Starting /dee2/code/volunteer_pipeline.sh SRR18694370 current disk space = 1525743075328 free memory = 1602395244 SRR18694370 SRAfilesize e5cda808123d1df69c9f3ff0733c1e6d SRR18694370.sra SRR18694370.sra file validated SRR18694370 is paired end SRR18694370 is conventional basespace SRR18694370 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694370_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.109 37.0 37.0 37.0 37.0 37.0 2 36.003 37.0 37.0 37.0 37.0 37.0 3 36.3065 37.0 37.0 37.0 37.0 37.0 4 36.382 37.0 37.0 37.0 37.0 37.0 5 36.555 37.0 37.0 37.0 37.0 37.0 6 36.5435 37.0 37.0 37.0 37.0 37.0 7 36.5205 37.0 37.0 37.0 37.0 37.0 8 36.576 37.0 37.0 37.0 37.0 37.0 9 36.534 37.0 37.0 37.0 37.0 37.0 10-14 36.629200000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.55 37.0 37.0 37.0 37.0 37.0 20-24 36.587199999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.5659 37.0 37.0 37.0 37.0 37.0 30-34 36.5118 37.0 37.0 37.0 37.0 37.0 35-39 36.61450000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.5467 37.0 37.0 37.0 37.0 37.0 45-49 36.3372 37.0 37.0 37.0 37.0 37.0 50-54 36.466699999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.502300000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.4499 37.0 37.0 37.0 37.0 37.0 65-69 36.27460000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.3318 37.0 37.0 37.0 37.0 37.0 75-79 36.46939999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.37 37.0 37.0 37.0 37.0 37.0 85-89 36.174699999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.3387 37.0 37.0 37.0 29.8 37.0 95-99 36.0554 37.0 37.0 37.0 37.0 37.0 100-104 36.078199999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.0635 37.0 37.0 37.0 37.0 37.0 110-114 36.1356 37.0 37.0 37.0 37.0 37.0 115-119 36.3775 37.0 37.0 37.0 37.0 37.0 120-124 36.4206 37.0 37.0 37.0 37.0 37.0 125-129 36.4259 37.0 37.0 37.0 37.0 37.0 130-134 36.3965 37.0 37.0 37.0 37.0 37.0 135-139 36.3015 37.0 37.0 37.0 37.0 37.0 140-144 36.140499999999996 37.0 37.0 37.0 37.0 37.0 145-149 36.074799999999996 37.0 37.0 37.0 37.0 37.0 150-151 33.5685 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 1.0 20 0.0 21 1.0 22 0.0 23 1.0 24 2.0 25 2.0 26 1.0 27 2.0 28 2.0 29 5.0 30 17.0 31 23.0 32 38.0 33 59.0 34 129.0 35 358.0 36 3202.0 37 156.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.275000000000006 9.875 4.725 35.125 2 23.79396984924623 9.748743718592964 35.050251256281406 31.4070351758794 3 20.200000000000003 14.2 26.1 39.5 4 26.200000000000003 22.275 21.675 29.849999999999998 5 27.075 26.525 22.6 23.799999999999997 6 23.549999999999997 28.825 23.200000000000003 24.425 7 19.25 24.125 40.075 16.55 8 18.625 23.150000000000002 31.0 27.224999999999998 9 19.55 21.875 34.225 24.349999999999998 10-14 23.035 26.755000000000003 25.580000000000002 24.63 15-19 23.895 24.33 25.979999999999997 25.795 20-24 23.195 24.855 26.150000000000002 25.8 25-29 23.105 25.835 25.840000000000003 25.22 30-34 23.095 24.52 25.765 26.619999999999997 35-39 23.165 24.895 25.695 26.245 40-44 23.064999999999998 25.27 25.705 25.96 45-49 22.945 25.480000000000004 25.485000000000003 26.090000000000003 50-54 23.0 24.6 25.765 26.634999999999998 55-59 23.34 25.264999999999997 25.525 25.869999999999997 60-64 23.05 24.349999999999998 26.205000000000002 26.395000000000003 65-69 23.105 25.595000000000002 25.569999999999997 25.729999999999997 70-74 23.54 24.990000000000002 25.759999999999998 25.71 75-79 23.815 24.42 26.240000000000002 25.525 80-84 23.330000000000002 24.705 25.564999999999998 26.400000000000002 85-89 23.885 24.97 25.22 25.924999999999997 90-94 24.13 24.79 25.355 25.724999999999998 95-99 23.235 24.275 25.295 27.195000000000004 100-104 23.575 25.074999999999996 25.595000000000002 25.755 105-109 23.585 25.040000000000003 25.605 25.77 110-114 24.115000000000002 25.314999999999998 24.54 26.029999999999998 115-119 24.215 25.009999999999998 25.25 25.525 120-124 23.845 24.575 25.430000000000003 26.150000000000002 125-129 23.54 25.46 25.495 25.505 130-134 23.419999999999998 24.88 25.590000000000003 26.11 135-139 23.685000000000002 24.92 25.374999999999996 26.02 140-144 23.66 24.805 24.43 27.105 145-149 24.035 24.759999999999998 24.69 26.515 150-151 24.25 24.587500000000002 25.7375 25.424999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 2.0 27 2.0 28 2.0 29 4.5 30 6.0 31 8.5 32 12.0 33 18.5 34 29.5 35 37.5 36 46.5 37 57.0 38 72.0 39 93.5 40 114.0 41 130.0 42 150.5 43 167.5 44 173.0 45 182.5 46 197.0 47 197.0 48 189.0 49 177.0 50 150.5 51 160.5 52 160.5 53 140.5 54 132.5 55 129.5 56 121.5 57 101.5 58 90.0 59 91.0 60 89.0 61 76.0 62 70.5 63 56.5 64 53.5 65 57.5 66 52.0 67 45.5 68 37.0 69 30.0 70 25.5 71 19.0 72 14.5 73 8.5 74 2.0 75 1.5 76 1.5 77 4.0 78 3.5 79 0.5 80 1.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.55 #Duplication Level Percentage of deduplicated Percentage of total 1 85.36369012418687 72.175 2 12.004730928444706 20.3 3 2.099349497338853 5.325 4 0.3252513305736251 1.0999999999999999 5 0.11827321111768185 0.5 6 0.05913660555884093 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.029568302779420463 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGTCAGTTAGCTTCTCGCCGAGATTCGTCATGACATGACGGAGCTCAG 12 0.3 No Hit CATGTACATCGCCGGTGGAGGCTTGGGTGAAGCCTGCGCGGAGTACAACC 6 0.15 No Hit AGACAGCACATCTTGCCCTTCTTGATAATGTCCGCCGCCTCCCGGTACCG 6 0.15 No Hit CCTCACTCCTCTGGCGCGCCTCGACGCGCCCCTGCCCTGCGGCAGGAGCA 5 0.125 No Hit CCGGGAACGGATTCACCGCCGTATGGCTGACCGGCGATTACTAGCGATTC 5 0.125 No Hit CCCGAAGTTACGGATCCGTTTTGCCGACTTCCCTTGCCTACATTGTTCCA 5 0.125 No Hit TCCATTGATAAATGGGGAAACGTTCAATGTTGTTTCCATTAAACTATTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.3250000000000002 0.0 0.0 0.0 0.0 106-107 1.55 0.0 0.0 0.0 0.0 108-109 1.8375 0.0 0.0 0.0 0.0 110-111 2.25 0.0 0.0 0.0 0.0 112-113 2.6375 0.0 0.0 0.0 0.0 114-115 3.1 0.0 0.0 0.0 0.0 116-117 3.2875 0.0 0.0 0.0 0.0 118-119 3.575 0.0 0.0 0.0 0.0 120-121 3.9875 0.0 0.0 0.0 0.0 122-123 4.225 0.0 0.0 0.0 0.0 124-125 4.5375 0.0 0.0 0.0 0.0 126-127 5.0625 0.0 0.0 0.0 0.0 128-129 5.550000000000001 0.0 0.0 0.0 0.0 130-131 6.2875 0.0 0.0 0.0 0.0 132-133 6.9625 0.0 0.0 0.0 0.0 134-135 7.5375 0.0 0.0 0.0 0.0 136-137 8.1375 0.0 0.0 0.0 0.0 138-139 8.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTGGC 10 0.006830828 145.0 9 >>END_MODULE SRR18694370 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694370_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.2605 37.0 37.0 37.0 25.0 37.0 2 35.0685 37.0 37.0 37.0 25.0 37.0 3 35.2055 37.0 37.0 37.0 25.0 37.0 4 35.283 37.0 37.0 37.0 25.0 37.0 5 35.1425 37.0 37.0 37.0 25.0 37.0 6 35.254 37.0 37.0 37.0 25.0 37.0 7 35.3135 37.0 37.0 37.0 37.0 37.0 8 35.599 37.0 37.0 37.0 37.0 37.0 9 35.5185 37.0 37.0 37.0 37.0 37.0 10-14 35.5013 37.0 37.0 37.0 37.0 37.0 15-19 35.607 37.0 37.0 37.0 37.0 37.0 20-24 35.363800000000005 37.0 37.0 37.0 34.6 37.0 25-29 35.5184 37.0 37.0 37.0 34.6 37.0 30-34 35.7556 37.0 37.0 37.0 37.0 37.0 35-39 35.6124 37.0 37.0 37.0 37.0 37.0 40-44 35.2312 37.0 37.0 37.0 29.8 37.0 45-49 35.44799999999999 37.0 37.0 37.0 34.6 37.0 50-54 34.8973 37.0 37.0 37.0 29.8 37.0 55-59 34.311699999999995 37.0 37.0 37.0 25.0 37.0 60-64 35.0078 37.0 37.0 37.0 27.4 37.0 65-69 34.275800000000004 37.0 34.6 37.0 27.4 37.0 70-74 33.0249 37.0 29.8 37.0 25.0 37.0 75-79 33.6158 37.0 34.6 37.0 22.2 37.0 80-84 34.5302 37.0 37.0 37.0 25.0 37.0 85-89 32.587300000000006 37.0 32.2 37.0 19.4 37.0 90-94 33.9377 37.0 37.0 37.0 25.0 37.0 95-99 33.8215 37.0 37.0 37.0 25.0 37.0 100-104 33.366099999999996 37.0 37.0 37.0 25.0 37.0 105-109 34.1858 37.0 37.0 37.0 25.0 37.0 110-114 34.5005 37.0 37.0 37.0 25.0 37.0 115-119 34.3571 37.0 37.0 37.0 25.0 37.0 120-124 34.066 37.0 37.0 37.0 25.0 37.0 125-129 33.924699999999994 37.0 37.0 37.0 25.0 37.0 130-134 33.6022 37.0 34.6 37.0 25.0 37.0 135-139 32.1576 37.0 27.4 37.0 13.8 37.0 140-144 31.663000000000004 37.0 25.0 37.0 11.0 37.0 145-149 31.156 37.0 25.0 37.0 11.0 37.0 150-151 30.58375 37.0 25.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 6.0 18 5.0 19 4.0 20 5.0 21 3.0 22 4.0 23 12.0 24 12.0 25 8.0 26 4.0 27 17.0 28 29.0 29 51.0 30 87.0 31 160.0 32 247.0 33 499.0 34 1102.0 35 1509.0 36 234.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.125 21.8 7.625 24.45 2 30.775000000000002 22.875 26.875 19.475 3 22.375 23.35 31.95 22.325 4 26.900000000000002 31.2 20.0 21.9 5 29.525000000000002 33.975 18.95 17.549999999999997 6 23.575 36.4 17.9 22.125 7 23.75 20.9 33.225 22.125 8 23.05 22.775000000000002 24.349999999999998 29.825000000000003 9 22.775000000000002 23.225 28.449999999999996 25.55 10-14 25.835 26.035000000000004 23.555 24.575 15-19 25.755 24.959999999999997 24.535 24.75 20-24 25.855 25.955000000000002 24.815 23.375 25-29 25.89 24.959999999999997 24.555 24.595 30-34 25.81 25.540000000000003 24.175 24.474999999999998 35-39 26.21 26.145000000000003 24.060000000000002 23.585 40-44 26.26 24.77 24.5 24.47 45-49 26.6 25.014999999999997 24.57 23.815 50-54 24.69 25.82 25.635 23.855 55-59 26.075 25.53 24.4 23.995 60-64 26.064999999999998 25.679999999999996 24.525 23.73 65-69 26.490000000000002 25.369999999999997 24.11 24.03 70-74 26.495 25.180000000000003 24.3 24.025 75-79 27.200000000000003 23.935000000000002 24.825 24.04 80-84 25.924999999999997 25.655 24.805 23.615 85-89 24.23 28.51 23.305 23.955000000000002 90-94 25.555 26.340000000000003 24.255 23.849999999999998 95-99 26.0 26.165 24.955 22.88 100-104 26.035000000000004 26.25 23.865 23.849999999999998 105-109 26.405 25.869999999999997 24.295 23.43 110-114 26.36 26.47 23.94 23.23 115-119 27.134999999999998 26.145000000000003 23.69 23.03 120-124 26.52 25.014999999999997 24.834999999999997 23.630000000000003 125-129 26.6 26.595000000000002 24.36 22.445 130-134 27.3 25.569999999999997 24.775 22.355 135-139 26.88 26.105 24.2 22.814999999999998 140-144 27.22 25.45 24.01 23.32 145-149 27.544999999999998 26.355 23.7 22.400000000000002 150-151 25.424999999999997 24.887500000000003 27.675 22.0125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 0.5 26 2.0 27 3.0 28 4.0 29 6.0 30 6.5 31 12.0 32 13.5 33 19.5 34 31.5 35 37.0 36 44.0 37 64.0 38 86.5 39 94.0 40 107.5 41 132.5 42 151.0 43 159.5 44 181.0 45 193.5 46 180.5 47 182.5 48 186.0 49 168.5 50 147.0 51 140.0 52 130.5 53 130.5 54 130.0 55 109.0 56 98.0 57 99.0 58 95.0 59 89.0 60 89.0 61 87.5 62 80.5 63 63.0 64 54.5 65 53.0 66 52.0 67 61.0 68 57.0 69 42.0 70 31.5 71 25.0 72 19.5 73 11.5 74 8.0 75 7.0 76 4.0 77 3.0 78 2.5 79 2.0 80 1.5 81 0.0 82 0.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.5 88 0.5 89 0.5 90 0.5 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.475 #Duplication Level Percentage of deduplicated Percentage of total 1 86.60427025446037 74.02499999999999 2 11.143609242468559 19.05 3 1.6379058204153263 4.2 4 0.35097981866042705 1.2 5 0.058496636443404505 0.25 6 0.11699327288680901 0.6 7 0.058496636443404505 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.029248318221702253 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCAATGAGGTTGATGCTGATGGCAACGGCACCATTGATTTTCCAGAGT 13 0.325 No Hit ATCAGCTCGATCGATCAGTAGTGTGATCTCAGAGCTCCCATCGCGATCGA 7 0.17500000000000002 No Hit GGGGATCAACCCGATCATGATGAGTGCTGGGGAGCTCGAGAGCGGCAATG 7 0.17500000000000002 No Hit CATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAA 6 0.15 No Hit ACCAGAACCACCAAACGATCAACAACGAACGCAAAAAATAACTCAGTACC 6 0.15 No Hit GGCTTGCGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAG 6 0.15 No Hit GCTAAGCTCCTGGCGGGCAACCGGAGTATCGCACAGTAGCCTTATGTGTT 6 0.15 No Hit GTTATCTTTTCTGCTTAACGGCCTGCCAACCCTGGAATCGGTTCAGCCGG 5 0.125 No Hit GAGGTGGGTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0125 14-15 0.0 0.0 0.0 0.0 0.025 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0125 0.0 0.0 0.0 0.025 32-33 0.025 0.0 0.0 0.0 0.025 34-35 0.025 0.0 0.0 0.0 0.025 36-37 0.025 0.0 0.0 0.0 0.025 38-39 0.025 0.0 0.0 0.0 0.025 40-41 0.025 0.0 0.0 0.0 0.025 42-43 0.025 0.0 0.0 0.0 0.025 44-45 0.025 0.0 0.0 0.0 0.025 46-47 0.025 0.0 0.0 0.0 0.025 48-49 0.025 0.0 0.0 0.0 0.025 50-51 0.025 0.0 0.0 0.0 0.025 52-53 0.025 0.0 0.0 0.0 0.025 54-55 0.025 0.0 0.0 0.0 0.025 56-57 0.025 0.0 0.0 0.0 0.025 58-59 0.0875 0.0 0.0 0.0 0.025 60-61 0.1 0.0 0.0 0.0 0.025 62-63 0.1 0.0 0.0 0.0 0.025 64-65 0.1 0.0 0.0 0.0 0.025 66-67 0.1 0.0 0.0 0.0 0.025 68-69 0.1 0.0 0.0 0.0 0.025 70-71 0.1 0.0 0.0 0.0 0.025 72-73 0.1 0.0 0.0 0.0 0.025 74-75 0.1 0.0 0.0 0.0 0.025 76-77 0.1 0.0 0.0 0.0 0.025 78-79 0.125 0.0 0.0 0.0 0.025 80-81 0.15 0.0 0.0 0.0 0.025 82-83 0.2375 0.0 0.0 0.0 0.025 84-85 0.275 0.0 0.0 0.0 0.025 86-87 0.32499999999999996 0.0 0.0 0.0 0.025 88-89 0.3875 0.0 0.0 0.0 0.025 90-91 0.4375 0.0 0.0 0.0 0.025 92-93 0.48750000000000004 0.0 0.0 0.0 0.025 94-95 0.525 0.0 0.0 0.0 0.025 96-97 0.575 0.0 0.0 0.0 0.025 98-99 0.5874999999999999 0.0 0.0 0.0 0.025 100-101 0.6875 0.0 0.0 0.0 0.025 102-103 0.9125 0.0 0.0 0.0 0.025 104-105 1.275 0.0 0.0 0.0 0.025 106-107 1.5 0.0 0.0 0.0 0.025 108-109 1.7625 0.0 0.0 0.0 0.025 110-111 2.175 0.0 0.0 0.0 0.025 112-113 2.5625 0.0 0.0 0.0 0.025 114-115 3.025 0.0 0.0 0.0 0.025 116-117 3.2125 0.0 0.0 0.0 0.025 118-119 3.475 0.0 0.0 0.0 0.025 120-121 3.8875 0.0 0.0 0.0 0.025 122-123 4.1125 0.0 0.0 0.0 0.025 124-125 4.4125 0.0 0.0 0.0 0.025 126-127 4.925000000000001 0.0 0.0 0.0 0.025 128-129 5.4 0.0 0.0 0.0 0.025 130-131 6.1375 0.0 0.0 0.0 0.025 132-133 6.8125 0.0 0.0 0.0 0.025 134-135 7.375 0.0 0.0 0.0 0.025 136-137 7.949999999999999 0.0 0.0 0.0 0.025 138-139 8.6 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 667300 spots for SRR18694370.sra Written 667300 spots for SRR18694370.sra Read 667300 spots for SRR18694370.sra Written 667300 spots for SRR18694370.sra Read 667300 spots for SRR18694370.sra Written 667300 spots for SRR18694370.sra Read 667300 spots for SRR18694370.sra Written 667300 spots for SRR18694370.sra Read 667300 spots for SRR18694370.sra Written 667300 spots for SRR18694370.sra Read 667300 spots for SRR18694370.sra Written 667300 spots for SRR18694370.sra Read 667300 spots for SRR18694370.sra Written 667300 spots for SRR18694370.sra Read 667300 spots for SRR18694370.sra Written 667300 spots for SRR18694370.sra Read 667317 spots for SRR18694370.sra Written 667317 spots for SRR18694370.sra Read 667300 spots for SRR18694370.sra Written 667300 spots for SRR18694370.sra Read 667300 spots for SRR18694370.sra Written 667300 spots for SRR18694370.sra Read 667300 spots for SRR18694370.sra Written 667300 spots for SRR18694370.sra Read 667300 spots for SRR18694370.sra Written 667300 spots for SRR18694370.sra Read 667300 spots for SRR18694370.sra Written 667300 spots for SRR18694370.sra Read 667300 spots for SRR18694370.sra Written 667300 spots for SRR18694370.sra Read 667300 spots for SRR18694370.sra Written 667300 spots for SRR18694370.sra Read 667300 spots for SRR18694370.sra Written 667300 spots for SRR18694370.sra Read 667300 spots for SRR18694370.sra Written 667300 spots for SRR18694370.sra Read 667300 spots for SRR18694370.sra Written 667300 spots for SRR18694370.sra Read 667300 spots for SRR18694370.sra Written 667300 spots for SRR18694370.sra SRR ids: ['SRR18694370.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7a8qinod SRR18694370.sra spots: 13346017 blocks: [[1, 667300], [667301, 1334600], [1334601, 2001900], [2001901, 2669200], [2669201, 3336500], [3336501, 4003800], [4003801, 4671100], [4671101, 5338400], [5338401, 6005700], [6005701, 6673000], [6673001, 7340300], [7340301, 8007600], [8007601, 8674900], [8674901, 9342200], [9342201, 10009500], [10009501, 10676800], [10676801, 11344100], [11344101, 12011400], [12011401, 12678700], [12678701, 13346017]] SRR18694370 file size 4513860 SRR18694370 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694370 SRR18694370_1.fastq SRR18694370_2.fastq Input file: SRR18694370_1.fastq Paired file: SRR18694370_2.fastq trimmed: SRR18694370-trimmed-pair1.fastq, SRR18694370-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:07:35 2024 >> started Tue Dec 10 06:07:50 2024 >> done (15.448s) 13346017 read pairs processed; of these: 135 ( 0.00%) short read pairs filtered out after trimming by size control 3648 ( 0.03%) empty read pairs filtered out after trimming by size control 13342234 (99.97%) read pairs available; of these: 1696586 (12.72%) trimmed read pairs available after processing 11645648 (87.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 8 0.00% 20 11 0.00% 21 20 0.00% 22 18 0.00% 23 15 0.00% 24 17 0.00% 25 20 0.00% 26 25 0.00% 27 21 0.00% 28 22 0.00% 29 23 0.00% 30 24 0.00% 31 33 0.00% 32 39 0.00% 33 29 0.00% 34 45 0.00% 35 30 0.00% 36 43 0.00% 37 47 0.00% 38 63 0.00% 39 46 0.00% 40 35 0.00% 41 43 0.00% 42 71 0.00% 43 51 0.00% 44 59 0.00% 45 53 0.00% 46 64 0.00% 47 82 0.00% 48 69 0.00% 49 88 0.00% 50 96 0.00% 51 101 0.00% 52 107 0.00% 53 117 0.00% 54 120 0.00% 55 178 0.00% 56 138 0.00% 57 176 0.00% 58 209 0.00% 59 252 0.00% 60 212 0.00% 61 325 0.00% 62 359 0.00% 63 346 0.00% 64 393 0.00% 65 407 0.00% 66 469 0.00% 67 520 0.00% 68 582 0.00% 69 739 0.01% 70 862 0.01% 71 993 0.01% 72 1133 0.01% 73 1235 0.01% 74 1336 0.01% 75 1332 0.01% 76 1505 0.01% 77 1748 0.01% 78 1973 0.01% 79 2262 0.02% 80 2446 0.02% 81 2778 0.02% 82 3041 0.02% 83 3414 0.03% 84 3665 0.03% 85 4023 0.03% 86 4472 0.03% 87 4671 0.04% 88 5100 0.04% 89 5673 0.04% 90 5998 0.04% 91 6484 0.05% 92 6962 0.05% 93 7849 0.06% 94 7995 0.06% 95 8886 0.07% 96 9203 0.07% 97 9768 0.07% 98 9936 0.07% 99 10705 0.08% 100 11305 0.08% 101 12096 0.09% 102 12741 0.10% 103 13554 0.10% 104 13999 0.10% 105 14526 0.11% 106 15092 0.11% 107 15678 0.12% 108 16362 0.12% 109 16952 0.13% 110 17672 0.13% 111 18462 0.14% 112 19521 0.15% 113 20094 0.15% 114 21324 0.16% 115 22321 0.17% 116 22952 0.17% 117 23217 0.17% 118 23578 0.18% 119 24318 0.18% 120 25718 0.19% 121 26017 0.19% 122 27134 0.20% 123 29043 0.22% 124 30021 0.23% 125 30153 0.23% 126 31185 0.23% 127 31776 0.24% 128 32719 0.25% 129 33505 0.25% 130 34137 0.26% 131 34476 0.26% 132 35726 0.27% 133 37191 0.28% 134 37902 0.28% 135 39198 0.29% 136 40507 0.30% 137 39913 0.30% 138 40820 0.31% 139 41971 0.31% 140 41589 0.31% 141 43889 0.33% 142 44268 0.33% 143 45189 0.34% 144 46429 0.35% 145 47758 0.36% 146 48174 0.36% 147 50167 0.38% 148 49158 0.37% 149 49663 0.37% 150 50905 0.38% 151 11645648 87.28% 13342234 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=24 prefix-density=0.34 prefix-fanout=2.2 sequence=GGGTACTCCTTCTTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=158.77 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=8.2 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=24 prefix-density=0.39 prefix-fanout=2.2 sequence=GTGCCAGCAGCCGCGGTAA criterion=fanout-score sequence-density=0.21 sequence-density-rank=9 fanout-score=25.49 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=10.2 sequence=CAAGAAGGAGTACCC SRR18694370 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:08:38 Started mapping on | Dec 10 06:08:38 Finished on | Dec 10 06:10:05 Mapping speed, Million of reads per hour | 552.09 Number of input reads | 13342234 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 11796008 Uniquely mapped reads % | 88.41% Average mapped length | 294.42 Number of splices: Total | 11353299 Number of splices: Annotated (sjdb) | 10605901 Number of splices: GT/AG | 11197036 Number of splices: GC/AG | 129130 Number of splices: AT/AC | 5396 Number of splices: Non-canonical | 21737 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.26 Insertion rate per base | 0.01% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 449576 % of reads mapped to multiple loci | 3.37% Number of reads mapped to too many loci | 63288 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.75% % of reads unmapped: other | 4.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1096650 1096650 1096650 N_multimapping 449576 449576 449576 N_noFeature 888970 11444088 1032604 N_ambiguous 257026 1831 48794 UnstrandedReadsAssigned:10650012 PositiveStrandReadsAssigned:350089 NegativeStrandReadsAssigned:10714610 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694370 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694370-trimmed-pair1.fastq SRR18694370-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,342,234 reads, 11,006,334 reads pseudoaligned [quant] estimated average fragment length: 248.18 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52973 SRR18694370.ke.tsv 35125 SRR18694370.se.tsv 88098 total ==> SRR18694370.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 689.223 0 0 PNS24247 1044 796.82 43.4601 7.20556 PNS24249 1928 1680.82 31.7296 2.49391 PNS24246 1044 796.82 43.4601 7.20556 PNS24248 1044 796.82 43.4601 7.20556 PNS24244 1471 1223.82 95.8899 10.3512 PNS24243 293 99.0595 0 0 KQK14069 1603 1355.82 722.561 70.4059 KQK14071 474 245.57 12.4065 6.67436 ==> SRR18694370.se.tsv <== BRADI_1g14170v3 834 BRADI_1g53295v3 1051 BRADI_1g59795v3 410 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 248 BRADI_1g74790v3 176 BRADI_1g09890v3 0 BRADI_1g77505v3 101 BRADI_1g48960v3 0 SRR18694370 completed mapping pipeline successfully