Starting /dee2/code/volunteer_pipeline.sh SRR18694362 current disk space = 1525864484864 free memory = 1597088364 SRR18694362 SRAfilesize 324be46dfbc665d80178fe051cbea693 SRR18694362.sra SRR18694362.sra file validated SRR18694362 is paired end SRR18694362 is conventional basespace SRR18694362 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694362_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.067 37.0 37.0 37.0 37.0 37.0 2 36.084 37.0 37.0 37.0 37.0 37.0 3 36.4555 37.0 37.0 37.0 37.0 37.0 4 36.607 37.0 37.0 37.0 37.0 37.0 5 36.565 37.0 37.0 37.0 37.0 37.0 6 36.5385 37.0 37.0 37.0 37.0 37.0 7 36.5315 37.0 37.0 37.0 37.0 37.0 8 36.5565 37.0 37.0 37.0 37.0 37.0 9 36.621 37.0 37.0 37.0 37.0 37.0 10-14 36.6373 37.0 37.0 37.0 37.0 37.0 15-19 36.5862 37.0 37.0 37.0 37.0 37.0 20-24 36.63349999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.5556 37.0 37.0 37.0 37.0 37.0 30-34 36.55970000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.6528 37.0 37.0 37.0 37.0 37.0 40-44 36.5643 37.0 37.0 37.0 37.0 37.0 45-49 36.3872 37.0 37.0 37.0 37.0 37.0 50-54 36.4788 37.0 37.0 37.0 37.0 37.0 55-59 36.4708 37.0 37.0 37.0 37.0 37.0 60-64 36.4527 37.0 37.0 37.0 37.0 37.0 65-69 36.2267 37.0 37.0 37.0 37.0 37.0 70-74 36.3209 37.0 37.0 37.0 37.0 37.0 75-79 36.4457 37.0 37.0 37.0 37.0 37.0 80-84 36.389799999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.118 37.0 37.0 37.0 37.0 37.0 90-94 35.3869 37.0 37.0 37.0 29.8 37.0 95-99 36.1263 37.0 37.0 37.0 37.0 37.0 100-104 36.1408 37.0 37.0 37.0 37.0 37.0 105-109 36.117399999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.1808 37.0 37.0 37.0 37.0 37.0 115-119 36.4246 37.0 37.0 37.0 37.0 37.0 120-124 36.520900000000005 37.0 37.0 37.0 37.0 37.0 125-129 36.4491 37.0 37.0 37.0 37.0 37.0 130-134 36.4891 37.0 37.0 37.0 37.0 37.0 135-139 36.336 37.0 37.0 37.0 37.0 37.0 140-144 36.101099999999995 37.0 37.0 37.0 37.0 37.0 145-149 36.032300000000006 37.0 37.0 37.0 37.0 37.0 150-151 33.56675 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 1.0 24 0.0 25 4.0 26 2.0 27 3.0 28 6.0 29 2.0 30 13.0 31 20.0 32 42.0 33 56.0 34 116.0 35 317.0 36 3242.0 37 173.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.425 11.0 6.8500000000000005 35.725 2 22.613065326633166 10.100502512562814 33.5678391959799 33.71859296482412 3 19.525000000000002 13.8 25.825 40.849999999999994 4 26.35 18.95 22.825 31.874999999999996 5 26.650000000000002 25.775 23.9 23.674999999999997 6 24.85 29.375 23.05 22.725 7 19.275000000000002 24.425 38.15 18.15 8 20.925 23.3 29.475 26.3 9 20.325 22.025 32.75 24.9 10-14 22.75 26.26 25.869999999999997 25.119999999999997 15-19 22.965 24.4 26.015 26.619999999999997 20-24 23.14 25.255 26.340000000000003 25.264999999999997 25-29 23.630000000000003 24.925 25.71 25.735000000000003 30-34 23.22 24.775 25.72 26.284999999999997 35-39 23.330000000000002 25.055 25.53 26.085 40-44 22.965 24.975 26.035000000000004 26.025 45-49 23.365 24.745 25.480000000000004 26.41 50-54 23.235 24.825 25.380000000000003 26.56 55-59 23.225 25.205 25.679999999999996 25.89 60-64 23.62 24.995 25.430000000000003 25.955000000000002 65-69 23.76 24.13 26.200000000000003 25.91 70-74 23.919999999999998 25.335 24.955 25.790000000000003 75-79 23.02 25.080000000000002 25.355 26.545 80-84 23.865 25.374999999999996 24.83 25.929999999999996 85-89 23.990000000000002 24.895 25.03 26.085 90-94 24.08 24.68 24.865000000000002 26.375 95-99 23.365 25.374999999999996 24.985 26.275 100-104 23.73 25.145 24.82 26.305 105-109 23.78 25.119999999999997 25.31 25.790000000000003 110-114 24.060000000000002 25.35 24.89 25.7 115-119 24.365000000000002 24.560000000000002 25.185000000000002 25.89 120-124 24.38 25.15 23.985 26.484999999999996 125-129 24.349999999999998 24.725 24.345 26.58 130-134 24.795 25.074999999999996 23.82 26.31 135-139 24.01 24.965 24.545 26.479999999999997 140-144 24.67 24.01 25.06 26.26 145-149 24.490000000000002 25.130000000000003 23.95 26.43 150-151 23.8125 24.55 24.625 27.0125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.5 27 2.5 28 4.0 29 5.5 30 7.0 31 11.5 32 13.0 33 18.5 34 28.0 35 37.5 36 50.0 37 63.0 38 72.5 39 90.0 40 120.0 41 136.5 42 139.5 43 157.0 44 182.5 45 194.5 46 194.0 47 186.5 48 189.5 49 166.5 50 149.0 51 150.5 52 138.0 53 135.0 54 126.0 55 102.0 56 96.0 57 107.5 58 98.0 59 84.0 60 79.0 61 71.5 62 70.5 63 66.0 64 68.0 65 74.5 66 59.5 67 47.5 68 45.5 69 42.0 70 32.0 71 22.0 72 18.0 73 14.5 74 9.0 75 6.0 76 5.0 77 2.5 78 1.0 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 86.5446091252543 74.45 2 11.392037198488811 19.6 3 1.7146178436501018 4.425 4 0.23249055507120026 0.8 5 0.058122638767800064 0.25 6 0.029061319383900032 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.029061319383900032 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGGCGAACGTCACGAACCCGAACCCGCGCGACCGCCCAGTCTCCCTGTC 13 0.325 No Hit GCCTGCTGATGTTTCTTCCCCATGATCTCTTTTATTGATGCTGCAATCAC 6 0.15 No Hit CACCACAGTTGAGTTTCCATACCTGTCTTCCTCTGGCACATCAGTTTGTT 5 0.125 No Hit GCCCTATTGTGGCATGTTGGAGGGCACCTGCATGATGGGCCACATTCATA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.8375 0.0 0.0 0.0 0.0 110-111 2.0375 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.4 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.2625 0.0 0.0 0.0 0.0 122-123 3.6624999999999996 0.0 0.0 0.0 0.0 124-125 4.05 0.0 0.0 0.0 0.0 126-127 4.2875 0.0 0.0 0.0 0.0 128-129 4.6625 0.0 0.0 0.0 0.0 130-131 5.0875 0.0 0.0 0.0 0.0 132-133 5.5375 0.0 0.0 0.0 0.0 134-135 6.1 0.0 0.0 0.0 0.0 136-137 6.675 0.0 0.0 0.0 0.0 138-139 7.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTCTT 10 0.006830828 145.0 4 CGTAGAG 10 0.006830828 145.0 7 CCCTGGC 10 0.006830828 145.0 5 AGTCTTC 10 0.006830828 145.0 5 GCCCTGG 10 0.006830828 145.0 4 >>END_MODULE SRR18694362 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694362_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.6275 37.0 37.0 37.0 25.0 37.0 2 34.7615 37.0 37.0 37.0 25.0 37.0 3 35.0695 37.0 37.0 37.0 25.0 37.0 4 34.9715 37.0 37.0 37.0 25.0 37.0 5 34.9785 37.0 37.0 37.0 25.0 37.0 6 34.9935 37.0 37.0 37.0 25.0 37.0 7 34.968 37.0 37.0 37.0 25.0 37.0 8 35.293 37.0 37.0 37.0 25.0 37.0 9 35.331 37.0 37.0 37.0 25.0 37.0 10-14 35.3352 37.0 37.0 37.0 29.8 37.0 15-19 35.3614 37.0 37.0 37.0 34.6 37.0 20-24 35.2165 37.0 37.0 37.0 29.8 37.0 25-29 35.3769 37.0 37.0 37.0 32.2 37.0 30-34 35.5544 37.0 37.0 37.0 34.6 37.0 35-39 35.4347 37.0 37.0 37.0 32.2 37.0 40-44 35.1078 37.0 37.0 37.0 27.4 37.0 45-49 35.3592 37.0 37.0 37.0 29.8 37.0 50-54 34.7918 37.0 37.0 37.0 27.0 37.0 55-59 34.237 37.0 37.0 37.0 25.0 37.0 60-64 34.947700000000005 37.0 37.0 37.0 27.4 37.0 65-69 34.1157 37.0 34.6 37.0 27.4 37.0 70-74 32.8846 37.0 29.8 37.0 22.2 37.0 75-79 33.4227 37.0 34.6 37.0 22.2 37.0 80-84 34.400400000000005 37.0 37.0 37.0 25.0 37.0 85-89 32.5135 37.0 32.2 37.0 19.4 37.0 90-94 33.999900000000004 37.0 37.0 37.0 25.0 37.0 95-99 33.850300000000004 37.0 37.0 37.0 25.0 37.0 100-104 33.33319999999999 37.0 37.0 37.0 25.0 37.0 105-109 34.0968 37.0 37.0 37.0 25.0 37.0 110-114 34.4856 37.0 37.0 37.0 25.0 37.0 115-119 34.4131 37.0 37.0 37.0 25.0 37.0 120-124 34.0244 37.0 37.0 37.0 25.0 37.0 125-129 33.976 37.0 37.0 37.0 25.0 37.0 130-134 33.6372 37.0 34.6 37.0 25.0 37.0 135-139 32.105999999999995 37.0 27.4 37.0 13.8 37.0 140-144 31.5524 37.0 25.0 37.0 11.0 37.0 145-149 30.9928 37.0 25.0 37.0 11.0 37.0 150-151 30.8455 37.0 25.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 3.0 19 2.0 20 0.0 21 4.0 22 7.0 23 11.0 24 9.0 25 9.0 26 17.0 27 20.0 28 38.0 29 37.0 30 77.0 31 181.0 32 309.0 33 592.0 34 1179.0 35 1309.0 36 195.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.125 20.849999999999998 8.95 28.075 2 31.924999999999997 20.474999999999998 26.400000000000002 21.2 3 24.099999999999998 24.65 28.775000000000002 22.475 4 25.775 28.675 21.8 23.75 5 30.225 31.25 18.825 19.7 6 24.775 35.175 19.05 21.0 7 23.825 20.200000000000003 33.5 22.475 8 25.25 22.425 23.45 28.875 9 24.95 21.975 26.75 26.325 10-14 26.640000000000004 25.4 23.150000000000002 24.81 15-19 27.27 24.65 23.549999999999997 24.529999999999998 20-24 26.41 24.75 23.830000000000002 25.009999999999998 25-29 26.38 24.94 23.705000000000002 24.975 30-34 26.029999999999998 25.674999999999997 23.82 24.474999999999998 35-39 26.445 24.765 24.115000000000002 24.675 40-44 26.85 25.055 23.549999999999997 24.545 45-49 26.565 25.145 24.035 24.255 50-54 25.835 24.73 25.06 24.375 55-59 26.040000000000003 25.03 24.275 24.654999999999998 60-64 26.295 24.44 24.575 24.69 65-69 26.21 24.345 24.39 25.055 70-74 26.845000000000002 23.995 25.16 24.0 75-79 28.04 22.994999999999997 24.785 24.18 80-84 26.97 25.355 23.535 24.14 85-89 24.154999999999998 27.74 23.815 24.29 90-94 26.334999999999997 25.285000000000004 24.265 24.115000000000002 95-99 26.63 25.374999999999996 22.975 25.019999999999996 100-104 26.685 25.46 24.044999999999998 23.810000000000002 105-109 26.700000000000003 24.8 24.27 24.23 110-114 26.729999999999997 24.779999999999998 25.055 23.435 115-119 26.779999999999998 24.92 24.310000000000002 23.990000000000002 120-124 26.555 25.355 24.055 24.035 125-129 26.974999999999998 25.44 23.72 23.865 130-134 26.724999999999998 25.900000000000002 23.810000000000002 23.565 135-139 26.58 25.430000000000003 24.745 23.244999999999997 140-144 27.295 25.655 23.95 23.1 145-149 27.744999999999997 25.22 24.19 22.845 150-151 25.424999999999997 25.0125 26.8625 22.7 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 0.0 23 0.5 24 1.0 25 1.5 26 3.0 27 3.0 28 4.0 29 6.5 30 6.5 31 7.5 32 10.5 33 14.0 34 21.0 35 28.0 36 33.5 37 52.5 38 74.0 39 98.5 40 114.0 41 116.0 42 138.0 43 158.5 44 155.0 45 157.0 46 185.5 47 185.5 48 166.5 49 156.5 50 144.5 51 137.5 52 127.0 53 123.5 54 119.0 55 117.5 56 108.5 57 92.0 58 86.5 59 101.5 60 102.0 61 90.0 62 100.5 63 91.5 64 81.5 65 70.5 66 62.5 67 63.5 68 58.5 69 54.0 70 42.5 71 34.0 72 28.0 73 17.0 74 8.0 75 6.0 76 6.0 77 3.5 78 1.5 79 1.5 80 1.5 81 1.5 82 0.0 83 1.0 84 1.5 85 1.0 86 0.5 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 1.5 97 1.5 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.15 #Duplication Level Percentage of deduplicated Percentage of total 1 88.35341365461848 77.0 2 9.63855421686747 16.8 3 1.4916810097532989 3.9 4 0.34423407917383825 1.2 5 0.05737234652897303 0.25 6 0.028686173264486515 0.15 7 0.028686173264486515 0.17500000000000002 8 0.0 0.0 9 0.028686173264486515 0.22499999999999998 >10 0.028686173264486515 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGTAGTAGCAGCTAGGGTTTCCGGTAGGGTTCCGTCGAGATCGCCATG 12 0.3 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 9 0.22499999999999998 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit ATCTCGTGTAGTTTCAGGGAAACATACAAATCCTTGGAATTCCTCTCCCC 6 0.15 No Hit ATTTCTTGTCTAGAAAACATAACTAACTGTGCTGTGTGAACCTTGAAATG 5 0.125 No Hit TACCAAAGTCATATATCCTCCTCCGTATGCAAAAGATCCCCCGGAAGGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.48750000000000004 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.175 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.7625 0.0 0.0 0.0 0.0 110-111 1.9625 0.0 0.0 0.0 0.0 112-113 2.0999999999999996 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.5875 0.0 0.0 0.0 0.0 118-119 2.8875 0.0 0.0 0.0 0.0 120-121 3.1625 0.0 0.0 0.0 0.0 122-123 3.5625 0.0 0.0 0.0 0.0 124-125 3.95 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.5375 0.0 0.0 0.0 0.0 130-131 4.975 0.0 0.0 0.0 0.0 132-133 5.4375 0.0 0.0 0.0 0.0 134-135 5.975 0.0 0.0 0.0 0.0 136-137 6.575 0.0 0.0 0.0 0.0 138-139 7.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGCAAT 10 0.006830828 145.0 1 >>END_MODULE Read 702550 spots for SRR18694362.sra Written 702550 spots for SRR18694362.sra Read 702550 spots for SRR18694362.sra Written 702550 spots for SRR18694362.sra Read 702550 spots for SRR18694362.sra Written 702550 spots for SRR18694362.sra Read 702550 spots for SRR18694362.sra Written 702550 spots for SRR18694362.sra Read 702550 spots for SRR18694362.sra Written 702550 spots for SRR18694362.sra Read 702550 spots for SRR18694362.sra Written 702550 spots for SRR18694362.sra Read 702550 spots for SRR18694362.sra Written 702550 spots for SRR18694362.sra Read 702550 spots for SRR18694362.sra Written 702550 spots for SRR18694362.sra Read 702550 spots for SRR18694362.sra Written 702550 spots for SRR18694362.sra Read 702550 spots for SRR18694362.sra Written 702550 spots for SRR18694362.sra Read 702555 spots for SRR18694362.sra Written 702555 spots for SRR18694362.sra Read 702550 spots for SRR18694362.sra Written 702550 spots for SRR18694362.sra Read 702550 spots for SRR18694362.sra Written 702550 spots for SRR18694362.sra Read 702550 spots for SRR18694362.sra Written 702550 spots for SRR18694362.sra Read 702550 spots for SRR18694362.sra Written 702550 spots for SRR18694362.sra Read 702550 spots for SRR18694362.sra Written 702550 spots for SRR18694362.sra Read 702550 spots for SRR18694362.sra Written 702550 spots for SRR18694362.sra Read 702550 spots for SRR18694362.sra Written 702550 spots for SRR18694362.sra Read 702550 spots for SRR18694362.sra Written 702550 spots for SRR18694362.sra Read 702550 spots for SRR18694362.sra Written 702550 spots for SRR18694362.sra SRR ids: ['SRR18694362.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zm5iok84 SRR18694362.sra spots: 14051005 blocks: [[1, 702550], [702551, 1405100], [1405101, 2107650], [2107651, 2810200], [2810201, 3512750], [3512751, 4215300], [4215301, 4917850], [4917851, 5620400], [5620401, 6322950], [6322951, 7025500], [7025501, 7728050], [7728051, 8430600], [8430601, 9133150], [9133151, 9835700], [9835701, 10538250], [10538251, 11240800], [11240801, 11943350], [11943351, 12645900], [12645901, 13348450], [13348451, 14051005]] SRR18694362 file size 4753445 SRR18694362 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694362 SRR18694362_1.fastq SRR18694362_2.fastq Input file: SRR18694362_1.fastq Paired file: SRR18694362_2.fastq trimmed: SRR18694362-trimmed-pair1.fastq, SRR18694362-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:58:02 2024 >> started Tue Dec 10 05:58:17 2024 >> done (14.640s) 14051005 read pairs processed; of these: 107 ( 0.00%) short read pairs filtered out after trimming by size control 9614 ( 0.07%) empty read pairs filtered out after trimming by size control 14041284 (99.93%) read pairs available; of these: 1447571 (10.31%) trimmed read pairs available after processing 12593713 (89.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 9 0.00% 20 16 0.00% 21 19 0.00% 22 13 0.00% 23 15 0.00% 24 24 0.00% 25 20 0.00% 26 29 0.00% 27 29 0.00% 28 21 0.00% 29 37 0.00% 30 46 0.00% 31 45 0.00% 32 49 0.00% 33 34 0.00% 34 29 0.00% 35 50 0.00% 36 38 0.00% 37 38 0.00% 38 42 0.00% 39 34 0.00% 40 46 0.00% 41 51 0.00% 42 48 0.00% 43 60 0.00% 44 44 0.00% 45 55 0.00% 46 69 0.00% 47 57 0.00% 48 60 0.00% 49 63 0.00% 50 74 0.00% 51 85 0.00% 52 90 0.00% 53 114 0.00% 54 85 0.00% 55 114 0.00% 56 111 0.00% 57 150 0.00% 58 128 0.00% 59 146 0.00% 60 213 0.00% 61 178 0.00% 62 222 0.00% 63 246 0.00% 64 274 0.00% 65 356 0.00% 66 330 0.00% 67 327 0.00% 68 433 0.00% 69 518 0.00% 70 547 0.00% 71 618 0.00% 72 763 0.01% 73 806 0.01% 74 821 0.01% 75 946 0.01% 76 1053 0.01% 77 1155 0.01% 78 1288 0.01% 79 1508 0.01% 80 1687 0.01% 81 1913 0.01% 82 2122 0.02% 83 2392 0.02% 84 2530 0.02% 85 2797 0.02% 86 3078 0.02% 87 3390 0.02% 88 3559 0.03% 89 3953 0.03% 90 4218 0.03% 91 4659 0.03% 92 4980 0.04% 93 5501 0.04% 94 5938 0.04% 95 6310 0.04% 96 6687 0.05% 97 7167 0.05% 98 7507 0.05% 99 7874 0.06% 100 8552 0.06% 101 9256 0.07% 102 9476 0.07% 103 10004 0.07% 104 10514 0.07% 105 11026 0.08% 106 11667 0.08% 107 12199 0.09% 108 13014 0.09% 109 13306 0.09% 110 13724 0.10% 111 14694 0.10% 112 15373 0.11% 113 16142 0.11% 114 16798 0.12% 115 17887 0.13% 116 18342 0.13% 117 18918 0.13% 118 19337 0.14% 119 20237 0.14% 120 20967 0.15% 121 21944 0.16% 122 22243 0.16% 123 23935 0.17% 124 24762 0.18% 125 26197 0.19% 126 26711 0.19% 127 27015 0.19% 128 28094 0.20% 129 28750 0.20% 130 29194 0.21% 131 30234 0.22% 132 31513 0.22% 133 32490 0.23% 134 33589 0.24% 135 34253 0.24% 136 35008 0.25% 137 36401 0.26% 138 36298 0.26% 139 38012 0.27% 140 38236 0.27% 141 39663 0.28% 142 39965 0.28% 143 41248 0.29% 144 42836 0.31% 145 44229 0.31% 146 44107 0.31% 147 45504 0.32% 148 46303 0.33% 149 46395 0.33% 150 47841 0.34% 151 12593713 89.69% 14041284 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=24 prefix-density=0.52 prefix-fanout=2.1 sequence=GGGTACTCCTTCTTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=162.50 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=9.9 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=26 prefix-density=0.44 prefix-fanout=2.1 sequence=AGCAAGGTCGGCTTCGTCTTTCGCGAGCATGCCAGGTCCCCTGGATACTACGACGGCAGGTACTGGACCATGTGGAAGCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=132.45 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.4 sequence=GTGCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGAGATTTGGAAGATGTCTTGCAGCTGTGGATCAAGCTGCAACTGTGGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGCCAGCACCACCAGCAGCACCCAGGCCCAGGTGGTGGTTCTCGGCATGGCGCCGGAGAAG SRR18694362 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 05:58:57 Started mapping on | Dec 10 05:58:57 Finished on | Dec 10 06:00:25 Mapping speed, Million of reads per hour | 574.42 Number of input reads | 14041284 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12748391 Uniquely mapped reads % | 90.79% Average mapped length | 295.94 Number of splices: Total | 11876951 Number of splices: Annotated (sjdb) | 11097732 Number of splices: GT/AG | 11715127 Number of splices: GC/AG | 135371 Number of splices: AT/AC | 5135 Number of splices: Non-canonical | 21318 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.01% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 384453 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 50919 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.70% % of reads unmapped: other | 3.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 908440 908440 908440 N_multimapping 384453 384453 384453 N_noFeature 783300 12314643 945240 N_ambiguous 326585 1982 55029 UnstrandedReadsAssigned:11638506 PositiveStrandReadsAssigned:431766 NegativeStrandReadsAssigned:11748122 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694362 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694362-trimmed-pair1.fastq SRR18694362-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,041,284 reads, 11,973,541 reads pseudoaligned [quant] estimated average fragment length: 252.132 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52973 SRR18694362.ke.tsv 35125 SRR18694362.se.tsv 88098 total ==> SRR18694362.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 685.331 3.6259e-05 5.90345e-06 PNS24247 1044 792.868 55.0853 7.7522 PNS24249 1928 1676.87 62.5346 4.16113 PNS24246 1044 792.868 55.0853 7.7522 PNS24248 1044 792.868 55.0853 7.7522 PNS24244 1471 1219.87 116.21 10.6297 PNS24243 293 94.4268 0 0 KQK14069 1603 1351.87 1472.55 121.542 KQK14071 474 240.98 24.3254 11.2634 ==> SRR18694362.se.tsv <== BRADI_1g14170v3 1605 BRADI_1g53295v3 1021 BRADI_1g59795v3 388 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 208 BRADI_1g74790v3 257 BRADI_1g09890v3 0 BRADI_1g77505v3 144 BRADI_1g48960v3 0 SRR18694362 completed mapping pipeline successfully