Starting /dee2/code/volunteer_pipeline.sh SRR18694371 current disk space = 1525748199424 free memory = 1558189556 SRR18694371 SRAfilesize 899ca4283ce132e9a3c867cd2c22b4e6 SRR18694371.sra SRR18694371.sra file validated SRR18694371 is paired end SRR18694371 is conventional basespace SRR18694371 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694371_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0585 37.0 37.0 37.0 37.0 37.0 2 35.94575 37.0 37.0 37.0 37.0 37.0 3 36.4185 37.0 37.0 37.0 37.0 37.0 4 36.4975 37.0 37.0 37.0 37.0 37.0 5 36.5295 37.0 37.0 37.0 37.0 37.0 6 36.446 37.0 37.0 37.0 37.0 37.0 7 36.4965 37.0 37.0 37.0 37.0 37.0 8 36.5855 37.0 37.0 37.0 37.0 37.0 9 36.6845 37.0 37.0 37.0 37.0 37.0 10-14 36.6275 37.0 37.0 37.0 37.0 37.0 15-19 36.634100000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.6423 37.0 37.0 37.0 37.0 37.0 25-29 36.571600000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.532799999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.631600000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.6115 37.0 37.0 37.0 37.0 37.0 45-49 36.4272 37.0 37.0 37.0 37.0 37.0 50-54 36.5376 37.0 37.0 37.0 37.0 37.0 55-59 36.4751 37.0 37.0 37.0 37.0 37.0 60-64 36.521100000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.268499999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3939 37.0 37.0 37.0 37.0 37.0 75-79 36.5095 37.0 37.0 37.0 37.0 37.0 80-84 36.401599999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.2056 37.0 37.0 37.0 37.0 37.0 90-94 35.353300000000004 37.0 37.0 37.0 29.8 37.0 95-99 36.153 37.0 37.0 37.0 37.0 37.0 100-104 36.189299999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.205 37.0 37.0 37.0 37.0 37.0 110-114 36.211499999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.495000000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.5497 37.0 37.0 37.0 37.0 37.0 125-129 36.52040000000001 37.0 37.0 37.0 37.0 37.0 130-134 36.501400000000004 37.0 37.0 37.0 37.0 37.0 135-139 36.4113 37.0 37.0 37.0 37.0 37.0 140-144 36.24329999999999 37.0 37.0 37.0 37.0 37.0 145-149 36.16589999999999 37.0 37.0 37.0 37.0 37.0 150-151 33.7675 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 0.0 25 1.0 26 3.0 27 3.0 28 3.0 29 4.0 30 9.0 31 15.0 32 29.0 33 63.0 34 93.0 35 340.0 36 3245.0 37 191.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.199999999999996 10.5 4.3 37.0 2 21.78168130489335 9.98745294855709 36.03513174404015 32.19573400250941 3 19.875 13.25 25.525 41.349999999999994 4 26.35 20.225 21.7 31.724999999999998 5 26.650000000000002 27.825 23.575 21.95 6 23.849999999999998 31.125000000000004 22.35 22.675 7 18.075 24.275 40.050000000000004 17.599999999999998 8 19.8 23.625 30.9 25.674999999999997 9 19.45 19.55 34.575 26.424999999999997 10-14 23.119999999999997 26.284999999999997 25.695 24.9 15-19 23.34 24.07 26.185000000000002 26.405 20-24 23.345 24.945 26.375 25.335 25-29 23.815 25.05 25.15 25.985000000000003 30-34 22.770000000000003 24.81 25.945 26.474999999999998 35-39 23.080000000000002 25.135 25.790000000000003 25.995 40-44 23.835 25.130000000000003 25.585 25.45 45-49 23.135 24.77 25.56 26.534999999999997 50-54 23.46 24.29 25.669999999999998 26.58 55-59 23.515 24.43 25.88 26.174999999999997 60-64 22.939999999999998 24.645 26.029999999999998 26.384999999999998 65-69 23.085 24.44 26.029999999999998 26.445 70-74 23.549999999999997 25.09 25.569999999999997 25.790000000000003 75-79 24.055 24.82 25.330000000000002 25.795 80-84 23.48 25.105 25.28 26.135 85-89 24.395 25.064999999999998 24.759999999999998 25.779999999999998 90-94 23.74 25.605 24.715 25.94 95-99 23.655 24.305 25.695 26.345000000000002 100-104 24.05 25.165 25.040000000000003 25.745 105-109 24.035 25.06 24.46 26.445 110-114 23.9 24.9 25.779999999999998 25.419999999999998 115-119 24.3 24.785 24.779999999999998 26.135 120-124 24.29 25.2 24.535 25.974999999999998 125-129 24.425 23.71 25.264999999999997 26.6 130-134 23.955000000000002 25.405 24.73 25.91 135-139 24.11 24.779999999999998 24.795 26.314999999999998 140-144 24.39 25.695 24.635 25.28 145-149 24.315 24.98 24.42 26.284999999999997 150-151 23.9 24.325 25.4625 26.3125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 1.0 25 1.5 26 1.5 27 3.0 28 6.0 29 7.0 30 7.5 31 7.5 32 12.0 33 21.5 34 28.5 35 36.0 36 45.0 37 66.5 38 87.5 39 100.5 40 115.5 41 134.0 42 142.0 43 162.0 44 180.5 45 185.5 46 191.0 47 187.0 48 185.0 49 174.5 50 164.5 51 154.0 52 135.5 53 123.5 54 120.0 55 118.5 56 109.5 57 91.5 58 77.5 59 79.0 60 70.0 61 62.0 62 68.0 63 78.5 64 74.5 65 56.5 66 54.5 67 50.5 68 44.0 69 39.0 70 32.0 71 26.0 72 22.5 73 12.5 74 11.0 75 12.5 76 7.5 77 4.5 78 3.0 79 2.0 80 1.0 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.4 #Duplication Level Percentage of deduplicated Percentage of total 1 86.92129629629629 75.1 2 10.99537037037037 19.0 3 1.678240740740741 4.35 4 0.23148148148148145 0.8 5 0.1736111111111111 0.75 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGTGGTACTACTCCACACAACCGAGCTCGGCCTGGGTTAAGGAGTGATTC 5 0.125 No Hit GGCTCATAAGTTCTCTCTGCTCTTGCTTTCTTTTTTTCGCGCTGCAAGCG 5 0.125 No Hit GTTCTTATCTGATCCGTGCAAGTGAGATTCCACACTTCCATTTGGAACCA 5 0.125 No Hit CGGAAATCCACGTCATAATCACAGGCACGCATGCACGAAGGGTGGCGAAG 5 0.125 No Hit GTCCGAGACCATGGAAATGCAAATATTGTTCTGTCAGTTTCTCAGCCCAA 5 0.125 No Hit GGTACATGTTGCAGCCGTTGCAGCCGCTGCCGCACTTGCAGGATGACCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.2374999999999998 0.0 0.0 0.0 0.0 104-105 1.625 0.0 0.0 0.0 0.0 106-107 1.8125 0.0 0.0 0.0 0.0 108-109 2.1375 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.75 0.0 0.0 0.0 0.0 114-115 3.1125 0.0 0.0 0.0 0.0 116-117 3.4875 0.0 0.0 0.0 0.0 118-119 3.8125 0.0 0.0 0.0 0.0 120-121 4.112500000000001 0.0 0.0 0.0 0.0 122-123 4.6 0.0 0.0 0.0 0.0 124-125 4.9625 0.0 0.0 0.0 0.0 126-127 5.5 0.0 0.0 0.0 0.0 128-129 6.0875 0.0 0.0 0.0 0.0 130-131 6.4375 0.0 0.0 0.0 0.0 132-133 6.85 0.0 0.0 0.0 0.0 134-135 7.512499999999999 0.0 0.0 0.0 0.0 136-137 8.287500000000001 0.0 0.0 0.0 0.0 138-139 8.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAGAT 10 0.006830828 145.0 3 >>END_MODULE SRR18694371 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694371_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.2715 37.0 37.0 37.0 25.0 37.0 2 34.9115 37.0 37.0 37.0 25.0 37.0 3 35.2205 37.0 37.0 37.0 25.0 37.0 4 35.271 37.0 37.0 37.0 25.0 37.0 5 35.2345 37.0 37.0 37.0 25.0 37.0 6 35.3285 37.0 37.0 37.0 25.0 37.0 7 35.2855 37.0 37.0 37.0 25.0 37.0 8 35.5205 37.0 37.0 37.0 37.0 37.0 9 35.597 37.0 37.0 37.0 37.0 37.0 10-14 35.5658 37.0 37.0 37.0 37.0 37.0 15-19 35.537400000000005 37.0 37.0 37.0 37.0 37.0 20-24 35.446299999999994 37.0 37.0 37.0 34.6 37.0 25-29 35.5655 37.0 37.0 37.0 32.2 37.0 30-34 35.7441 37.0 37.0 37.0 37.0 37.0 35-39 35.589299999999994 37.0 37.0 37.0 37.0 37.0 40-44 35.3779 37.0 37.0 37.0 32.2 37.0 45-49 35.541399999999996 37.0 37.0 37.0 37.0 37.0 50-54 34.9954 37.0 37.0 37.0 29.8 37.0 55-59 34.3678 37.0 37.0 37.0 25.0 37.0 60-64 35.02040000000001 37.0 37.0 37.0 27.4 37.0 65-69 34.1827 37.0 34.6 37.0 27.4 37.0 70-74 32.9639 37.0 29.8 37.0 22.2 37.0 75-79 33.5779 37.0 34.6 37.0 22.2 37.0 80-84 34.5487 37.0 37.0 37.0 25.0 37.0 85-89 32.6271 37.0 32.2 37.0 19.4 37.0 90-94 34.0402 37.0 37.0 37.0 25.0 37.0 95-99 33.9527 37.0 37.0 37.0 25.0 37.0 100-104 33.497 37.0 37.0 37.0 25.0 37.0 105-109 34.2307 37.0 37.0 37.0 25.0 37.0 110-114 34.49830000000001 37.0 37.0 37.0 25.0 37.0 115-119 34.4649 37.0 37.0 37.0 25.0 37.0 120-124 34.173199999999994 37.0 37.0 37.0 25.0 37.0 125-129 34.0532 37.0 37.0 37.0 25.0 37.0 130-134 33.755199999999995 37.0 34.6 37.0 25.0 37.0 135-139 32.2279 37.0 27.4 37.0 13.8 37.0 140-144 31.4997 37.0 25.0 37.0 11.0 37.0 145-149 31.177000000000003 37.0 25.0 37.0 11.0 37.0 150-151 30.8215 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 4.0 18 2.0 19 5.0 20 5.0 21 1.0 22 5.0 23 4.0 24 9.0 25 7.0 26 11.0 27 15.0 28 25.0 29 44.0 30 82.0 31 137.0 32 253.0 33 568.0 34 1171.0 35 1442.0 36 208.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.75 21.224999999999998 7.124999999999999 26.900000000000002 2 30.075000000000003 21.725 29.225 18.975 3 22.425 25.7 27.55 24.325 4 27.575 30.425 19.55 22.45 5 28.875 34.125 17.474999999999998 19.525000000000002 6 23.75 37.3 16.7 22.25 7 25.55 20.599999999999998 32.125 21.725 8 23.875 23.5 24.575 28.050000000000004 9 25.025 21.325 27.075 26.575 10-14 26.83 25.7 22.875 24.595 15-19 26.14 25.35 24.05 24.46 20-24 26.43 25.805 23.625 24.14 25-29 26.125 24.98 24.13 24.765 30-34 26.205000000000002 24.79 24.2 24.805 35-39 26.900000000000002 25.06 23.73 24.310000000000002 40-44 25.985000000000003 25.230000000000004 24.33 24.455 45-49 25.935000000000002 25.395 24.385 24.285 50-54 24.834999999999997 25.46 24.98 24.725 55-59 25.575 25.985000000000003 23.61 24.83 60-64 26.93 24.2 24.66 24.21 65-69 26.575 25.230000000000004 24.099999999999998 24.095 70-74 26.950000000000003 24.805 23.91 24.335 75-79 27.229999999999997 23.895 24.58 24.295 80-84 26.590000000000003 25.305 24.18 23.925 85-89 23.745 27.67 24.415 24.169999999999998 90-94 26.945000000000004 25.474999999999998 24.060000000000002 23.52 95-99 25.814999999999998 25.369999999999997 24.25 24.565 100-104 26.05 25.990000000000002 23.49 24.47 105-109 26.41 25.765 24.57 23.255 110-114 26.545 26.534999999999997 23.555 23.365 115-119 27.1 25.405 23.875 23.62 120-124 27.284999999999997 25.419999999999998 24.15 23.145 125-129 25.75 25.53 24.59 24.13 130-134 27.255000000000003 24.795 24.095 23.855 135-139 26.784999999999997 26.355 23.745 23.115 140-144 28.075 25.505 23.66 22.759999999999998 145-149 27.395000000000003 25.94 23.835 22.830000000000002 150-151 26.2125 25.4375 26.2875 22.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 0.0 24 0.5 25 1.0 26 2.0 27 2.0 28 1.0 29 3.0 30 7.5 31 11.0 32 16.0 33 18.0 34 21.5 35 30.5 36 44.0 37 58.5 38 77.5 39 102.0 40 122.5 41 140.5 42 152.5 43 165.5 44 176.5 45 175.0 46 168.0 47 182.5 48 171.0 49 146.0 50 139.0 51 134.0 52 127.5 53 127.5 54 116.0 55 96.0 56 95.0 57 100.0 58 102.0 59 84.5 60 83.5 61 83.5 62 83.5 63 80.0 64 65.5 65 63.0 66 58.0 67 62.0 68 70.5 69 53.0 70 32.5 71 33.0 72 31.0 73 20.0 74 14.5 75 12.5 76 10.5 77 7.0 78 3.5 79 2.0 80 2.5 81 3.0 82 1.0 83 0.0 84 0.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 1.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.875 #Duplication Level Percentage of deduplicated Percentage of total 1 88.62019914651493 77.875 2 9.41678520625889 16.55 3 1.6785206258890468 4.425 4 0.1422475106685633 0.5 5 0.11379800853485066 0.5 6 0.028449502133712664 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCT 6 0.15 No Hit GTCAAGTTTGAGAAATATGGACCGGACAGGAAAAAGGTAAGCGTTTACCC 5 0.125 No Hit CAGCAAGGAACCCGGGAATTTTTGGCTGAGGTTGAAATGCTTAGCCGATT 5 0.125 No Hit GAAGCACATGAACTCCAACCGAGGTTCATACCAGTATGTAAACCCAAACC 5 0.125 No Hit TGCAAAATGGTCAGCGCCAATTAACTGGGAACGGAGGGAGTAGCTTTTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.7374999999999998 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.2875 0.0 0.0 0.0 0.0 112-113 2.675 0.0 0.0 0.0 0.0 114-115 3.0374999999999996 0.0 0.0 0.0 0.0 116-117 3.4125 0.0 0.0 0.0 0.0 118-119 3.7375 0.0 0.0 0.0 0.0 120-121 4.0375 0.0 0.0 0.0 0.0 122-123 4.525 0.0 0.0 0.0 0.0 124-125 4.9125 0.0 0.0 0.0 0.0 126-127 5.449999999999999 0.0 0.0 0.0 0.0 128-129 6.0375 0.0 0.0 0.0 0.0 130-131 6.4125 0.0 0.0 0.0 0.0 132-133 6.824999999999999 0.0 0.0 0.0 0.0 134-135 7.512499999999999 0.0 0.0 0.0 0.0 136-137 8.287500000000001 0.0 0.0 0.0 0.0 138-139 8.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 556120 spots for SRR18694371.sra Written 556120 spots for SRR18694371.sra Read 556120 spots for SRR18694371.sra Written 556120 spots for SRR18694371.sra Read 556120 spots for SRR18694371.sra Written 556120 spots for SRR18694371.sra Read 556120 spots for SRR18694371.sra Written 556120 spots for SRR18694371.sra Read 556120 spots for SRR18694371.sra Written 556120 spots for SRR18694371.sra Read 556120 spots for SRR18694371.sra Written 556120 spots for SRR18694371.sra Read 556120 spots for SRR18694371.sra Written 556120 spots for SRR18694371.sra Read 556120 spots for SRR18694371.sra Written 556120 spots for SRR18694371.sra Read 556120 spots for SRR18694371.sra Written 556120 spots for SRR18694371.sra Read 556120 spots for SRR18694371.sra Written 556120 spots for SRR18694371.sra Read 556120 spots for SRR18694371.sra Written 556120 spots for SRR18694371.sra Read 556120 spots for SRR18694371.sra Written 556120 spots for SRR18694371.sra Read 556120 spots for SRR18694371.sra Written 556120 spots for SRR18694371.sra Read 556120 spots for SRR18694371.sra Written 556120 spots for SRR18694371.sra Read 556120 spots for SRR18694371.sra Written 556120 spots for SRR18694371.sra Read 556120 spots for SRR18694371.sra Written 556120 spots for SRR18694371.sra Read 556129 spots for SRR18694371.sra Written 556129 spots for SRR18694371.sra Read 556120 spots for SRR18694371.sra Written 556120 spots for SRR18694371.sra Read 556120 spots for SRR18694371.sra Written 556120 spots for SRR18694371.sra Read 556120 spots for SRR18694371.sra Written 556120 spots for SRR18694371.sra SRR ids: ['SRR18694371.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rmiilkk_ SRR18694371.sra spots: 11122409 blocks: [[1, 556120], [556121, 1112240], [1112241, 1668360], [1668361, 2224480], [2224481, 2780600], [2780601, 3336720], [3336721, 3892840], [3892841, 4448960], [4448961, 5005080], [5005081, 5561200], [5561201, 6117320], [6117321, 6673440], [6673441, 7229560], [7229561, 7785680], [7785681, 8341800], [8341801, 8897920], [8897921, 9454040], [9454041, 10010160], [10010161, 10566280], [10566281, 11122409]] SRR18694371 file size 3758180 SRR18694371 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694371 SRR18694371_1.fastq SRR18694371_2.fastq Input file: SRR18694371_1.fastq Paired file: SRR18694371_2.fastq trimmed: SRR18694371-trimmed-pair1.fastq, SRR18694371-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:06:37 2024 >> started Tue Dec 10 06:06:50 2024 >> done (13.108s) 11122409 read pairs processed; of these: 127 ( 0.00%) short read pairs filtered out after trimming by size control 766 ( 0.01%) empty read pairs filtered out after trimming by size control 11121516 (99.99%) read pairs available; of these: 1459417 (13.12%) trimmed read pairs available after processing 9662099 (86.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 10 0.00% 20 14 0.00% 21 11 0.00% 22 14 0.00% 23 18 0.00% 24 10 0.00% 25 20 0.00% 26 17 0.00% 27 27 0.00% 28 27 0.00% 29 22 0.00% 30 23 0.00% 31 19 0.00% 32 28 0.00% 33 27 0.00% 34 32 0.00% 35 26 0.00% 36 33 0.00% 37 34 0.00% 38 39 0.00% 39 34 0.00% 40 48 0.00% 41 47 0.00% 42 53 0.00% 43 55 0.00% 44 57 0.00% 45 39 0.00% 46 57 0.00% 47 31 0.00% 48 54 0.00% 49 90 0.00% 50 72 0.00% 51 83 0.00% 52 100 0.00% 53 93 0.00% 54 82 0.00% 55 123 0.00% 56 198 0.00% 57 137 0.00% 58 146 0.00% 59 226 0.00% 60 219 0.00% 61 260 0.00% 62 306 0.00% 63 312 0.00% 64 339 0.00% 65 379 0.00% 66 424 0.00% 67 486 0.00% 68 606 0.01% 69 680 0.01% 70 687 0.01% 71 846 0.01% 72 1006 0.01% 73 1145 0.01% 74 1222 0.01% 75 1402 0.01% 76 1502 0.01% 77 1773 0.02% 78 1762 0.02% 79 2113 0.02% 80 2285 0.02% 81 2508 0.02% 82 2935 0.03% 83 3150 0.03% 84 3396 0.03% 85 3848 0.03% 86 4141 0.04% 87 4269 0.04% 88 4868 0.04% 89 5219 0.05% 90 5676 0.05% 91 6228 0.06% 92 6638 0.06% 93 7064 0.06% 94 7346 0.07% 95 7887 0.07% 96 8523 0.08% 97 8991 0.08% 98 9089 0.08% 99 9498 0.09% 100 10339 0.09% 101 11055 0.10% 102 11419 0.10% 103 12062 0.11% 104 12714 0.11% 105 13063 0.12% 106 13463 0.12% 107 14118 0.13% 108 14814 0.13% 109 15221 0.14% 110 15901 0.14% 111 16536 0.15% 112 17948 0.16% 113 18264 0.16% 114 18503 0.17% 115 19941 0.18% 116 19759 0.18% 117 20963 0.19% 118 20828 0.19% 119 21835 0.20% 120 22927 0.21% 121 23387 0.21% 122 23725 0.21% 123 24726 0.22% 124 25982 0.23% 125 26441 0.24% 126 26733 0.24% 127 26974 0.24% 128 28063 0.25% 129 28507 0.26% 130 29152 0.26% 131 29827 0.27% 132 30251 0.27% 133 31893 0.29% 134 31960 0.29% 135 32537 0.29% 136 33744 0.30% 137 34097 0.31% 138 34333 0.31% 139 35229 0.32% 140 35703 0.32% 141 36061 0.32% 142 37170 0.33% 143 37709 0.34% 144 38593 0.35% 145 39317 0.35% 146 39542 0.36% 147 40434 0.36% 148 40899 0.37% 149 40534 0.36% 150 40908 0.37% 151 9662099 86.88% 11121516 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=6.47 fanout-score-rank=9 prefix-density=0.41 prefix-fanout=5.2 sequence=TGATGGTCTTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=57.53 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.0 sequence=CATTTCTTTGTATTCAGAAACTTACAATTCAAATCGTTTACCTGTGCGGCGATGAATCAAAAAAGGTACGGAATTTTCCAAACATGCATATATAGTGACGGCATTCTTAATTACTAGAATCAAGTGGCCTTGGCGTAGAAGGACCCGGTCTTCATGGCGTCGTCGTTGGCTTCACCCAGTGCAGCCTCACTGAGGTACTTGTCTGCAAGCTGCACCCTCTTCACGTTCTCCTGCTCCTGGACAAGCATGTGCCCATACTCCATGAGCTTACTGATTGTCATCTTCGGCTGCTCGAACTTGGGCGGGCCCTCCTTCGAGTTCACCAGCCTCTTGGAAATGTTCTCCACACCGATTTCCCCGACCCATTTCCGCACCTCGTCATCGTAAACCCTGGCACGCAGCGCGCCGAAGAAGTCGATGCTCTGCCCCGGGAACATGTCGACGAGCCTAACCACCGCCTCGTCGGGGACGCCATCGGTGCGGAAAATGCCCTTGCACACGCCAATGCGGT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=32 prefix-density=0.32 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=156.25 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.5 sequence=GTGCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGAGATTTGGAAGATGTCTTGCAGCTGTGGATCAAGCTGCAACTGTGGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGCCAGCACCACCAGCAGCACCCAGGCCCAGGTGGTGGTTCTCGGCATGGCGCCGGAGAAG SRR18694371 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:07:37 Started mapping on | Dec 10 06:07:37 Finished on | Dec 10 06:08:54 Mapping speed, Million of reads per hour | 519.97 Number of input reads | 11121516 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 10079333 Uniquely mapped reads % | 90.63% Average mapped length | 294.11 Number of splices: Total | 9520324 Number of splices: Annotated (sjdb) | 8884520 Number of splices: GT/AG | 9389871 Number of splices: GC/AG | 106768 Number of splices: AT/AC | 4925 Number of splices: Non-canonical | 18760 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.01% Deletion average length | 2.45 Insertion rate per base | 0.01% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299120 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 46437 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 3.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 743063 743063 743063 N_multimapping 299120 299120 299120 N_noFeature 695782 9772658 826956 N_ambiguous 215377 1559 39833 UnstrandedReadsAssigned:9168174 PositiveStrandReadsAssigned:305116 NegativeStrandReadsAssigned:9212544 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694371 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694371-trimmed-pair1.fastq SRR18694371-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,121,516 reads, 9,385,306 reads pseudoaligned [quant] estimated average fragment length: 250.188 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52973 SRR18694371.ke.tsv 35125 SRR18694371.se.tsv 88098 total ==> SRR18694371.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 687.201 0 0 PNS24247 1044 794.812 39.7958 7.80577 PNS24249 1928 1678.81 49.3256 4.58051 PNS24246 1044 794.812 39.7958 7.80577 PNS24248 1044 794.812 39.7958 7.80577 PNS24244 1471 1221.81 60.2869 7.69239 PNS24243 293 99.7457 0 0 KQK14069 1603 1353.81 1315.2 151.453 KQK14071 474 244.788 4.41258 2.81025 ==> SRR18694371.se.tsv <== BRADI_1g14170v3 1379 BRADI_1g53295v3 874 BRADI_1g59795v3 337 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 139 BRADI_1g74790v3 188 BRADI_1g09890v3 0 BRADI_1g77505v3 106 BRADI_1g48960v3 0 SRR18694371 completed mapping pipeline successfully