Starting /dee2/code/volunteer_pipeline.sh SRR18694363 current disk space = 1525841694720 free memory = 1561118088 SRR18694363 SRAfilesize 0a1f9b92b0be5a86514bea34dbd60b61 SRR18694363.sra SRR18694363.sra file validated SRR18694363 is paired end SRR18694363 is conventional basespace SRR18694363 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694363_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0465 37.0 37.0 37.0 37.0 37.0 2 36.0065 37.0 37.0 37.0 37.0 37.0 3 36.4445 37.0 37.0 37.0 37.0 37.0 4 36.5115 37.0 37.0 37.0 37.0 37.0 5 36.5325 37.0 37.0 37.0 37.0 37.0 6 36.562 37.0 37.0 37.0 37.0 37.0 7 36.5645 37.0 37.0 37.0 37.0 37.0 8 36.638 37.0 37.0 37.0 37.0 37.0 9 36.642 37.0 37.0 37.0 37.0 37.0 10-14 36.637600000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.6275 37.0 37.0 37.0 37.0 37.0 20-24 36.6078 37.0 37.0 37.0 37.0 37.0 25-29 36.5329 37.0 37.0 37.0 37.0 37.0 30-34 36.5261 37.0 37.0 37.0 37.0 37.0 35-39 36.6631 37.0 37.0 37.0 37.0 37.0 40-44 36.5973 37.0 37.0 37.0 37.0 37.0 45-49 36.404900000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.506499999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.5168 37.0 37.0 37.0 37.0 37.0 60-64 36.4785 37.0 37.0 37.0 37.0 37.0 65-69 36.284499999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.3783 37.0 37.0 37.0 37.0 37.0 75-79 36.45700000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.3822 37.0 37.0 37.0 37.0 37.0 85-89 36.153000000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.3962 37.0 37.0 37.0 29.8 37.0 95-99 36.1375 37.0 37.0 37.0 37.0 37.0 100-104 36.1674 37.0 37.0 37.0 37.0 37.0 105-109 36.149 37.0 37.0 37.0 37.0 37.0 110-114 36.204100000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.462 37.0 37.0 37.0 37.0 37.0 120-124 36.5793 37.0 37.0 37.0 37.0 37.0 125-129 36.4875 37.0 37.0 37.0 37.0 37.0 130-134 36.4562 37.0 37.0 37.0 37.0 37.0 135-139 36.4022 37.0 37.0 37.0 37.0 37.0 140-144 36.1923 37.0 37.0 37.0 37.0 37.0 145-149 36.1767 37.0 37.0 37.0 37.0 37.0 150-151 33.807 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 3.0 26 2.0 27 6.0 28 1.0 29 7.0 30 6.0 31 15.0 32 27.0 33 59.0 34 120.0 35 317.0 36 3231.0 37 203.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.275 10.85 4.25 40.625 2 19.53360080240722 9.679037111334003 38.94182547642929 31.845536609829487 3 18.525 13.0 26.224999999999998 42.25 4 25.0 19.725 23.1 32.175 5 27.650000000000002 25.974999999999998 23.325000000000003 23.05 6 22.075 31.025000000000002 24.025 22.875 7 18.925 25.074999999999996 37.875 18.125 8 18.4 23.125 32.800000000000004 25.674999999999997 9 18.175 20.775 34.275 26.775 10-14 22.205 26.565 26.375 24.855 15-19 22.575 24.92 26.765 25.740000000000002 20-24 22.939999999999998 25.945 26.290000000000003 24.825 25-29 23.155 25.34 26.815 24.69 30-34 22.42 25.1 26.340000000000003 26.14 35-39 21.78 25.515 26.255 26.450000000000003 40-44 23.095 25.515 25.735000000000003 25.655 45-49 22.975 25.480000000000004 26.045 25.5 50-54 22.625 25.095 26.325 25.955000000000002 55-59 22.88 25.509999999999998 25.995 25.615 60-64 22.375 25.55 26.450000000000003 25.624999999999996 65-69 22.56 25.314999999999998 26.75 25.374999999999996 70-74 22.720000000000002 25.540000000000003 26.174999999999997 25.564999999999998 75-79 22.25 25.624999999999996 26.105 26.02 80-84 22.57 25.47 25.674999999999997 26.284999999999997 85-89 22.89 25.75 26.169999999999998 25.19 90-94 22.91 25.11 26.205000000000002 25.775 95-99 22.939999999999998 25.290000000000003 25.91 25.86 100-104 23.26 25.6 25.745 25.395 105-109 23.25 25.264999999999997 25.81 25.674999999999997 110-114 23.27 24.88 26.025 25.825 115-119 23.3 25.28 25.874999999999996 25.545 120-124 22.63 25.805 25.405 26.16 125-129 23.22 25.72 25.485000000000003 25.575 130-134 23.325000000000003 25.28 25.080000000000002 26.314999999999998 135-139 23.0 25.41 25.46 26.13 140-144 22.865 25.845000000000002 25.845000000000002 25.445 145-149 23.974999999999998 25.25 25.915 24.86 150-151 23.7125 25.162499999999998 24.8125 26.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 0.0 24 0.0 25 2.0 26 3.0 27 4.0 28 8.5 29 11.5 30 11.0 31 12.0 32 15.0 33 20.5 34 31.5 35 43.0 36 53.0 37 73.5 38 88.0 39 96.5 40 102.0 41 123.0 42 152.0 43 176.5 44 204.0 45 209.5 46 210.5 47 202.0 48 184.5 49 192.5 50 176.0 51 153.5 52 138.0 53 121.0 54 129.0 55 125.5 56 128.5 57 110.5 58 82.5 59 77.5 60 72.5 61 67.5 62 60.5 63 54.5 64 46.5 65 34.5 66 30.0 67 33.5 68 36.5 69 27.0 70 13.0 71 10.5 72 8.5 73 10.0 74 9.0 75 3.0 76 3.5 77 2.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.3 #Duplication Level Percentage of deduplicated Percentage of total 1 87.88659793814433 76.725 2 10.137457044673539 17.7 3 1.575028636884307 4.125 4 0.3436426116838488 1.2 5 0.057273768613974804 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCGCGTACTGCTTGGCGCGGGCGAAGATGACCTTGCGGTTCTCGCTCG 5 0.125 No Hit GCTTCTGCTCCAAAACATGAAGATGATCAGACTGGACATAATCTTCTGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.9624999999999999 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 1.825 0.0 0.0 0.0 0.0 116-117 2.1500000000000004 0.0 0.0 0.0 0.0 118-119 2.2375 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 2.875 0.0 0.0 0.0 0.0 124-125 3.1500000000000004 0.0 0.0 0.0 0.0 126-127 3.525 0.0 0.0 0.0 0.0 128-129 3.875 0.0 0.0 0.0 0.0 130-131 4.125 0.0 0.0 0.0 0.0 132-133 4.35 0.0 0.0 0.0 0.0 134-135 4.7125 0.0 0.0 0.0 0.0 136-137 5.074999999999999 0.0 0.0 0.0 0.0 138-139 5.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGCAT 10 0.006830828 145.0 1 ATATCCC 10 0.006830828 145.0 145 >>END_MODULE SRR18694363 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694363_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.1845 37.0 37.0 37.0 25.0 37.0 2 34.984 37.0 37.0 37.0 25.0 37.0 3 35.0195 37.0 37.0 37.0 25.0 37.0 4 35.1105 37.0 37.0 37.0 25.0 37.0 5 35.198 37.0 37.0 37.0 25.0 37.0 6 35.256 37.0 37.0 37.0 25.0 37.0 7 35.1955 37.0 37.0 37.0 25.0 37.0 8 35.3695 37.0 37.0 37.0 37.0 37.0 9 35.494 37.0 37.0 37.0 37.0 37.0 10-14 35.4379 37.0 37.0 37.0 37.0 37.0 15-19 35.6083 37.0 37.0 37.0 37.0 37.0 20-24 35.394800000000004 37.0 37.0 37.0 34.6 37.0 25-29 35.4969 37.0 37.0 37.0 32.2 37.0 30-34 35.7868 37.0 37.0 37.0 37.0 37.0 35-39 35.644600000000004 37.0 37.0 37.0 34.6 37.0 40-44 35.3649 37.0 37.0 37.0 29.8 37.0 45-49 35.473 37.0 37.0 37.0 37.0 37.0 50-54 34.8819 37.0 37.0 37.0 27.0 37.0 55-59 34.3534 37.0 37.0 37.0 25.0 37.0 60-64 35.0171 37.0 37.0 37.0 27.4 37.0 65-69 34.1591 37.0 34.6 37.0 27.4 37.0 70-74 33.1142 37.0 29.8 37.0 22.2 37.0 75-79 33.6336 37.0 34.6 37.0 22.2 37.0 80-84 34.5494 37.0 37.0 37.0 25.0 37.0 85-89 32.658100000000005 37.0 32.2 37.0 19.4 37.0 90-94 34.099900000000005 37.0 37.0 37.0 25.0 37.0 95-99 33.7974 37.0 37.0 37.0 25.0 37.0 100-104 33.4376 37.0 37.0 37.0 25.0 37.0 105-109 34.150400000000005 37.0 37.0 37.0 25.0 37.0 110-114 34.5304 37.0 37.0 37.0 25.0 37.0 115-119 34.4365 37.0 37.0 37.0 25.0 37.0 120-124 34.1237 37.0 37.0 37.0 25.0 37.0 125-129 34.0091 37.0 37.0 37.0 25.0 37.0 130-134 33.6794 37.0 37.0 37.0 25.0 37.0 135-139 32.1741 37.0 27.4 37.0 13.8 37.0 140-144 31.5125 37.0 25.0 37.0 11.0 37.0 145-149 31.1278 37.0 25.0 37.0 11.0 37.0 150-151 30.8815 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 2.0 19 0.0 20 3.0 21 6.0 22 3.0 23 1.0 24 5.0 25 5.0 26 12.0 27 18.0 28 31.0 29 50.0 30 95.0 31 144.0 32 267.0 33 565.0 34 1194.0 35 1405.0 36 192.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.775 20.5 7.95 30.775000000000002 2 28.7 21.825 29.349999999999998 20.125 3 20.849999999999998 23.7 30.5 24.95 4 24.349999999999998 30.925000000000004 22.6 22.125 5 27.500000000000004 33.300000000000004 19.375 19.825 6 21.8 37.85 19.400000000000002 20.95 7 23.674999999999997 19.85 33.95 22.525000000000002 8 22.925 22.975 26.400000000000002 27.700000000000003 9 24.224999999999998 23.1 26.924999999999997 25.75 10-14 25.724999999999998 26.455000000000002 23.905 23.915 15-19 25.345000000000002 26.135 24.490000000000002 24.03 20-24 26.44 25.35 24.39 23.82 25-29 26.14 25.665 24.115000000000002 24.08 30-34 25.590000000000003 25.56 24.77 24.08 35-39 25.7 25.679999999999996 24.560000000000002 24.060000000000002 40-44 25.45 25.814999999999998 25.119999999999997 23.615 45-49 25.965 25.895000000000003 24.485 23.655 50-54 23.990000000000002 26.19 26.295 23.525 55-59 25.874999999999996 25.56 24.595 23.97 60-64 25.4 25.814999999999998 24.89 23.895 65-69 26.484999999999996 25.72 24.779999999999998 23.015 70-74 26.05 25.735000000000003 24.94 23.275000000000002 75-79 27.08 24.095 25.61 23.215 80-84 25.95 26.235000000000003 24.92 22.895 85-89 23.71 27.99 24.985 23.315 90-94 26.105 25.874999999999996 24.725 23.294999999999998 95-99 26.06 27.189999999999998 23.995 22.755 100-104 25.465 26.095000000000002 24.59 23.849999999999998 105-109 27.029999999999998 26.314999999999998 24.54 22.115000000000002 110-114 25.39 26.25 25.619999999999997 22.74 115-119 25.929999999999996 26.290000000000003 24.87 22.91 120-124 26.69 25.52 25.195 22.595000000000002 125-129 26.229999999999997 27.04 24.235 22.495 130-134 26.44 26.135 24.79 22.634999999999998 135-139 26.515 26.35 24.990000000000002 22.145 140-144 26.445 25.495 25.52 22.54 145-149 27.195000000000004 26.235000000000003 24.385 22.185 150-151 24.975 26.85 26.1125 22.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 3.0 27 7.0 28 7.5 29 7.0 30 8.0 31 12.0 32 22.0 33 28.0 34 31.5 35 40.5 36 46.5 37 51.0 38 64.5 39 104.0 40 129.5 41 131.5 42 150.5 43 175.5 44 190.0 45 191.0 46 201.0 47 203.0 48 173.5 49 154.5 50 150.5 51 135.0 52 130.5 53 144.0 54 139.5 55 117.0 56 99.0 57 94.5 58 92.5 59 83.0 60 83.0 61 79.5 62 79.5 63 77.5 64 57.0 65 46.5 66 54.5 67 50.0 68 35.0 69 32.5 70 23.5 71 15.0 72 16.0 73 11.5 74 4.5 75 2.0 76 2.5 77 2.0 78 0.5 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.625 #Duplication Level Percentage of deduplicated Percentage of total 1 89.22425952045134 79.07499999999999 2 9.19605077574048 16.3 3 1.2976022566995769 3.45 4 0.16925246826516221 0.6 5 0.05641748942172073 0.25 6 0.028208744710860365 0.15 7 0.028208744710860365 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 7 0.17500000000000002 No Hit CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 6 0.15 No Hit TGTTGCTGCTCTTCAGCGCATCTCTTCATACTATAGCTCCGCCCAGAGAA 5 0.125 No Hit CGTCAAGGTAAGATGTCGTCTGAGGCGGCCAAGGTGGTGGTGCCGGAGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.7375 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.1625 0.0 0.0 0.0 0.0 118-119 2.2375 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 2.875 0.0 0.0 0.0 0.0 124-125 3.1500000000000004 0.0 0.0 0.0 0.0 126-127 3.525 0.0 0.0 0.0 0.0 128-129 3.875 0.0 0.0 0.0 0.0 130-131 4.112500000000001 0.0 0.0 0.0 0.0 132-133 4.325 0.0 0.0 0.0 0.0 134-135 4.6875 0.0 0.0 0.0 0.0 136-137 5.050000000000001 0.0 0.0 0.0 0.0 138-139 5.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 603360 spots for SRR18694363.sra Written 603360 spots for SRR18694363.sra Read 603360 spots for SRR18694363.sra Written 603360 spots for SRR18694363.sra Read 603360 spots for SRR18694363.sra Written 603360 spots for SRR18694363.sra Read 603360 spots for SRR18694363.sra Written 603360 spots for SRR18694363.sra Read 603360 spots for SRR18694363.sra Written 603360 spots for SRR18694363.sra Read 603360 spots for SRR18694363.sra Written 603360 spots for SRR18694363.sra Read 603360 spots for SRR18694363.sra Written 603360 spots for SRR18694363.sra Read 603360 spots for SRR18694363.sra Written 603360 spots for SRR18694363.sra Read 603360 spots for SRR18694363.sra Written 603360 spots for SRR18694363.sra Read 603374 spots for SRR18694363.sra Written 603374 spots for SRR18694363.sra Read 603360 spots for SRR18694363.sra Written 603360 spots for SRR18694363.sra Read 603360 spots for SRR18694363.sra Written 603360 spots for SRR18694363.sra Read 603360 spots for SRR18694363.sra Written 603360 spots for SRR18694363.sra Read 603360 spots for SRR18694363.sra Written 603360 spots for SRR18694363.sra Read 603360 spots for SRR18694363.sra Written 603360 spots for SRR18694363.sra Read 603360 spots for SRR18694363.sra Written 603360 spots for SRR18694363.sra Read 603360 spots for SRR18694363.sra Written 603360 spots for SRR18694363.sra Read 603360 spots for SRR18694363.sra Written 603360 spots for SRR18694363.sra Read 603360 spots for SRR18694363.sra Written 603360 spots for SRR18694363.sra Read 603360 spots for SRR18694363.sra Written 603360 spots for SRR18694363.sra SRR ids: ['SRR18694363.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8zqhvsia SRR18694363.sra spots: 12067214 blocks: [[1, 603360], [603361, 1206720], [1206721, 1810080], [1810081, 2413440], [2413441, 3016800], [3016801, 3620160], [3620161, 4223520], [4223521, 4826880], [4826881, 5430240], [5430241, 6033600], [6033601, 6636960], [6636961, 7240320], [7240321, 7843680], [7843681, 8447040], [8447041, 9050400], [9050401, 9653760], [9653761, 10257120], [10257121, 10860480], [10860481, 11463840], [11463841, 12067214]] SRR18694363 file size 4079266 SRR18694363 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694363 SRR18694363_1.fastq SRR18694363_2.fastq Input file: SRR18694363_1.fastq Paired file: SRR18694363_2.fastq trimmed: SRR18694363-trimmed-pair1.fastq, SRR18694363-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 05:59:04 2024 >> started Tue Dec 10 05:59:19 2024 >> done (14.623s) 12067214 read pairs processed; of these: 84 ( 0.00%) short read pairs filtered out after trimming by size control 1696 ( 0.01%) empty read pairs filtered out after trimming by size control 12065434 (99.99%) read pairs available; of these: 1031662 ( 8.55%) trimmed read pairs available after processing 11033772 (91.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 16 0.00% 20 13 0.00% 21 8 0.00% 22 15 0.00% 23 14 0.00% 24 15 0.00% 25 21 0.00% 26 32 0.00% 27 14 0.00% 28 26 0.00% 29 20 0.00% 30 21 0.00% 31 33 0.00% 32 20 0.00% 33 19 0.00% 34 26 0.00% 35 35 0.00% 36 25 0.00% 37 30 0.00% 38 25 0.00% 39 38 0.00% 40 23 0.00% 41 37 0.00% 42 35 0.00% 43 38 0.00% 44 35 0.00% 45 40 0.00% 46 47 0.00% 47 56 0.00% 48 50 0.00% 49 63 0.00% 50 48 0.00% 51 55 0.00% 52 64 0.00% 53 84 0.00% 54 85 0.00% 55 84 0.00% 56 97 0.00% 57 89 0.00% 58 118 0.00% 59 136 0.00% 60 143 0.00% 61 163 0.00% 62 203 0.00% 63 165 0.00% 64 233 0.00% 65 261 0.00% 66 282 0.00% 67 327 0.00% 68 376 0.00% 69 392 0.00% 70 490 0.00% 71 548 0.00% 72 538 0.00% 73 621 0.01% 74 733 0.01% 75 813 0.01% 76 979 0.01% 77 979 0.01% 78 1165 0.01% 79 1262 0.01% 80 1360 0.01% 81 1452 0.01% 82 1620 0.01% 83 1755 0.01% 84 2093 0.02% 85 2192 0.02% 86 2578 0.02% 87 2707 0.02% 88 2885 0.02% 89 3139 0.03% 90 3309 0.03% 91 3457 0.03% 92 3950 0.03% 93 4140 0.03% 94 4499 0.04% 95 4590 0.04% 96 5137 0.04% 97 5301 0.04% 98 5649 0.05% 99 5980 0.05% 100 6201 0.05% 101 6524 0.05% 102 6966 0.06% 103 7253 0.06% 104 7627 0.06% 105 7990 0.07% 106 8553 0.07% 107 9005 0.07% 108 9049 0.07% 109 9480 0.08% 110 10168 0.08% 111 10396 0.09% 112 10854 0.09% 113 11304 0.09% 114 11775 0.10% 115 12499 0.10% 116 13130 0.11% 117 13449 0.11% 118 13580 0.11% 119 14485 0.12% 120 15079 0.12% 121 15324 0.13% 122 15851 0.13% 123 17120 0.14% 124 17536 0.15% 125 18113 0.15% 126 18357 0.15% 127 18801 0.16% 128 19441 0.16% 129 20137 0.17% 130 20592 0.17% 131 21849 0.18% 132 22060 0.18% 133 23276 0.19% 134 23195 0.19% 135 23628 0.20% 136 24678 0.20% 137 25240 0.21% 138 25513 0.21% 139 27176 0.23% 140 26969 0.22% 141 27760 0.23% 142 28675 0.24% 143 29390 0.24% 144 30373 0.25% 145 30574 0.25% 146 31056 0.26% 147 32668 0.27% 148 33030 0.27% 149 33496 0.28% 150 34188 0.28% 151 11033772 91.45% 12065434 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=22 prefix-density=0.37 prefix-fanout=2.2 sequence=GGGTACTCCTTCTTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=29 fanout-score=16.58 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=5.1 sequence=GCTTCCTTGACAGCAAGCTCAGATGGGCCGTTGGGGATGCTGACGACAGTGCGCCACTTGGCGAAGCGGGCGCCTTGCTGGTAGTAGGCTGCCTCACGGGAGGCAAGGCCATCAAGACCTTGGCACCATGACTCGTCGTTGGAACCAACGAGTGGCACAAGACCCTTGTCAACCTTGATGCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTTTTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAG criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=26 prefix-density=0.37 prefix-fanout=2.3 sequence=GTGCCAGCAGCCGCGGTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=96.56 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.0 sequence=GTGCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGAGATTTGGAAGATGTCTTGCAGCTGTGGATCAAGCTGCAACTGTGGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGCCAGCACCACCAGCAGCACCCAGGCCCAGGTGGTGGTTCTCGGCATGGCGCCGGAGAAG SRR18694363 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:00:08 Started mapping on | Dec 10 06:00:09 Finished on | Dec 10 06:01:51 Mapping speed, Million of reads per hour | 425.84 Number of input reads | 12065434 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 10966065 Uniquely mapped reads % | 90.89% Average mapped length | 296.80 Number of splices: Total | 11171823 Number of splices: Annotated (sjdb) | 10434929 Number of splices: GT/AG | 11019754 Number of splices: GC/AG | 127560 Number of splices: AT/AC | 5121 Number of splices: Non-canonical | 19388 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.01% Deletion average length | 2.40 Insertion rate per base | 0.01% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 365995 % of reads mapped to multiple loci | 3.03% Number of reads mapped to too many loci | 46952 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.18% % of reads unmapped: other | 3.51% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 733374 733374 733374 N_multimapping 365995 365995 365995 N_noFeature 820337 10644112 947612 N_ambiguous 240965 1682 46496 UnstrandedReadsAssigned:9904763 PositiveStrandReadsAssigned:320271 NegativeStrandReadsAssigned:9971957 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694363 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694363-trimmed-pair1.fastq SRR18694363-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,065,434 reads, 10,168,122 reads pseudoaligned [quant] estimated average fragment length: 268.185 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52973 SRR18694363.ke.tsv 35125 SRR18694363.se.tsv 88098 total ==> SRR18694363.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 669.352 0 0 PNS24247 1044 776.815 51.4299 9.56812 PNS24249 1928 1660.82 50.3672 4.38283 PNS24246 1044 776.815 51.4299 9.56812 PNS24248 1044 776.815 51.4299 9.56812 PNS24244 1471 1203.82 71.3431 8.56487 PNS24243 293 90.3173 0 0 KQK14069 1603 1335.82 507.995 54.9593 KQK14071 474 230.391 1.5436 0.968274 ==> SRR18694363.se.tsv <== BRADI_1g14170v3 547 BRADI_1g53295v3 994 BRADI_1g59795v3 427 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 258 BRADI_1g74790v3 150 BRADI_1g09890v3 0 BRADI_1g77505v3 121 BRADI_1g48960v3 0 SRR18694363 completed mapping pipeline successfully