Starting /dee2/code/volunteer_pipeline.sh SRR18694369 current disk space = 1525739307008 free memory = 1556980652 SRR18694369 SRAfilesize 6bbb0bf577cf8f32ebfcdc932daa2ffd SRR18694369.sra SRR18694369.sra file validated SRR18694369 is paired end SRR18694369 is conventional basespace SRR18694369 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694369_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2445 37.0 37.0 37.0 37.0 37.0 2 36.18325 37.0 37.0 37.0 37.0 37.0 3 36.466 37.0 37.0 37.0 37.0 37.0 4 36.627 37.0 37.0 37.0 37.0 37.0 5 36.596 37.0 37.0 37.0 37.0 37.0 6 36.5255 37.0 37.0 37.0 37.0 37.0 7 36.531 37.0 37.0 37.0 37.0 37.0 8 36.613 37.0 37.0 37.0 37.0 37.0 9 36.6395 37.0 37.0 37.0 37.0 37.0 10-14 36.67980000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.602 37.0 37.0 37.0 37.0 37.0 20-24 36.667 37.0 37.0 37.0 37.0 37.0 25-29 36.5868 37.0 37.0 37.0 37.0 37.0 30-34 36.547900000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.6947 37.0 37.0 37.0 37.0 37.0 40-44 36.6181 37.0 37.0 37.0 37.0 37.0 45-49 36.4433 37.0 37.0 37.0 37.0 37.0 50-54 36.5339 37.0 37.0 37.0 37.0 37.0 55-59 36.5484 37.0 37.0 37.0 37.0 37.0 60-64 36.534400000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.2938 37.0 37.0 37.0 37.0 37.0 70-74 36.4303 37.0 37.0 37.0 37.0 37.0 75-79 36.4693 37.0 37.0 37.0 37.0 37.0 80-84 36.4035 37.0 37.0 37.0 37.0 37.0 85-89 36.1511 37.0 37.0 37.0 37.0 37.0 90-94 35.397000000000006 37.0 37.0 37.0 29.8 37.0 95-99 36.133300000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.201 37.0 37.0 37.0 37.0 37.0 105-109 36.1679 37.0 37.0 37.0 37.0 37.0 110-114 36.2622 37.0 37.0 37.0 37.0 37.0 115-119 36.4935 37.0 37.0 37.0 37.0 37.0 120-124 36.5747 37.0 37.0 37.0 37.0 37.0 125-129 36.5302 37.0 37.0 37.0 37.0 37.0 130-134 36.5378 37.0 37.0 37.0 37.0 37.0 135-139 36.4502 37.0 37.0 37.0 37.0 37.0 140-144 36.2537 37.0 37.0 37.0 37.0 37.0 145-149 36.26180000000001 37.0 37.0 37.0 37.0 37.0 150-151 33.649499999999996 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 1.0 25 2.0 26 1.0 27 4.0 28 4.0 29 4.0 30 9.0 31 15.0 32 21.0 33 51.0 34 103.0 35 310.0 36 3279.0 37 194.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.6 10.174999999999999 5.1 41.125 2 21.459012283780396 10.679368262722488 38.20506392579594 29.65655552770118 3 19.400000000000002 14.274999999999999 26.275 40.050000000000004 4 26.724999999999998 19.975 22.325 30.975 5 26.125 27.450000000000003 23.325000000000003 23.1 6 23.25 30.075000000000003 21.825 24.85 7 18.6 26.0 36.825 18.575 8 20.375 22.05 30.425 27.150000000000002 9 19.925 20.325 35.8 23.95 10-14 23.04 26.19 25.445 25.324999999999996 15-19 22.689999999999998 24.965 25.885 26.46 20-24 23.555 24.695 26.165 25.585 25-29 23.13 25.0 25.96 25.91 30-34 22.75 25.679999999999996 25.41 26.16 35-39 22.685 25.3 26.015 26.0 40-44 23.335 24.67 25.624999999999996 26.369999999999997 45-49 23.3 24.740000000000002 25.365 26.595000000000002 50-54 23.09 25.085 25.835 25.990000000000002 55-59 23.085 25.21 25.825 25.88 60-64 23.48 24.915000000000003 25.465 26.14 65-69 23.745 24.709999999999997 25.474999999999998 26.07 70-74 23.945 25.014999999999997 25.474999999999998 25.564999999999998 75-79 23.86 24.884999999999998 25.264999999999997 25.990000000000002 80-84 23.544999999999998 24.515 25.47 26.47 85-89 23.75 24.68 25.590000000000003 25.979999999999997 90-94 23.695 25.35 24.935 26.02 95-99 22.675 25.205 25.874999999999996 26.245 100-104 23.925 24.79 25.685000000000002 25.6 105-109 24.060000000000002 25.165 24.9 25.874999999999996 110-114 23.255 24.995 25.46 26.290000000000003 115-119 23.544999999999998 25.34 24.84 26.275 120-124 23.79 25.09 24.68 26.44 125-129 24.385 24.65 24.610000000000003 26.355 130-134 23.94 25.835 24.385 25.840000000000003 135-139 23.955000000000002 24.795 25.009999999999998 26.240000000000002 140-144 23.605 25.080000000000002 24.895 26.419999999999998 145-149 24.34 25.41 24.205 26.045 150-151 22.85 24.887500000000003 25.374999999999996 26.887499999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.5 27 2.5 28 4.0 29 6.0 30 10.5 31 12.5 32 16.5 33 25.0 34 33.0 35 40.5 36 48.5 37 55.5 38 67.0 39 94.5 40 112.5 41 125.5 42 152.0 43 166.0 44 179.0 45 202.0 46 215.5 47 189.0 48 159.5 49 174.5 50 162.5 51 142.5 52 150.0 53 135.5 54 121.5 55 122.5 56 118.5 57 106.0 58 94.0 59 78.5 60 68.0 61 71.5 62 59.0 63 54.5 64 61.5 65 62.5 66 53.5 67 44.5 68 42.5 69 35.5 70 31.5 71 28.5 72 22.5 73 13.5 74 8.5 75 7.0 76 3.5 77 2.0 78 2.5 79 1.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.7 #Duplication Level Percentage of deduplicated Percentage of total 1 85.09445100354192 72.075 2 12.278630460448642 20.8 3 2.2432113341204247 5.7 4 0.29515938606847697 1.0 5 0.05903187721369539 0.25 6 0.0 0.0 7 0.029515938606847696 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCAATCTTGGGGCCTGGGCCGCTGCTGCCGCCGGCAGTGCTCGCCGGA 7 0.17500000000000002 No Hit CCTCACGGTACTACTTCGCTATCGGTCACCCAGGAGTATTTAGCCTTGCA 5 0.125 No Hit CTGTAATCAGTCTTTCCCTGTCTCCTCCGCTTGAACTTGACTTGGAAGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.6875 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 0.8374999999999999 0.0 0.0 0.0 0.0 90-91 0.9875 0.0 0.0 0.0 0.0 92-93 1.0875 0.0 0.0 0.0 0.0 94-95 1.25 0.0 0.0 0.0 0.0 96-97 1.475 0.0 0.0 0.0 0.0 98-99 1.75 0.0 0.0 0.0 0.0 100-101 1.9875 0.0 0.0 0.0 0.0 102-103 2.075 0.0 0.0 0.0 0.0 104-105 2.25 0.0 0.0 0.0 0.0 106-107 2.4625 0.0 0.0 0.0 0.0 108-109 2.7249999999999996 0.0 0.0 0.0 0.0 110-111 3.0125 0.0 0.0 0.0 0.0 112-113 3.3499999999999996 0.0 0.0 0.0 0.0 114-115 3.65 0.0 0.0 0.0 0.0 116-117 3.9625 0.0 0.0 0.0 0.0 118-119 4.4125 0.0 0.0 0.0 0.0 120-121 4.85 0.0 0.0 0.0 0.0 122-123 5.225 0.0 0.0 0.0 0.0 124-125 5.6625 0.0 0.0 0.0 0.0 126-127 5.987500000000001 0.0 0.0 0.0 0.0 128-129 6.375 0.0 0.0 0.0 0.0 130-131 6.7125 0.0 0.0 0.0 0.0 132-133 7.2125 0.0 0.0 0.0 0.0 134-135 7.75 0.0 0.0 0.0 0.0 136-137 8.55 0.0 0.0 0.0 0.0 138-139 9.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18694369 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694369_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.285 37.0 37.0 37.0 25.0 37.0 2 35.127 37.0 37.0 37.0 25.0 37.0 3 35.278 37.0 37.0 37.0 25.0 37.0 4 35.264 37.0 37.0 37.0 25.0 37.0 5 35.0615 37.0 37.0 37.0 25.0 37.0 6 35.2515 37.0 37.0 37.0 25.0 37.0 7 35.2635 37.0 37.0 37.0 25.0 37.0 8 35.562 37.0 37.0 37.0 37.0 37.0 9 35.594 37.0 37.0 37.0 37.0 37.0 10-14 35.6158 37.0 37.0 37.0 37.0 37.0 15-19 35.623000000000005 37.0 37.0 37.0 37.0 37.0 20-24 35.4046 37.0 37.0 37.0 34.6 37.0 25-29 35.5931 37.0 37.0 37.0 32.2 37.0 30-34 35.8411 37.0 37.0 37.0 37.0 37.0 35-39 35.688700000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.3746 37.0 37.0 37.0 29.8 37.0 45-49 35.5798 37.0 37.0 37.0 37.0 37.0 50-54 35.0092 37.0 37.0 37.0 32.2 37.0 55-59 34.377500000000005 37.0 37.0 37.0 25.0 37.0 60-64 35.08540000000001 37.0 37.0 37.0 27.4 37.0 65-69 34.2496 37.0 34.6 37.0 27.4 37.0 70-74 33.07899999999999 37.0 29.8 37.0 22.2 37.0 75-79 33.6109 37.0 34.6 37.0 22.2 37.0 80-84 34.653999999999996 37.0 37.0 37.0 25.0 37.0 85-89 32.7276 37.0 32.2 37.0 19.4 37.0 90-94 34.1442 37.0 37.0 37.0 25.0 37.0 95-99 34.0815 37.0 37.0 37.0 25.0 37.0 100-104 33.4991 37.0 37.0 37.0 25.0 37.0 105-109 34.235 37.0 37.0 37.0 25.0 37.0 110-114 34.6564 37.0 37.0 37.0 25.0 37.0 115-119 34.5363 37.0 37.0 37.0 25.0 37.0 120-124 34.2175 37.0 37.0 37.0 25.0 37.0 125-129 34.0618 37.0 37.0 37.0 25.0 37.0 130-134 33.835 37.0 37.0 37.0 25.0 37.0 135-139 32.2016 37.0 27.4 37.0 13.8 37.0 140-144 31.6846 37.0 25.0 37.0 11.0 37.0 145-149 31.194399999999995 37.0 25.0 37.0 13.8 37.0 150-151 30.645000000000003 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 1.0 18 0.0 19 1.0 20 2.0 21 0.0 22 5.0 23 5.0 24 7.0 25 4.0 26 7.0 27 15.0 28 19.0 29 47.0 30 72.0 31 148.0 32 295.0 33 533.0 34 1185.0 35 1466.0 36 186.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.65 22.25 7.225 30.875000000000004 2 29.475 21.349999999999998 29.799999999999997 19.375 3 22.25 23.525 30.599999999999998 23.625 4 26.700000000000003 29.4 21.675 22.225 5 27.6 33.800000000000004 18.525 20.075000000000003 6 23.125 35.3 19.650000000000002 21.925 7 22.8 20.1 35.3 21.8 8 22.675 22.575 26.55 28.199999999999996 9 24.025 21.325 28.000000000000004 26.650000000000002 10-14 25.82 25.685000000000002 23.705000000000002 24.79 15-19 25.840000000000003 25.080000000000002 24.47 24.610000000000003 20-24 26.290000000000003 25.355 23.474999999999998 24.88 25-29 26.075 25.619999999999997 24.169999999999998 24.135 30-34 26.224999999999998 24.695 24.605 24.474999999999998 35-39 26.075 25.765 23.830000000000002 24.33 40-44 26.375 25.045 24.245 24.335 45-49 26.810000000000002 24.79 24.305 24.095 50-54 25.595000000000002 25.615 24.89 23.9 55-59 25.650000000000002 26.215 23.78 24.355 60-64 25.64 25.16 24.525 24.675 65-69 26.22 25.765 24.22 23.794999999999998 70-74 26.334999999999997 25.22 24.265 24.18 75-79 27.115000000000002 23.56 24.945 24.38 80-84 26.555 25.165 24.415 23.865 85-89 24.060000000000002 27.11 24.745 24.085 90-94 26.69 25.595000000000002 24.055 23.66 95-99 26.515 24.665 24.34 24.48 100-104 26.715 25.330000000000002 24.22 23.735 105-109 25.97 25.775 24.69 23.565 110-114 26.71 25.724999999999998 24.265 23.3 115-119 26.669999999999998 25.91 23.66 23.76 120-124 27.07 25.355 24.47 23.105 125-129 27.305 25.374999999999996 24.310000000000002 23.01 130-134 27.24 25.905 23.94 22.915 135-139 27.084999999999997 25.905 23.849999999999998 23.16 140-144 27.415 25.674999999999997 24.205 22.705000000000002 145-149 27.415 26.145000000000003 24.145 22.295 150-151 27.0125 25.624999999999996 25.2375 22.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 0.5 28 1.5 29 5.0 30 11.5 31 13.0 32 10.5 33 14.0 34 27.0 35 47.5 36 56.5 37 57.0 38 63.0 39 86.0 40 113.0 41 132.0 42 146.5 43 164.0 44 171.0 45 177.0 46 179.0 47 168.5 48 171.0 49 178.5 50 171.0 51 142.0 52 124.0 53 120.0 54 125.5 55 119.0 56 101.0 57 105.0 58 107.0 59 89.5 60 75.5 61 73.0 62 74.0 63 77.5 64 76.0 65 64.0 66 51.0 67 54.0 68 60.0 69 51.5 70 42.5 71 33.0 72 24.5 73 17.5 74 7.5 75 4.0 76 3.5 77 2.5 78 2.0 79 1.5 80 1.5 81 1.0 82 1.5 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.55 #Duplication Level Percentage of deduplicated Percentage of total 1 86.38223261250731 73.9 2 11.046171829339567 18.9 3 2.104032729398013 5.4 4 0.3506721215663355 1.2 5 0.058445353594389245 0.25 6 0.0 0.0 7 0.058445353594389245 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 7 0.17500000000000002 No Hit CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 7 0.17500000000000002 No Hit AGAGCAGCAGCCGCCGCCGCCGCTGCTTCTGTTCTCCCCCGCCGCAGCCA 5 0.125 No Hit GGCTTGCGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.6875 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 0.8374999999999999 0.0 0.0 0.0 0.0 90-91 0.9875 0.0 0.0 0.0 0.0 92-93 1.0875 0.0 0.0 0.0 0.0 94-95 1.25 0.0 0.0 0.0 0.0 96-97 1.475 0.0 0.0 0.0 0.0 98-99 1.75 0.0 0.0 0.0 0.0 100-101 1.9625 0.0 0.0 0.0 0.0 102-103 2.05 0.0 0.0 0.0 0.0 104-105 2.2375 0.0 0.0 0.0 0.0 106-107 2.4375 0.0 0.0 0.0 0.0 108-109 2.7 0.0 0.0 0.0 0.0 110-111 2.9875 0.0 0.0 0.0 0.0 112-113 3.325 0.0 0.0 0.0 0.0 114-115 3.625 0.0 0.0 0.0 0.0 116-117 3.9125 0.0 0.0 0.0 0.0 118-119 4.3625 0.0 0.0 0.0 0.0 120-121 4.800000000000001 0.0 0.0 0.0 0.0 122-123 5.175 0.0 0.0 0.0 0.0 124-125 5.612500000000001 0.0 0.0 0.0 0.0 126-127 5.9375 0.0 0.0 0.0 0.0 128-129 6.35 0.0 0.0 0.0 0.0 130-131 6.6875 0.0 0.0125 0.0 0.0 132-133 7.1875 0.0 0.025 0.0 0.0 134-135 7.725 0.0 0.025 0.0 0.0 136-137 8.524999999999999 0.0 0.025 0.0 0.0 138-139 9.325 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCAGCC 10 0.006830828 145.0 7 >>END_MODULE Read 431555 spots for SRR18694369.sra Written 431555 spots for SRR18694369.sra Read 431555 spots for SRR18694369.sra Written 431555 spots for SRR18694369.sra Read 431555 spots for SRR18694369.sra Written 431555 spots for SRR18694369.sra Read 431555 spots for SRR18694369.sra Written 431555 spots for SRR18694369.sra Read 431555 spots for SRR18694369.sra Written 431555 spots for SRR18694369.sra Read 431555 spots for SRR18694369.sra Written 431555 spots for SRR18694369.sra Read 431555 spots for SRR18694369.sra Written 431555 spots for SRR18694369.sra Read 431555 spots for SRR18694369.sra Written 431555 spots for SRR18694369.sra Read 431555 spots for SRR18694369.sra Written 431555 spots for SRR18694369.sra Read 431555 spots for SRR18694369.sra Written 431555 spots for SRR18694369.sra Read 431555 spots for SRR18694369.sra Written 431555 spots for SRR18694369.sra Read 431555 spots for SRR18694369.sra Written 431555 spots for SRR18694369.sra Read 431555 spots for SRR18694369.sra Written 431555 spots for SRR18694369.sra Read 431555 spots for SRR18694369.sra Written 431555 spots for SRR18694369.sra Read 431555 spots for SRR18694369.sra Written 431555 spots for SRR18694369.sra Read 431555 spots for SRR18694369.sra Written 431555 spots for SRR18694369.sra Read 431557 spots for SRR18694369.sra Written 431557 spots for SRR18694369.sra Read 431555 spots for SRR18694369.sra Written 431555 spots for SRR18694369.sra Read 431555 spots for SRR18694369.sra Written 431555 spots for SRR18694369.sra Read 431555 spots for SRR18694369.sra Written 431555 spots for SRR18694369.sra SRR ids: ['SRR18694369.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nw6z7d30 SRR18694369.sra spots: 8631102 blocks: [[1, 431555], [431556, 863110], [863111, 1294665], [1294666, 1726220], [1726221, 2157775], [2157776, 2589330], [2589331, 3020885], [3020886, 3452440], [3452441, 3883995], [3883996, 4315550], [4315551, 4747105], [4747106, 5178660], [5178661, 5610215], [5610216, 6041770], [6041771, 6473325], [6473326, 6904880], [6904881, 7336435], [7336436, 7767990], [7767991, 8199545], [8199546, 8631102]] SRR18694369 file size 2914199 SRR18694369 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694369 SRR18694369_1.fastq SRR18694369_2.fastq Input file: SRR18694369_1.fastq Paired file: SRR18694369_2.fastq trimmed: SRR18694369-trimmed-pair1.fastq, SRR18694369-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:10:31 2024 >> started Tue Dec 10 06:10:43 2024 >> done (11.758s) 8631102 read pairs processed; of these: 105 ( 0.00%) short read pairs filtered out after trimming by size control 1370 ( 0.02%) empty read pairs filtered out after trimming by size control 8629627 (99.98%) read pairs available; of these: 1230234 (14.26%) trimmed read pairs available after processing 7399393 (85.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 6 0.00% 20 9 0.00% 21 8 0.00% 22 11 0.00% 23 15 0.00% 24 14 0.00% 25 21 0.00% 26 20 0.00% 27 10 0.00% 28 17 0.00% 29 23 0.00% 30 11 0.00% 31 22 0.00% 32 26 0.00% 33 21 0.00% 34 18 0.00% 35 24 0.00% 36 18 0.00% 37 19 0.00% 38 34 0.00% 39 37 0.00% 40 34 0.00% 41 37 0.00% 42 29 0.00% 43 37 0.00% 44 31 0.00% 45 36 0.00% 46 36 0.00% 47 53 0.00% 48 58 0.00% 49 69 0.00% 50 74 0.00% 51 83 0.00% 52 97 0.00% 53 86 0.00% 54 112 0.00% 55 114 0.00% 56 124 0.00% 57 144 0.00% 58 168 0.00% 59 209 0.00% 60 249 0.00% 61 312 0.00% 62 397 0.00% 63 329 0.00% 64 430 0.00% 65 449 0.01% 66 550 0.01% 67 517 0.01% 68 655 0.01% 69 705 0.01% 70 831 0.01% 71 886 0.01% 72 1092 0.01% 73 1246 0.01% 74 1283 0.01% 75 1476 0.02% 76 1661 0.02% 77 1741 0.02% 78 2001 0.02% 79 2227 0.03% 80 2512 0.03% 81 2790 0.03% 82 2990 0.03% 83 3369 0.04% 84 3655 0.04% 85 3905 0.05% 86 4351 0.05% 87 4504 0.05% 88 4969 0.06% 89 5221 0.06% 90 5683 0.07% 91 6418 0.07% 92 6483 0.08% 93 7178 0.08% 94 7571 0.09% 95 7898 0.09% 96 8042 0.09% 97 8642 0.10% 98 9212 0.11% 99 9410 0.11% 100 10161 0.12% 101 10213 0.12% 102 10856 0.13% 103 11023 0.13% 104 11875 0.14% 105 12226 0.14% 106 13004 0.15% 107 13015 0.15% 108 13290 0.15% 109 14085 0.16% 110 14365 0.17% 111 14815 0.17% 112 15756 0.18% 113 16050 0.19% 114 16529 0.19% 115 17318 0.20% 116 17369 0.20% 117 17826 0.21% 118 18288 0.21% 119 18775 0.22% 120 19566 0.23% 121 19558 0.23% 122 19980 0.23% 123 21085 0.24% 124 21515 0.25% 125 21901 0.25% 126 22351 0.26% 127 22492 0.26% 128 22893 0.27% 129 23336 0.27% 130 23848 0.28% 131 24349 0.28% 132 24993 0.29% 133 25476 0.30% 134 25650 0.30% 135 26214 0.30% 136 26790 0.31% 137 26593 0.31% 138 27211 0.32% 139 27770 0.32% 140 28131 0.33% 141 29029 0.34% 142 29504 0.34% 143 29644 0.34% 144 30263 0.35% 145 30365 0.35% 146 30587 0.35% 147 31313 0.36% 148 31377 0.36% 149 31607 0.37% 150 32139 0.37% 151 7399393 85.74% 8629627 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=30 prefix-density=0.33 prefix-fanout=2.0 sequence=GTATTTAGCCTTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=148.09 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=9.8 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=33 prefix-density=0.35 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=30.86 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.7 sequence=AAGAACCTTACCAGGGCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGCCCTCGGGAACGCGGACACAGGTGGTGCATG SRR18694369 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:11:30 Started mapping on | Dec 10 06:11:30 Finished on | Dec 10 06:12:28 Mapping speed, Million of reads per hour | 535.63 Number of input reads | 8629627 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 7802592 Uniquely mapped reads % | 90.42% Average mapped length | 293.22 Number of splices: Total | 7506092 Number of splices: Annotated (sjdb) | 6989980 Number of splices: GT/AG | 7402495 Number of splices: GC/AG | 85406 Number of splices: AT/AC | 3739 Number of splices: Non-canonical | 14452 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.01% Deletion average length | 2.36 Insertion rate per base | 0.01% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 264607 % of reads mapped to multiple loci | 3.07% Number of reads mapped to too many loci | 40195 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.58% % of reads unmapped: other | 3.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 562428 562428 562428 N_multimapping 264607 264607 264607 N_noFeature 575659 7566877 672175 N_ambiguous 171803 1291 32575 UnstrandedReadsAssigned:7055130 PositiveStrandReadsAssigned:234424 NegativeStrandReadsAssigned:7097842 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694369 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694369-trimmed-pair1.fastq SRR18694369-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,629,627 reads, 7,242,140 reads pseudoaligned [quant] estimated average fragment length: 249.054 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52973 SRR18694369.ke.tsv 35125 SRR18694369.se.tsv 88098 total ==> SRR18694369.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 688.395 0 0 PNS24247 1044 795.946 35.2226 8.92536 PNS24249 1928 1679.95 28.1697 3.38201 PNS24246 1044 795.946 35.2226 8.92536 PNS24248 1044 795.946 35.2226 8.92536 PNS24244 1471 1222.95 49.1627 8.10805 PNS24243 293 101.539 0 0 KQK14069 1603 1354.95 913.835 136.03 KQK14071 474 245.445 8.22589 6.75954 ==> SRR18694369.se.tsv <== BRADI_1g14170v3 1023 BRADI_1g53295v3 665 BRADI_1g59795v3 313 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 116 BRADI_1g74790v3 132 BRADI_1g09890v3 0 BRADI_1g77505v3 77 BRADI_1g48960v3 0 SRR18694369 completed mapping pipeline successfully