read 694834 spots for SRR18694361.sra Written 694834 spots for SRR18694361.sra Read 694834 spots for SRR18694361.sra Written 694834 spots for SRR18694361.sra Read 694834 spots for SRR18694361.sra Written 694834 spots for SRR18694361.sra Read 694846 spots for SRR18694361.sra Written 694846 spots for SRR18694361.sra Read 694834 spots for SRR18694361.sra Written 694834 spots for SRR18694361.sra Read 694834 spots for SRR18694361.sra Written 694834 spots for SRR18694361.sra SRR ids: ['SRR18694361.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tblxro27 SRR18694361.sra spots: 13896692 blocks: [[1, 694834], [694835, 1389668], [1389669, 2084502], [2084503, 2779336], [2779337, 3474170], [3474171, 4169004], [4169005, 4863838], [4863839, 5558672], [5558673, 6253506], [6253507, 6948340], [6948341, 7643174], [7643175, 8338008], [8338009, 9032842], [9032843, 9727676], [9727677, 10422510], [10422511, 11117344], [11117345, 11812178], [11812179, 12507012], [12507013, 13201846], [13201847, 13896692]] SRR18694361 file size 4701003 SRR18694361 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694361 SRR18694361_1.fastq SRR18694361_2.fastq Input file: SRR18694361_1.fastq Paired file: SRR18694361_2.fastq trimmed: SRR18694361-trimmed-pair1.fastq, SRR18694361-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:57:52 2024 >> started Tue Dec 10 05:58:14 2024 >> done (22.124s) 13896692 read pairs processed; of these: 147 ( 0.00%) short read pairs filtered out after trimming by size control 7231 ( 0.05%) empty read pairs filtered out after trimming by size control 13889314 (99.95%) read pairs available; of these: 1723760 (12.41%) trimmed read pairs available after processing 12165554 (87.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 10 0.00% 20 17 0.00% 21 20 0.00% 22 26 0.00% 23 18 0.00% 24 23 0.00% 25 19 0.00% 26 26 0.00% 27 32 0.00% 28 33 0.00% 29 33 0.00% 30 38 0.00% 31 26 0.00% 32 32 0.00% 33 36 0.00% 34 39 0.00% 35 50 0.00% 36 43 0.00% 37 38 0.00% 38 47 0.00% 39 60 0.00% 40 53 0.00% 41 52 0.00% 42 73 0.00% 43 46 0.00% 44 48 0.00% 45 49 0.00% 46 79 0.00% 47 79 0.00% 48 71 0.00% 49 90 0.00% 50 96 0.00% 51 99 0.00% 52 152 0.00% 53 124 0.00% 54 134 0.00% 55 158 0.00% 56 174 0.00% 57 173 0.00% 58 252 0.00% 59 266 0.00% 60 302 0.00% 61 327 0.00% 62 382 0.00% 63 429 0.00% 64 436 0.00% 65 456 0.00% 66 541 0.00% 67 605 0.00% 68 700 0.01% 69 787 0.01% 70 926 0.01% 71 1068 0.01% 72 1266 0.01% 73 1376 0.01% 74 1488 0.01% 75 1650 0.01% 76 1799 0.01% 77 2033 0.01% 78 2270 0.02% 79 2601 0.02% 80 2855 0.02% 81 3198 0.02% 82 3451 0.02% 83 3950 0.03% 84 4327 0.03% 85 4704 0.03% 86 5141 0.04% 87 5331 0.04% 88 5743 0.04% 89 6067 0.04% 90 6386 0.05% 91 7078 0.05% 92 7706 0.06% 93 8151 0.06% 94 8843 0.06% 95 9622 0.07% 96 9827 0.07% 97 10041 0.07% 98 10606 0.08% 99 11395 0.08% 100 12109 0.09% 101 12451 0.09% 102 13084 0.09% 103 13680 0.10% 104 14280 0.10% 105 15096 0.11% 106 15372 0.11% 107 15988 0.12% 108 16463 0.12% 109 16808 0.12% 110 17750 0.13% 111 18820 0.14% 112 19913 0.14% 113 20270 0.15% 114 22120 0.16% 115 22394 0.16% 116 23197 0.17% 117 23989 0.17% 118 23860 0.17% 119 24544 0.18% 120 27214 0.20% 121 26725 0.19% 122 27984 0.20% 123 29259 0.21% 124 30567 0.22% 125 30507 0.22% 126 32347 0.23% 127 32797 0.24% 128 32258 0.23% 129 33785 0.24% 130 33998 0.24% 131 34582 0.25% 132 36895 0.27% 133 36857 0.27% 134 37475 0.27% 135 39304 0.28% 136 39880 0.29% 137 40703 0.29% 138 40658 0.29% 139 41855 0.30% 140 41971 0.30% 141 42782 0.31% 142 44568 0.32% 143 45777 0.33% 144 47753 0.34% 145 47662 0.34% 146 47509 0.34% 147 50303 0.36% 148 48738 0.35% 149 49805 0.36% 150 50247 0.36% 151 12165554 87.59% 13889314 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=33 prefix-density=0.25 prefix-fanout=2.5 sequence=CCACCAAGATCTGCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=34.34 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.8 sequence=GCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=33 prefix-density=0.36 prefix-fanout=2.3 sequence=CTGAACGCCTCTAAGTCAGAATCCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=152.54 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=20.9 sequence=CGCCGCCGCCGACGTCGCGAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAGAAG SRR18694361 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:59:37 Started mapping on | Dec 10 05:59:38 Finished on | Dec 10 06:05:53 Mapping speed, Million of reads per hour | 133.34 Number of input reads | 13889314 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 10095505 Uniquely mapped reads % | 72.69% Average mapped length | 294.55 Number of splices: Total | 10795205 Number of splices: Annotated (sjdb) | 10170126 Number of splices: GT/AG | 10647010 Number of splices: GC/AG | 124675 Number of splices: AT/AC | 6539 Number of splices: Non-canonical | 16981 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.54 Insertion rate per base | 0.01% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 126799 % of reads mapped to multiple loci | 0.91% Number of reads mapped to too many loci | 157961 % of reads mapped to too many loci | 1.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.20% % of reads unmapped: other | 12.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3667010 3667010 3667010 N_multimapping 126799 126799 126799 N_noFeature 337420 9848082 412204 N_ambiguous 202759 1283 30777 UnstrandedReadsAssigned:9555326 PositiveStrandReadsAssigned:246140 NegativeStrandReadsAssigned:9652524 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694361 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694361-trimmed-pair1.fastq SRR18694361-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,889,314 reads, 9,872,008 reads pseudoaligned [quant] estimated average fragment length: 253.725 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52973 SRR18694361.ke.tsv 35125 SRR18694361.se.tsv 88098 total ==> SRR18694361.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 683.766 0 0 PNS24247 1044 791.275 30.7643 5.93216 PNS24249 1928 1675.28 30.1078 2.74213 PNS24246 1044 791.275 30.7643 5.93216 PNS24248 1044 791.275 30.7643 5.93216 PNS24244 1471 1218.28 63.5994 7.96529 PNS24243 293 98.1442 1 1.55464 KQK14069 1603 1350.28 3233.91 365.426 KQK14071 474 242.37 21.6479 13.628 ==> SRR18694361.se.tsv <== BRADI_1g14170v3 3378 BRADI_1g53295v3 42 BRADI_1g59795v3 150 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 233 BRADI_1g74790v3 185 BRADI_1g09890v3 0 BRADI_1g77505v3 69 BRADI_1g48960v3 0 SRR18694361 completed mapping pipeline successfully