Starting /dee2/code/volunteer_pipeline.sh SRR18694368 current disk space = 1525738094592 free memory = 1557592964 SRR18694368 SRAfilesize f12c3cccc4cb2a8eb930a7194dd082fc SRR18694368.sra SRR18694368.sra file validated SRR18694368 is paired end SRR18694368 is conventional basespace SRR18694368 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694368_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0995 37.0 37.0 37.0 37.0 37.0 2 36.14675 37.0 37.0 37.0 37.0 37.0 3 36.5635 37.0 37.0 37.0 37.0 37.0 4 36.648 37.0 37.0 37.0 37.0 37.0 5 36.58 37.0 37.0 37.0 37.0 37.0 6 36.5185 37.0 37.0 37.0 37.0 37.0 7 36.5815 37.0 37.0 37.0 37.0 37.0 8 36.6175 37.0 37.0 37.0 37.0 37.0 9 36.617 37.0 37.0 37.0 37.0 37.0 10-14 36.652699999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.6455 37.0 37.0 37.0 37.0 37.0 20-24 36.656400000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.5784 37.0 37.0 37.0 37.0 37.0 30-34 36.5788 37.0 37.0 37.0 37.0 37.0 35-39 36.6769 37.0 37.0 37.0 37.0 37.0 40-44 36.6306 37.0 37.0 37.0 37.0 37.0 45-49 36.431900000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.5255 37.0 37.0 37.0 37.0 37.0 55-59 36.5325 37.0 37.0 37.0 37.0 37.0 60-64 36.5509 37.0 37.0 37.0 37.0 37.0 65-69 36.3376 37.0 37.0 37.0 37.0 37.0 70-74 36.414199999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.5293 37.0 37.0 37.0 37.0 37.0 80-84 36.3905 37.0 37.0 37.0 37.0 37.0 85-89 36.211 37.0 37.0 37.0 37.0 37.0 90-94 35.44359999999999 37.0 37.0 37.0 29.8 37.0 95-99 36.17620000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.1432 37.0 37.0 37.0 37.0 37.0 105-109 36.171800000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.2154 37.0 37.0 37.0 37.0 37.0 115-119 36.532 37.0 37.0 37.0 37.0 37.0 120-124 36.5702 37.0 37.0 37.0 37.0 37.0 125-129 36.56269999999999 37.0 37.0 37.0 37.0 37.0 130-134 36.5252 37.0 37.0 37.0 37.0 37.0 135-139 36.4491 37.0 37.0 37.0 37.0 37.0 140-144 36.218500000000006 37.0 37.0 37.0 37.0 37.0 145-149 36.2096 37.0 37.0 37.0 37.0 37.0 150-151 33.64775 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 0.0 27 1.0 28 2.0 29 4.0 30 11.0 31 16.0 32 26.0 33 53.0 34 110.0 35 317.0 36 3249.0 37 209.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.0 9.2 5.6000000000000005 45.2 2 20.767494356659142 10.00752445447705 37.89816904941058 31.326812139453224 3 20.175 13.65 23.625 42.55 4 24.075 20.375 20.95 34.599999999999994 5 28.549999999999997 23.925 23.974999999999998 23.549999999999997 6 24.825 28.975 23.25 22.95 7 17.65 25.0 38.025 19.325 8 18.325 22.025 32.75 26.900000000000002 9 19.8 21.8 32.65 25.75 10-14 22.475 25.985000000000003 26.57 24.97 15-19 22.68 24.555 26.865 25.900000000000002 20-24 22.79 24.995 26.305 25.91 25-29 22.595000000000002 25.119999999999997 26.290000000000003 25.995 30-34 23.185 24.415 25.355 27.045 35-39 22.115000000000002 25.285000000000004 26.375 26.224999999999998 40-44 23.16 24.43 25.965 26.445 45-49 23.145 24.79 25.555 26.51 50-54 22.705000000000002 25.405 25.740000000000002 26.150000000000002 55-59 23.494999999999997 24.62 25.474999999999998 26.41 60-64 23.064999999999998 24.395 26.69 25.85 65-69 22.759999999999998 24.884999999999998 26.005 26.35 70-74 23.185 25.71 25.385 25.72 75-79 23.855 25.064999999999998 25.419999999999998 25.66 80-84 22.965 24.79 25.785000000000004 26.46 85-89 24.125 25.0 25.424999999999997 25.45 90-94 23.580000000000002 25.840000000000003 25.069999999999997 25.509999999999998 95-99 23.52 24.654999999999998 25.580000000000002 26.245 100-104 23.865 24.82 25.285000000000004 26.029999999999998 105-109 23.79 25.290000000000003 24.86 26.06 110-114 23.875 24.92 25.624999999999996 25.580000000000002 115-119 23.585 25.5 24.825 26.090000000000003 120-124 23.895 25.435000000000002 25.215 25.455 125-129 23.79 25.324999999999996 25.180000000000003 25.705 130-134 24.05 25.455 24.525 25.97 135-139 24.175 25.979999999999997 23.985 25.86 140-144 23.794999999999998 25.275 24.73 26.200000000000003 145-149 23.995 25.46 24.515 26.029999999999998 150-151 24.337500000000002 24.875 25.924999999999997 24.8625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 0.5 27 0.5 28 2.5 29 6.0 30 6.5 31 11.5 32 18.0 33 20.0 34 29.0 35 36.5 36 41.0 37 70.0 38 97.0 39 99.0 40 109.5 41 126.5 42 136.5 43 158.0 44 171.5 45 174.0 46 184.0 47 205.5 48 214.5 49 187.5 50 184.5 51 172.5 52 140.5 53 133.0 54 128.0 55 119.5 56 110.5 57 95.0 58 73.5 59 65.5 60 68.5 61 62.5 62 60.5 63 64.0 64 62.0 65 55.0 66 46.0 67 53.5 68 48.0 69 28.0 70 29.5 71 29.0 72 17.5 73 10.5 74 7.5 75 8.5 76 9.0 77 4.5 78 1.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.875 #Duplication Level Percentage of deduplicated Percentage of total 1 84.9478390461997 71.25 2 11.8628912071535 19.900000000000002 3 2.533532041728763 6.375 4 0.47690014903129657 1.6 5 0.14903129657228018 0.625 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.029806259314456036 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCAGTATCGCTTCGAGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGC 10 0.25 No Hit GGGGTTTCTCTGCGGGGAACCTTGGGGAAGAACTCGCATAGGCGAATCCA 5 0.125 No Hit CTTCCGTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCGGA 5 0.125 No Hit CGGGCGGTGTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACT 5 0.125 No Hit CCCCCATCCGCTTCCCTCCCGGCAATTTCAAGCACTCTTTGACTCTCTTT 5 0.125 No Hit GCTACCTTAAGAGAGTCATAGTTACTCCCGCCGTTTACCCGCGCTTGGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.8250000000000002 0.0 0.0 0.0 0.0 110-111 2.1500000000000004 0.0 0.0 0.0 0.0 112-113 2.2750000000000004 0.0 0.0 0.0 0.0 114-115 2.4625 0.0 0.0 0.0 0.0 116-117 2.925 0.025 0.0 0.0 0.0 118-119 3.1125 0.025 0.0 0.0 0.0 120-121 3.375 0.025 0.0 0.0 0.0 122-123 3.8125 0.025 0.0 0.0 0.0 124-125 4.225 0.025 0.0 0.0 0.0 126-127 4.7125 0.025 0.0 0.0 0.0 128-129 5.137499999999999 0.025 0.0 0.0 0.0 130-131 5.637499999999999 0.025 0.0 0.0 0.0 132-133 6.25 0.025 0.0 0.0 0.0 134-135 7.075 0.025 0.0 0.0 0.0 136-137 7.5625 0.025 0.0 0.0 0.0 138-139 8.1 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 20 0.00593511 29.0 45-49 >>END_MODULE SRR18694368 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694368_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.3455 37.0 37.0 37.0 25.0 37.0 2 35.266 37.0 37.0 37.0 25.0 37.0 3 35.2895 37.0 37.0 37.0 25.0 37.0 4 35.3775 37.0 37.0 37.0 37.0 37.0 5 35.4375 37.0 37.0 37.0 37.0 37.0 6 35.391 37.0 37.0 37.0 37.0 37.0 7 35.4095 37.0 37.0 37.0 37.0 37.0 8 35.581 37.0 37.0 37.0 37.0 37.0 9 35.5345 37.0 37.0 37.0 37.0 37.0 10-14 35.621500000000005 37.0 37.0 37.0 37.0 37.0 15-19 35.6699 37.0 37.0 37.0 37.0 37.0 20-24 35.4802 37.0 37.0 37.0 34.6 37.0 25-29 35.5912 37.0 37.0 37.0 34.6 37.0 30-34 35.8558 37.0 37.0 37.0 37.0 37.0 35-39 35.627399999999994 37.0 37.0 37.0 37.0 37.0 40-44 35.3857 37.0 37.0 37.0 29.8 37.0 45-49 35.5564 37.0 37.0 37.0 37.0 37.0 50-54 34.958600000000004 37.0 37.0 37.0 29.8 37.0 55-59 34.3655 37.0 37.0 37.0 25.0 37.0 60-64 35.1451 37.0 37.0 37.0 27.4 37.0 65-69 34.2681 37.0 34.6 37.0 27.4 37.0 70-74 33.0263 37.0 29.8 37.0 22.2 37.0 75-79 33.540800000000004 37.0 34.6 37.0 22.2 37.0 80-84 34.5381 37.0 37.0 37.0 25.0 37.0 85-89 32.634899999999995 37.0 32.2 37.0 19.4 37.0 90-94 34.1274 37.0 37.0 37.0 25.0 37.0 95-99 33.9276 37.0 37.0 37.0 25.0 37.0 100-104 33.410399999999996 37.0 37.0 37.0 25.0 37.0 105-109 34.2796 37.0 37.0 37.0 25.0 37.0 110-114 34.5635 37.0 37.0 37.0 25.0 37.0 115-119 34.5875 37.0 37.0 37.0 25.0 37.0 120-124 34.2658 37.0 37.0 37.0 25.0 37.0 125-129 34.0348 37.0 37.0 37.0 25.0 37.0 130-134 33.819599999999994 37.0 37.0 37.0 25.0 37.0 135-139 32.3819 37.0 29.8 37.0 13.8 37.0 140-144 31.8661 37.0 25.0 37.0 11.0 37.0 145-149 31.413099999999996 37.0 25.0 37.0 13.8 37.0 150-151 31.028750000000002 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 1.0 17 2.0 18 2.0 19 5.0 20 1.0 21 1.0 22 3.0 23 5.0 24 6.0 25 2.0 26 5.0 27 19.0 28 18.0 29 55.0 30 78.0 31 122.0 32 262.0 33 532.0 34 1187.0 35 1477.0 36 215.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.725 21.475 9.475 32.324999999999996 2 29.049999999999997 24.474999999999998 27.975 18.5 3 23.150000000000002 26.575 28.175 22.1 4 27.075 30.75 21.25 20.925 5 29.099999999999998 31.7 20.075000000000003 19.125 6 22.525000000000002 36.375 20.225 20.875 7 23.474999999999998 19.75 33.625 23.150000000000002 8 22.225 22.2 26.8 28.775000000000002 9 24.975 21.425 28.125 25.474999999999998 10-14 26.125 26.400000000000002 23.630000000000003 23.845 15-19 26.02 25.95 24.21 23.82 20-24 26.3 25.130000000000003 25.09 23.48 25-29 25.91 25.674999999999997 25.195 23.22 30-34 25.465 25.335 24.815 24.385 35-39 25.555 26.57 23.91 23.965 40-44 26.195 25.255 24.97 23.580000000000002 45-49 26.645000000000003 25.240000000000002 24.45 23.665 50-54 25.275 25.575 26.125 23.025000000000002 55-59 25.419999999999998 26.06 24.675 23.845 60-64 26.155 24.875 24.735 24.235 65-69 26.055 25.045 24.9 24.0 70-74 26.0 25.624999999999996 24.490000000000002 23.885 75-79 27.165 23.375 25.8 23.66 80-84 25.240000000000002 26.375 24.91 23.474999999999998 85-89 23.44 28.33 24.485 23.745 90-94 26.35 25.224999999999998 24.935 23.49 95-99 26.424999999999997 25.75 24.735 23.09 100-104 26.405 25.615 24.725 23.255 105-109 26.125 25.66 25.155 23.06 110-114 26.575 25.840000000000003 24.695 22.89 115-119 26.655 25.705 24.905 22.735 120-124 26.755000000000003 25.745 24.54 22.96 125-129 26.540000000000003 25.555 24.91 22.994999999999997 130-134 27.034999999999997 25.605 24.740000000000002 22.62 135-139 26.515 25.8 25.064999999999998 22.62 140-144 27.560000000000002 25.985000000000003 24.45 22.005 145-149 28.110000000000003 25.869999999999997 23.865 22.155 150-151 25.674999999999997 25.974999999999998 26.2875 22.0625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 1.5 27 3.5 28 4.0 29 5.0 30 11.0 31 20.0 32 26.0 33 29.5 34 42.0 35 52.0 36 56.5 37 70.5 38 80.5 39 92.5 40 119.5 41 142.0 42 155.5 43 167.0 44 158.5 45 163.5 46 176.5 47 174.5 48 170.0 49 154.0 50 149.0 51 162.5 52 158.5 53 138.0 54 128.5 55 107.5 56 92.5 57 91.5 58 79.0 59 75.5 60 77.5 61 67.5 62 59.5 63 59.5 64 67.0 65 65.0 66 57.5 67 64.5 68 54.5 69 37.5 70 31.5 71 27.5 72 23.0 73 13.0 74 9.0 75 7.5 76 4.0 77 3.0 78 2.0 79 0.5 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 87.42010459035444 75.225 2 10.371876815804765 17.849999999999998 3 1.6269610691458454 4.2 4 0.31958163858221966 1.0999999999999999 5 0.058105752469494475 0.25 6 0.08715862870424172 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.08715862870424172 0.675 >10 0.029052876234747237 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 10 0.25 No Hit CGGGTTCTGAAACCTGGGATGCGCAAGGAAGCTGACGAGCGGGAGGCCCT 9 0.22499999999999998 No Hit ACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTTGAT 9 0.22499999999999998 No Hit AGGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGC 9 0.22499999999999998 No Hit GAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAA 6 0.15 No Hit GGCGGGACTACCCGCTGAGTTTAAGCATATAAATAAGCGGAGGAGAAGAA 6 0.15 No Hit CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 6 0.15 No Hit AGTAATTCTAGAGCTAATACGTGCAACAAACCCCGACTTCTGGGAGGGGC 5 0.125 No Hit CAATCGCACCATAGCAAACACGGAAACACCACCCGCGCCGCTTCGAAGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.1749999999999998 0.0 0.0 0.0 0.0 106-107 1.45 0.0 0.0 0.0 0.0 108-109 1.7375 0.0 0.0 0.0 0.0 110-111 2.0250000000000004 0.0 0.0 0.0 0.0 112-113 2.1500000000000004 0.0 0.0 0.0 0.0 114-115 2.3375 0.0 0.0 0.0 0.0 116-117 2.7750000000000004 0.0 0.0 0.0 0.0 118-119 2.9625000000000004 0.0 0.0 0.0 0.0 120-121 3.225 0.0 0.0 0.0 0.0 122-123 3.6624999999999996 0.0 0.0 0.0 0.0 124-125 4.0625 0.0 0.0 0.0 0.0 126-127 4.512499999999999 0.0 0.0 0.0 0.0 128-129 4.9375 0.0 0.0 0.0 0.0 130-131 5.4375 0.0 0.0 0.0 0.0 132-133 6.0375 0.0 0.0 0.0 0.0 134-135 6.85 0.0 0.0 0.0 0.0 136-137 7.3 0.0 0.0 0.0 0.0 138-139 7.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTGGTT 10 0.006830828 145.0 7 >>END_MODULE Read 646286 spots for SRR18694368.sra Written 646286 spots for SRR18694368.sra Read 646286 spots for SRR18694368.sra Written 646286 spots for SRR18694368.sra Read 646286 spots for SRR18694368.sra Written 646286 spots for SRR18694368.sra Read 646286 spots for SRR18694368.sra Written 646286 spots for SRR18694368.sra Read 646286 spots for SRR18694368.sra Written 646286 spots for SRR18694368.sra Read 646286 spots for SRR18694368.sra Written 646286 spots for SRR18694368.sra Read 646286 spots for SRR18694368.sra Written 646286 spots for SRR18694368.sra Read 646286 spots for SRR18694368.sra Written 646286 spots for SRR18694368.sra Read 646286 spots for SRR18694368.sra Written 646286 spots for SRR18694368.sra Read 646286 spots for SRR18694368.sra Written 646286 spots for SRR18694368.sra Read 646286 spots for SRR18694368.sra Written 646286 spots for SRR18694368.sra Read 646301 spots for SRR18694368.sra Written 646301 spots for SRR18694368.sra Read 646286 spots for SRR18694368.sra Written 646286 spots for SRR18694368.sra Read 646286 spots for SRR18694368.sra Written 646286 spots for SRR18694368.sra Read 646286 spots for SRR18694368.sra Written 646286 spots for SRR18694368.sra Read 646286 spots for SRR18694368.sra Written 646286 spots for SRR18694368.sra Read 646286 spots for SRR18694368.sra Written 646286 spots for SRR18694368.sra Read 646286 spots for SRR18694368.sra Written 646286 spots for SRR18694368.sra Read 646286 spots for SRR18694368.sra Written 646286 spots for SRR18694368.sra Read 646286 spots for SRR18694368.sra Written 646286 spots for SRR18694368.sra SRR ids: ['SRR18694368.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0qyjbryk SRR18694368.sra spots: 12925735 blocks: [[1, 646286], [646287, 1292572], [1292573, 1938858], [1938859, 2585144], [2585145, 3231430], [3231431, 3877716], [3877717, 4524002], [4524003, 5170288], [5170289, 5816574], [5816575, 6462860], [6462861, 7109146], [7109147, 7755432], [7755433, 8401718], [8401719, 9048004], [9048005, 9694290], [9694291, 10340576], [10340577, 10986862], [10986863, 11633148], [11633149, 12279434], [12279435, 12925735]] SRR18694368 file size 4371029 SRR18694368 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694368 SRR18694368_1.fastq SRR18694368_2.fastq Input file: SRR18694368_1.fastq Paired file: SRR18694368_2.fastq trimmed: SRR18694368-trimmed-pair1.fastq, SRR18694368-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:06:47 2024 >> started Tue Dec 10 06:07:01 2024 >> done (14.649s) 12925735 read pairs processed; of these: 101 ( 0.00%) short read pairs filtered out after trimming by size control 1795 ( 0.01%) empty read pairs filtered out after trimming by size control 12923839 (99.99%) read pairs available; of these: 1607980 (12.44%) trimmed read pairs available after processing 11315859 (87.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 11 0.00% 20 5 0.00% 21 10 0.00% 22 12 0.00% 23 9 0.00% 24 17 0.00% 25 12 0.00% 26 20 0.00% 27 14 0.00% 28 21 0.00% 29 20 0.00% 30 20 0.00% 31 23 0.00% 32 24 0.00% 33 19 0.00% 34 35 0.00% 35 21 0.00% 36 31 0.00% 37 35 0.00% 38 28 0.00% 39 24 0.00% 40 23 0.00% 41 31 0.00% 42 32 0.00% 43 54 0.00% 44 40 0.00% 45 35 0.00% 46 53 0.00% 47 45 0.00% 48 52 0.00% 49 74 0.00% 50 77 0.00% 51 69 0.00% 52 72 0.00% 53 91 0.00% 54 96 0.00% 55 94 0.00% 56 127 0.00% 57 105 0.00% 58 160 0.00% 59 161 0.00% 60 197 0.00% 61 250 0.00% 62 278 0.00% 63 290 0.00% 64 353 0.00% 65 308 0.00% 66 408 0.00% 67 446 0.00% 68 463 0.00% 69 574 0.00% 70 720 0.01% 71 751 0.01% 72 900 0.01% 73 1019 0.01% 74 1133 0.01% 75 1315 0.01% 76 1450 0.01% 77 1472 0.01% 78 1764 0.01% 79 2037 0.02% 80 2092 0.02% 81 2441 0.02% 82 2808 0.02% 83 3101 0.02% 84 3270 0.03% 85 3737 0.03% 86 4048 0.03% 87 4516 0.03% 88 5002 0.04% 89 5091 0.04% 90 5386 0.04% 91 5890 0.05% 92 6336 0.05% 93 6922 0.05% 94 7467 0.06% 95 8090 0.06% 96 8676 0.07% 97 9008 0.07% 98 9478 0.07% 99 9908 0.08% 100 10498 0.08% 101 10999 0.09% 102 11550 0.09% 103 12034 0.09% 104 12519 0.10% 105 12685 0.10% 106 13709 0.11% 107 14749 0.11% 108 15099 0.12% 109 15728 0.12% 110 16386 0.13% 111 17098 0.13% 112 18074 0.14% 113 18480 0.14% 114 19363 0.15% 115 20371 0.16% 116 21041 0.16% 117 22050 0.17% 118 22314 0.17% 119 23278 0.18% 120 25399 0.20% 121 24747 0.19% 122 25965 0.20% 123 28065 0.22% 124 28557 0.22% 125 28838 0.22% 126 29492 0.23% 127 29890 0.23% 128 30707 0.24% 129 32533 0.25% 130 32985 0.26% 131 33499 0.26% 132 35326 0.27% 133 35019 0.27% 134 35835 0.28% 135 37103 0.29% 136 37791 0.29% 137 39144 0.30% 138 38952 0.30% 139 40337 0.31% 140 41673 0.32% 141 41825 0.32% 142 43254 0.33% 143 43961 0.34% 144 45051 0.35% 145 45263 0.35% 146 45295 0.35% 147 46953 0.36% 148 47564 0.37% 149 49061 0.38% 150 48563 0.38% 151 11315859 87.56% 12923839 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.61 fanout-score-rank=20 prefix-density=0.17 prefix-fanout=2.9 sequence=CCTTTCCCTCACGGTACTTGTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=34 fanout-score=70.92 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=14.5 sequence=CTTCTCCAGCTCCTT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=35 prefix-density=0.34 prefix-fanout=2.0 sequence=ACGTGAGCTGGGTTTA criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=119.08 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=16.7 sequence=CGCCGCCGCCGT SRR18694368 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:07:59 Started mapping on | Dec 10 06:07:59 Finished on | Dec 10 06:12:20 Mapping speed, Million of reads per hour | 178.26 Number of input reads | 12923839 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 9653830 Uniquely mapped reads % | 74.70% Average mapped length | 294.63 Number of splices: Total | 8329806 Number of splices: Annotated (sjdb) | 7618306 Number of splices: GT/AG | 8219543 Number of splices: GC/AG | 89512 Number of splices: AT/AC | 1052 Number of splices: Non-canonical | 19699 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.02% Deletion average length | 2.30 Insertion rate per base | 0.01% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 149976 % of reads mapped to multiple loci | 1.16% Number of reads mapped to too many loci | 200585 % of reads mapped to too many loci | 1.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.08% % of reads unmapped: other | 13.51% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3120033 3120033 3120033 N_multimapping 149976 149976 149976 N_noFeature 918346 9343095 1080220 N_ambiguous 181850 1607 32995 UnstrandedReadsAssigned:8553634 PositiveStrandReadsAssigned:309128 NegativeStrandReadsAssigned:8540615 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694368 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694368-trimmed-pair1.fastq SRR18694368-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,923,839 reads, 8,682,391 reads pseudoaligned [quant] estimated average fragment length: 250.972 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52973 SRR18694368.ke.tsv 35125 SRR18694368.se.tsv 88098 total ==> SRR18694368.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 686.484 30.453 8.30414 PNS24247 1044 794.028 38.8133 9.1504 PNS24249 1928 1678.03 80.1095 8.93676 PNS24246 1044 794.028 38.8133 9.1504 PNS24248 1044 794.028 38.8133 9.1504 PNS24244 1471 1221.03 65.9977 10.1181 PNS24243 293 97.8639 3 5.73845 KQK14069 1603 1353.03 89.5474 12.3891 KQK14071 474 243.799 3.21807 2.47091 ==> SRR18694368.se.tsv <== BRADI_1g14170v3 121 BRADI_1g53295v3 658 BRADI_1g59795v3 303 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 38 BRADI_1g74790v3 539 BRADI_1g09890v3 0 BRADI_1g77505v3 17 BRADI_1g48960v3 0 SRR18694368 completed mapping pipeline successfully