Starting /dee2/code/volunteer_pipeline.sh SRR18694366 current disk space = 1525739974656 free memory = 1557821504 SRR18694366 SRAfilesize 1c913565f2663c8b0df2dc5ed24d0313 SRR18694366.sra SRR18694366.sra file validated SRR18694366 is paired end SRR18694366 is conventional basespace SRR18694366 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694366_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.184 37.0 37.0 37.0 37.0 37.0 2 35.9185 37.0 37.0 37.0 37.0 37.0 3 36.461 37.0 37.0 37.0 37.0 37.0 4 36.557 37.0 37.0 37.0 37.0 37.0 5 36.5675 37.0 37.0 37.0 37.0 37.0 6 36.5415 37.0 37.0 37.0 37.0 37.0 7 36.5625 37.0 37.0 37.0 37.0 37.0 8 36.6235 37.0 37.0 37.0 37.0 37.0 9 36.685 37.0 37.0 37.0 37.0 37.0 10-14 36.6184 37.0 37.0 37.0 37.0 37.0 15-19 36.6294 37.0 37.0 37.0 37.0 37.0 20-24 36.633500000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.5797 37.0 37.0 37.0 37.0 37.0 30-34 36.5769 37.0 37.0 37.0 37.0 37.0 35-39 36.629400000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.597500000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.43000000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.5274 37.0 37.0 37.0 37.0 37.0 55-59 36.52869999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.507600000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.2863 37.0 37.0 37.0 37.0 37.0 70-74 36.378699999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.465999999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.399699999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.2011 37.0 37.0 37.0 37.0 37.0 90-94 35.429700000000004 37.0 37.0 37.0 29.8 37.0 95-99 36.129200000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.1206 37.0 37.0 37.0 37.0 37.0 105-109 36.1656 37.0 37.0 37.0 37.0 37.0 110-114 36.2237 37.0 37.0 37.0 37.0 37.0 115-119 36.4769 37.0 37.0 37.0 37.0 37.0 120-124 36.5397 37.0 37.0 37.0 37.0 37.0 125-129 36.54 37.0 37.0 37.0 37.0 37.0 130-134 36.4818 37.0 37.0 37.0 37.0 37.0 135-139 36.4155 37.0 37.0 37.0 37.0 37.0 140-144 36.253699999999995 37.0 37.0 37.0 37.0 37.0 145-149 36.2183 37.0 37.0 37.0 37.0 37.0 150-151 33.595 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 2.0 26 1.0 27 2.0 28 2.0 29 12.0 30 10.0 31 13.0 32 28.0 33 46.0 34 97.0 35 331.0 36 3294.0 37 160.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.6 10.0 4.8 34.599999999999994 2 20.321123933768188 9.784244856999498 39.08680381334671 30.8078273958856 3 19.925 15.4 25.75 38.925 4 23.674999999999997 20.974999999999998 24.85 30.5 5 23.65 27.750000000000004 24.925 23.674999999999997 6 22.5 31.075000000000003 25.224999999999998 21.2 7 16.825000000000003 25.174999999999997 39.125 18.875 8 17.75 24.525 32.824999999999996 24.9 9 18.425 21.425 35.4 24.75 10-14 20.765 27.625 27.200000000000003 24.41 15-19 22.105 25.665 27.02 25.21 20-24 21.36 27.41 26.83 24.4 25-29 20.669999999999998 26.495 27.11 25.724999999999998 30-34 22.134999999999998 26.045 27.18 24.64 35-39 21.615000000000002 26.334999999999997 27.08 24.97 40-44 21.545 26.395000000000003 27.485 24.575 45-49 22.14 26.075 26.735 25.05 50-54 21.325 26.07 27.72 24.884999999999998 55-59 21.275 27.139999999999997 27.334999999999997 24.25 60-64 21.385 26.145000000000003 27.279999999999998 25.19 65-69 21.935 26.205000000000002 27.33 24.529999999999998 70-74 21.58 26.215 26.6 25.605 75-79 21.455 26.924999999999997 26.924999999999997 24.695 80-84 21.175 26.82 27.089999999999996 24.915000000000003 85-89 21.89 26.76 26.415 24.935 90-94 21.36 25.985000000000003 27.384999999999998 25.27 95-99 21.38 26.455000000000002 26.71 25.455 100-104 22.335 25.974999999999998 26.6 25.09 105-109 21.9 26.22 27.045 24.834999999999997 110-114 21.91 27.055 26.669999999999998 24.365000000000002 115-119 21.64 27.175 26.334999999999997 24.85 120-124 21.22 27.089999999999996 26.655 25.035 125-129 21.8 26.705000000000002 26.005 25.490000000000002 130-134 21.745 26.625 26.155 25.474999999999998 135-139 22.470000000000002 26.615 26.0 24.915000000000003 140-144 21.46 26.979999999999997 26.07 25.490000000000002 145-149 21.9 26.685 26.025 25.39 150-151 22.825 25.1875 26.525 25.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 2.0 27 4.0 28 8.0 29 9.5 30 15.0 31 24.5 32 21.0 33 23.0 34 45.5 35 63.5 36 70.5 37 91.5 38 112.5 39 127.5 40 145.0 41 155.0 42 164.0 43 184.5 44 206.0 45 212.5 46 232.5 47 231.0 48 189.0 49 180.0 50 195.5 51 183.0 52 149.0 53 127.0 54 112.5 55 97.0 56 89.0 57 82.5 58 75.0 59 66.5 60 55.5 61 41.5 62 35.0 63 32.5 64 25.0 65 27.0 66 22.0 67 15.0 68 18.0 69 12.5 70 4.5 71 3.5 72 5.0 73 3.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.82499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 86.95018933877076 74.625 2 10.544713078939703 18.099999999999998 3 1.951645790853481 5.025 4 0.4369356248179435 1.5 5 0.029129041654529564 0.125 6 0.029129041654529564 0.15 7 0.029129041654529564 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.029129041654529564 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 12 0.3 No Hit CTCTCCATTTGCTGATATTGTACCCACCTGCGCTATTTCCTCTGGTGTGC 7 0.17500000000000002 No Hit GTGGATCGACTTTGCTGGGCAGGATAAGGTGAAGCATGTAGCTGTCATTT 6 0.15 No Hit GTCGCCGGCACGAGGGCCGTGCGATCCGTCGAGTTATCATGAATCATCGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 0.9625 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.4875 0.0 0.0 0.0 0.0 112-113 1.7375 0.0 0.0 0.0 0.0 114-115 1.8125 0.0 0.0 0.0 0.0 116-117 1.95 0.0 0.0 0.0 0.0 118-119 2.125 0.0 0.0 0.0 0.0 120-121 2.375 0.0 0.0 0.0 0.0 122-123 2.65 0.0 0.0 0.0 0.0 124-125 2.8499999999999996 0.0 0.0 0.0 0.0 126-127 3.0625 0.0 0.0 0.0 0.0 128-129 3.4625 0.0 0.0 0.0 0.0 130-131 3.8625 0.0 0.0 0.0 0.0 132-133 4.4 0.0 0.0 0.0 0.0 134-135 4.8 0.0 0.0 0.0 0.0 136-137 5.1375 0.0 0.0 0.0 0.0 138-139 5.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGCG 10 0.006830828 145.0 145 CCCTGCA 10 0.006830828 145.0 1 >>END_MODULE SRR18694366 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694366_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.178 37.0 37.0 37.0 25.0 37.0 2 35.266 37.0 37.0 37.0 25.0 37.0 3 35.154 37.0 37.0 37.0 25.0 37.0 4 35.2725 37.0 37.0 37.0 25.0 37.0 5 35.307 37.0 37.0 37.0 25.0 37.0 6 35.2275 37.0 37.0 37.0 25.0 37.0 7 35.303 37.0 37.0 37.0 25.0 37.0 8 35.42 37.0 37.0 37.0 37.0 37.0 9 35.4835 37.0 37.0 37.0 37.0 37.0 10-14 35.554199999999994 37.0 37.0 37.0 37.0 37.0 15-19 35.6351 37.0 37.0 37.0 37.0 37.0 20-24 35.403 37.0 37.0 37.0 34.6 37.0 25-29 35.545100000000005 37.0 37.0 37.0 32.2 37.0 30-34 35.7795 37.0 37.0 37.0 37.0 37.0 35-39 35.644600000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.3938 37.0 37.0 37.0 29.8 37.0 45-49 35.5467 37.0 37.0 37.0 37.0 37.0 50-54 34.971199999999996 37.0 37.0 37.0 29.8 37.0 55-59 34.323800000000006 37.0 37.0 37.0 25.0 37.0 60-64 35.1352 37.0 37.0 37.0 29.8 37.0 65-69 34.333 37.0 34.6 37.0 27.4 37.0 70-74 33.1656 37.0 29.8 37.0 25.0 37.0 75-79 33.5015 37.0 34.6 37.0 22.2 37.0 80-84 34.5843 37.0 37.0 37.0 25.0 37.0 85-89 32.633500000000005 37.0 32.2 37.0 19.4 37.0 90-94 34.1016 37.0 37.0 37.0 25.0 37.0 95-99 33.8381 37.0 37.0 37.0 25.0 37.0 100-104 33.3757 37.0 34.6 37.0 25.0 37.0 105-109 34.181400000000004 37.0 37.0 37.0 25.0 37.0 110-114 34.526799999999994 37.0 37.0 37.0 25.0 37.0 115-119 34.4186 37.0 37.0 37.0 25.0 37.0 120-124 33.9959 37.0 37.0 37.0 25.0 37.0 125-129 33.9933 37.0 37.0 37.0 25.0 37.0 130-134 33.7202 37.0 34.6 37.0 25.0 37.0 135-139 32.1241 37.0 25.0 37.0 13.8 37.0 140-144 31.6255 37.0 25.0 37.0 11.0 37.0 145-149 31.325599999999998 37.0 25.0 37.0 13.8 37.0 150-151 30.703500000000002 37.0 25.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 1.0 17 3.0 18 1.0 19 2.0 20 2.0 21 2.0 22 6.0 23 4.0 24 2.0 25 9.0 26 11.0 27 12.0 28 31.0 29 39.0 30 76.0 31 143.0 32 268.0 33 545.0 34 1245.0 35 1416.0 36 180.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.225 21.675 6.575 24.525 2 28.95 23.3 30.0 17.75 3 22.8 24.275 31.574999999999996 21.349999999999998 4 26.424999999999997 31.75 21.5 20.325 5 27.200000000000003 34.375 20.5 17.925 6 21.425 36.95 21.55 20.075000000000003 7 21.9 21.3 36.199999999999996 20.599999999999998 8 23.200000000000003 22.325 27.725 26.75 9 23.35 22.15 28.225 26.275 10-14 25.580000000000002 27.400000000000002 24.69 22.33 15-19 25.314999999999998 26.745 25.385 22.555 20-24 25.94 26.705000000000002 25.369999999999997 21.985 25-29 25.319999999999997 26.105 26.0 22.575 30-34 25.619999999999997 26.51 25.495 22.375 35-39 24.865000000000002 27.51 25.515 22.11 40-44 25.130000000000003 26.825 25.82 22.225 45-49 24.725 26.865 26.384999999999998 22.025 50-54 23.43 27.73 26.735 22.105 55-59 24.51 26.755000000000003 26.450000000000003 22.285 60-64 25.28 26.08 26.735 21.905 65-69 25.15 26.545 26.205000000000002 22.1 70-74 24.985 26.655 26.14 22.220000000000002 75-79 26.529999999999998 25.45 26.215 21.805 80-84 25.069999999999997 26.955000000000002 26.284999999999997 21.69 85-89 22.39 28.849999999999998 25.929999999999996 22.830000000000002 90-94 24.69 26.865 26.44 22.005 95-99 24.9 27.529999999999998 25.855 21.715 100-104 25.28 27.084999999999997 25.825 21.81 105-109 25.46 26.555 26.765 21.22 110-114 25.005 27.22 26.150000000000002 21.625 115-119 25.435000000000002 27.860000000000003 25.215 21.490000000000002 120-124 25.2 27.089999999999996 26.375 21.335 125-129 25.545 27.36 26.035000000000004 21.060000000000002 130-134 25.69 26.99 26.125 21.195 135-139 25.595000000000002 27.284999999999997 26.174999999999997 20.945 140-144 25.965 27.355 25.25 21.43 145-149 25.765 27.694999999999997 25.505 21.035 150-151 24.4375 26.8625 28.3125 20.3875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 1.5 24 1.5 25 1.0 26 2.0 27 2.5 28 4.0 29 10.0 30 16.5 31 21.5 32 24.5 33 31.5 34 40.0 35 51.0 36 69.5 37 83.0 38 103.0 39 136.0 40 152.5 41 162.0 42 178.5 43 200.5 44 223.0 45 220.0 46 200.5 47 191.5 48 190.5 49 175.5 50 156.0 51 148.0 52 152.5 53 135.0 54 113.0 55 98.5 56 82.0 57 73.0 58 62.5 59 62.5 60 57.5 61 58.0 62 54.5 63 44.0 64 43.5 65 34.5 66 25.0 67 27.0 68 26.5 69 17.0 70 7.5 71 4.5 72 5.0 73 4.5 74 2.5 75 0.5 76 0.5 77 3.0 78 3.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.575 #Duplication Level Percentage of deduplicated Percentage of total 1 88.69540393948044 77.67500000000001 2 9.363402797602054 16.400000000000002 3 1.4558949471881244 3.8249999999999997 4 0.3140165572366543 1.0999999999999999 5 0.028546959748786755 0.125 6 0.05709391949757351 0.3 7 0.028546959748786755 0.17500000000000002 8 0.05709391949757351 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 8 0.2 No Hit AGGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGC 8 0.2 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 7 0.17500000000000002 No Hit GAGCATTGAATTCAAGGATAGAGTCAAGAATGTCGGTGCAAGCCTTGTGA 6 0.15 No Hit GGCAAGTCGAAGGTTCTAGTGAAGGTGCACCCAGAAGGCAAATATGTTGT 6 0.15 No Hit ACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTTGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 1.8624999999999998 0.0 0.0 0.0 0.0 116-117 2.0 0.0 0.0 0.0 0.0 118-119 2.175 0.0 0.0 0.0 0.0 120-121 2.425 0.0 0.0 0.0 0.0 122-123 2.7 0.0 0.0 0.0 0.0 124-125 2.8875 0.0 0.0 0.0 0.0 126-127 3.0625 0.0 0.0 0.0 0.0 128-129 3.4625 0.0 0.0 0.0 0.0 130-131 3.875 0.0 0.0 0.0 0.0 132-133 4.425 0.0 0.0 0.0 0.0 134-135 4.825 0.0 0.0 0.0 0.0 136-137 5.1625 0.0 0.0 0.0 0.0 138-139 5.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTCTTG 10 0.006830828 145.0 6 >>END_MODULE Read 743572 spots for SRR18694366.sra Written 743572 spots for SRR18694366.sra Read 743572 spots for SRR18694366.sra Written 743572 spots for SRR18694366.sra Read 743572 spots for SRR18694366.sra Written 743572 spots for SRR18694366.sra Read 743572 spots for SRR18694366.sra Written 743572 spots for SRR18694366.sra Read 743572 spots for SRR18694366.sra Written 743572 spots for SRR18694366.sra Read 743572 spots for SRR18694366.sra Written 743572 spots for SRR18694366.sra Read 743572 spots for SRR18694366.sra Written 743572 spots for SRR18694366.sra Read 743572 spots for SRR18694366.sra Written 743572 spots for SRR18694366.sra Read 743572 spots for SRR18694366.sra Written 743572 spots for SRR18694366.sra Read 743572 spots for SRR18694366.sra Written 743572 spots for SRR18694366.sra Read 743572 spots for SRR18694366.sra Written 743572 spots for SRR18694366.sra Read 743572 spots for SRR18694366.sra Written 743572 spots for SRR18694366.sra Read 743574 spots for SRR18694366.sra Written 743574 spots for SRR18694366.sra Read 743572 spots for SRR18694366.sra Written 743572 spots for SRR18694366.sra Read 743572 spots for SRR18694366.sra Written 743572 spots for SRR18694366.sra Read 743572 spots for SRR18694366.sra Written 743572 spots for SRR18694366.sra Read 743572 spots for SRR18694366.sra Written 743572 spots for SRR18694366.sra Read 743572 spots for SRR18694366.sra Written 743572 spots for SRR18694366.sra Read 743572 spots for SRR18694366.sra Written 743572 spots for SRR18694366.sra Read 743572 spots for SRR18694366.sra Written 743572 spots for SRR18694366.sra SRR ids: ['SRR18694366.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_beba629g SRR18694366.sra spots: 14871442 blocks: [[1, 743572], [743573, 1487144], [1487145, 2230716], [2230717, 2974288], [2974289, 3717860], [3717861, 4461432], [4461433, 5205004], [5205005, 5948576], [5948577, 6692148], [6692149, 7435720], [7435721, 8179292], [8179293, 8922864], [8922865, 9666436], [9666437, 10410008], [10410009, 11153580], [11153581, 11897152], [11897153, 12640724], [12640725, 13384296], [13384297, 14127868], [14127869, 14871442]] SRR18694366 file size 5032266 SRR18694366 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694366 SRR18694366_1.fastq SRR18694366_2.fastq Input file: SRR18694366_1.fastq Paired file: SRR18694366_2.fastq trimmed: SRR18694366-trimmed-pair1.fastq, SRR18694366-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:02:10 2024 >> started Tue Dec 10 06:02:26 2024 >> done (16.125s) 14871442 read pairs processed; of these: 134 ( 0.00%) short read pairs filtered out after trimming by size control 4452 ( 0.03%) empty read pairs filtered out after trimming by size control 14866856 (99.97%) read pairs available; of these: 1364498 ( 9.18%) trimmed read pairs available after processing 13502358 (90.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 12 0.00% 20 13 0.00% 21 16 0.00% 22 13 0.00% 23 22 0.00% 24 24 0.00% 25 24 0.00% 26 26 0.00% 27 16 0.00% 28 28 0.00% 29 24 0.00% 30 28 0.00% 31 27 0.00% 32 25 0.00% 33 40 0.00% 34 40 0.00% 35 33 0.00% 36 25 0.00% 37 35 0.00% 38 47 0.00% 39 41 0.00% 40 46 0.00% 41 43 0.00% 42 65 0.00% 43 51 0.00% 44 41 0.00% 45 58 0.00% 46 48 0.00% 47 54 0.00% 48 69 0.00% 49 73 0.00% 50 90 0.00% 51 78 0.00% 52 121 0.00% 53 132 0.00% 54 99 0.00% 55 106 0.00% 56 137 0.00% 57 182 0.00% 58 183 0.00% 59 200 0.00% 60 219 0.00% 61 278 0.00% 62 326 0.00% 63 340 0.00% 64 351 0.00% 65 372 0.00% 66 423 0.00% 67 477 0.00% 68 553 0.00% 69 608 0.00% 70 703 0.00% 71 816 0.01% 72 910 0.01% 73 1086 0.01% 74 1115 0.01% 75 1302 0.01% 76 1363 0.01% 77 1525 0.01% 78 1633 0.01% 79 1845 0.01% 80 2155 0.01% 81 2334 0.02% 82 2544 0.02% 83 2802 0.02% 84 3136 0.02% 85 3409 0.02% 86 3766 0.03% 87 4163 0.03% 88 4214 0.03% 89 4611 0.03% 90 4771 0.03% 91 5214 0.04% 92 5506 0.04% 93 6011 0.04% 94 6453 0.04% 95 6746 0.05% 96 7263 0.05% 97 7374 0.05% 98 7878 0.05% 99 8220 0.06% 100 9070 0.06% 101 8946 0.06% 102 9260 0.06% 103 10064 0.07% 104 10526 0.07% 105 10772 0.07% 106 11002 0.07% 107 11688 0.08% 108 12108 0.08% 109 12668 0.09% 110 13364 0.09% 111 13885 0.09% 112 14947 0.10% 113 15030 0.10% 114 16161 0.11% 115 16597 0.11% 116 17187 0.12% 117 17956 0.12% 118 17965 0.12% 119 19091 0.13% 120 20422 0.14% 121 20243 0.14% 122 21101 0.14% 123 22905 0.15% 124 23121 0.16% 125 24148 0.16% 126 24372 0.16% 127 25021 0.17% 128 24720 0.17% 129 26733 0.18% 130 26987 0.18% 131 27682 0.19% 132 29190 0.20% 133 29620 0.20% 134 30236 0.20% 135 31327 0.21% 136 32399 0.22% 137 32924 0.22% 138 33667 0.23% 139 34462 0.23% 140 34954 0.24% 141 36239 0.24% 142 37138 0.25% 143 38463 0.26% 144 39422 0.27% 145 39877 0.27% 146 40981 0.28% 147 42253 0.28% 148 41901 0.28% 149 43375 0.29% 150 43072 0.29% 151 13502358 90.82% 14866856 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=34 prefix-density=0.19 prefix-fanout=2.0 sequence=GCCACTCACGTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=36 fanout-score=149.83 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=17.0 sequence=CTTCTTCACTCCGGGAAGGTCCGCCTTGAACACGTGAGCTTCGGGAGTCTCCTTCCAGTCCATGCGGGCGTTGACGAAGGCCGCAGTGTCGAAGTCGGAGGAGGCCGCGGCTGCCGGGACGATGGAGCGGAAGATGCTGTCGATCGGGTCCCAGAGGTCCTGGGAGAATGGGTCGAACACGCTGCCGCGCCTCACCAGCGACATTGTTGTTTGTTGGTTTCGGGTTTGATGGAGATCTGTGGTGAAATGTGATTGATTTCAAGTGTGTGTTTGTGAAGGGATGATATGCTCTGCTTTTGCTCT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=36 prefix-density=0.74 prefix-fanout=1.0 sequence=CAAGTGTAAGGTGTGTATGCTCTCTCTTGTACTAATATTCCTAAAGCAATATAGTACTACTTTGTTCATATAAGTCTCCCGGTTAGGCCTTGTTATTTCTAAGTACTTAGTGCATATAAGTTGTGATTTAACGTGAGCGGATTCGCCCGGAATCACAACGGTCTTGTTTCAACGTGAGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=36.55 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.6 sequence=ACCAAGGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGGAAGCTGACGAGCGGGAGGCCCTCACGGGCCGCACCGCTGGCCGACCCTGATCTTCTGTGAAGGGTTCGAGTTGGAGCACGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGAAGCGATACTGACGTGCAAATCGTTCGTCTGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGAGCCCATTACGAGTTCTATCAGGTAAAGCCAATGATTAGAGGCATCGGGGGCGCAACGCCCTCGACCTATTCTCAAACTTTAAATAGGTAGGACGGCGCGGCTGCTCCGGTGAGCCGCGCCATGGAATCGGGAGCTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGGAAGCCG SRR18694366 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:03:34 Started mapping on | Dec 10 06:03:34 Finished on | Dec 10 06:08:23 Mapping speed, Million of reads per hour | 185.19 Number of input reads | 14866856 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11635635 Uniquely mapped reads % | 78.27% Average mapped length | 295.92 Number of splices: Total | 10612746 Number of splices: Annotated (sjdb) | 9734553 Number of splices: GT/AG | 10472662 Number of splices: GC/AG | 113580 Number of splices: AT/AC | 1122 Number of splices: Non-canonical | 25382 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.02% Deletion average length | 2.22 Insertion rate per base | 0.01% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 195051 % of reads mapped to multiple loci | 1.31% Number of reads mapped to too many loci | 138416 % of reads mapped to too many loci | 0.93% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.90% % of reads unmapped: other | 9.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3036170 3036170 3036170 N_multimapping 195051 195051 195051 N_noFeature 1227824 11259852 1422794 N_ambiguous 220293 1846 39795 UnstrandedReadsAssigned:10187518 PositiveStrandReadsAssigned:373937 NegativeStrandReadsAssigned:10173046 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694366 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694366-trimmed-pair1.fastq SRR18694366-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,866,856 reads, 10,363,271 reads pseudoaligned [quant] estimated average fragment length: 266.414 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52973 SRR18694366.ke.tsv 35125 SRR18694366.se.tsv 88098 total ==> SRR18694366.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 671.067 27.9475 6.90298 PNS24247 1044 778.586 58.2323 12.397 PNS24249 1928 1662.59 53.0611 5.28995 PNS24246 1044 778.586 58.2323 12.397 PNS24248 1044 778.586 58.2323 12.397 PNS24244 1471 1205.59 113.294 15.5765 PNS24243 293 91.809 2 3.61081 KQK14069 1603 1337.59 88.7079 10.9926 KQK14071 474 232.955 0 0 ==> SRR18694366.se.tsv <== BRADI_1g14170v3 119 BRADI_1g53295v3 1113 BRADI_1g59795v3 412 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 40 BRADI_1g74790v3 625 BRADI_1g09890v3 0 BRADI_1g77505v3 41 BRADI_1g48960v3 0 SRR18694366 completed mapping pipeline successfully