Starting /dee2/code/volunteer_pipeline.sh SRR18694372 current disk space = 1525709516800 free memory = 1602385716 SRR18694372 SRAfilesize 83f90374c86a66022f724289278a57d6 SRR18694372.sra SRR18694372.sra file validated SRR18694372 is paired end SRR18694372 is conventional basespace SRR18694372 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694372_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0835 37.0 37.0 37.0 37.0 37.0 2 35.9745 37.0 37.0 37.0 37.0 37.0 3 36.49 37.0 37.0 37.0 37.0 37.0 4 36.5185 37.0 37.0 37.0 37.0 37.0 5 36.6355 37.0 37.0 37.0 37.0 37.0 6 36.622 37.0 37.0 37.0 37.0 37.0 7 36.552 37.0 37.0 37.0 37.0 37.0 8 36.6015 37.0 37.0 37.0 37.0 37.0 9 36.69 37.0 37.0 37.0 37.0 37.0 10-14 36.659800000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.6215 37.0 37.0 37.0 37.0 37.0 20-24 36.6137 37.0 37.0 37.0 37.0 37.0 25-29 36.5544 37.0 37.0 37.0 37.0 37.0 30-34 36.540800000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.659000000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.625899999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.418600000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.5241 37.0 37.0 37.0 37.0 37.0 55-59 36.531099999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.5161 37.0 37.0 37.0 37.0 37.0 65-69 36.3077 37.0 37.0 37.0 37.0 37.0 70-74 36.458299999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.5239 37.0 37.0 37.0 37.0 37.0 80-84 36.4396 37.0 37.0 37.0 37.0 37.0 85-89 36.2162 37.0 37.0 37.0 37.0 37.0 90-94 35.393699999999995 37.0 37.0 37.0 29.8 37.0 95-99 36.2167 37.0 37.0 37.0 37.0 37.0 100-104 36.2057 37.0 37.0 37.0 37.0 37.0 105-109 36.233000000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.2716 37.0 37.0 37.0 37.0 37.0 115-119 36.5421 37.0 37.0 37.0 37.0 37.0 120-124 36.6329 37.0 37.0 37.0 37.0 37.0 125-129 36.5699 37.0 37.0 37.0 37.0 37.0 130-134 36.613 37.0 37.0 37.0 37.0 37.0 135-139 36.4607 37.0 37.0 37.0 37.0 37.0 140-144 36.3039 37.0 37.0 37.0 37.0 37.0 145-149 36.2263 37.0 37.0 37.0 37.0 37.0 150-151 33.894 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 0.0 25 0.0 26 1.0 27 3.0 28 2.0 29 8.0 30 6.0 31 11.0 32 25.0 33 42.0 34 97.0 35 354.0 36 3261.0 37 189.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.725 9.8 4.8 43.675000000000004 2 19.949748743718594 10.100502512562814 39.54773869346734 30.402010050251256 3 18.224999999999998 14.575 27.200000000000003 40.0 4 25.674999999999997 20.45 21.95 31.924999999999997 5 26.55 27.0 23.025000000000002 23.425 6 22.95 30.525000000000002 23.400000000000002 23.125 7 17.325 24.075 40.775 17.825 8 18.55 21.575 34.425 25.45 9 19.625 19.375 36.325 24.675 10-14 22.085 26.32 27.295 24.3 15-19 22.675 24.73 27.255000000000003 25.34 20-24 22.295 26.090000000000003 26.775 24.84 25-29 22.27 25.485000000000003 26.765 25.480000000000004 30-34 22.805 26.0 25.295 25.900000000000002 35-39 22.85 25.3 25.94 25.91 40-44 22.439999999999998 26.174999999999997 25.77 25.615 45-49 22.64 25.41 26.25 25.7 50-54 22.705000000000002 25.77 25.669999999999998 25.855 55-59 21.765 25.264999999999997 26.745 26.224999999999998 60-64 22.175 25.185000000000002 26.46 26.179999999999996 65-69 22.715 25.814999999999998 26.174999999999997 25.295 70-74 22.425 26.085 25.405 26.085 75-79 23.005 26.08 25.629999999999995 25.285000000000004 80-84 22.735 24.95 26.015 26.3 85-89 22.485 25.355 25.715 26.445 90-94 22.28 25.990000000000002 26.265 25.465 95-99 22.689999999999998 25.415 26.83 25.064999999999998 100-104 22.645 25.05 26.619999999999997 25.685000000000002 105-109 22.665 25.805 25.740000000000002 25.790000000000003 110-114 22.13 25.745 26.105 26.02 115-119 23.135 25.785000000000004 26.02 25.06 120-124 23.200000000000003 25.085 26.090000000000003 25.624999999999996 125-129 23.200000000000003 25.805 25.019999999999996 25.974999999999998 130-134 22.84 26.115 24.990000000000002 26.055 135-139 23.549999999999997 25.97 25.35 25.130000000000003 140-144 22.85 26.009999999999998 25.005 26.135 145-149 23.695 26.63 24.27 25.405 150-151 22.662499999999998 27.975 25.1875 24.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 1.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 4.0 26 4.5 27 1.5 28 3.0 29 5.0 30 8.5 31 10.5 32 11.5 33 16.5 34 19.0 35 26.0 36 50.5 37 64.0 38 74.0 39 88.5 40 101.5 41 141.5 42 170.5 43 184.0 44 189.0 45 188.5 46 207.5 47 224.0 48 222.5 49 205.0 50 195.0 51 192.5 52 186.0 53 161.5 54 125.5 55 124.5 56 121.0 57 100.5 58 85.0 59 62.0 60 56.5 61 69.0 62 57.0 63 41.5 64 43.0 65 40.5 66 33.0 67 25.0 68 17.5 69 7.5 70 8.5 71 8.0 72 3.5 73 2.5 74 1.0 75 1.0 76 1.5 77 1.0 78 0.0 79 2.0 80 2.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.275 #Duplication Level Percentage of deduplicated Percentage of total 1 85.84989617324236 72.35000000000001 2 11.005636309700385 18.55 3 2.135864728567191 5.4 4 0.7416196974191634 2.5 5 0.23731830317413233 1.0 6 0.0 0.0 7 0.0 0.0 8 0.02966478789676654 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAGGCTATA 8 0.2 No Hit CATTGCTGTTGTCCACTGGGCCATGATCAACGGCTGTTCTCAAAGAATAT 5 0.125 No Hit GCACCAACATCATCAGCAAACTCGATGAAAGCAAAACGCATCACTGAATT 5 0.125 No Hit CCTGCGTTATCTTTTAACAGATGTGCCGCCCCAGCCAAACTCCCCACCTG 5 0.125 No Hit CTTGTGCTCCTCATCCTCAGACTTGTACTTCTCAGCATCCTGAACCATCT 5 0.125 No Hit AGCACGTACCATCAAACAAACTATAACTGATTTAATGAGCCATTCGCAGT 5 0.125 No Hit GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 5 0.125 No Hit CCTTAGGATCATCACGTGGGCCTATGCGGCCATCATCAATGGCCTCAGCT 5 0.125 No Hit CATCAATGTCGAAGCAGACAGTGATCTGAGGAACACCCCTGGGAGCAGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0125000000000002 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.2999999999999998 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.6125 0.0 0.0 0.0 0.0 112-113 1.9 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.6875 0.0 0.0 0.0 0.0 118-119 3.1375 0.0 0.0 0.0 0.0 120-121 3.4 0.0 0.0 0.0 0.0 122-123 3.7125 0.0 0.0 0.0 0.0 124-125 3.9000000000000004 0.0 0.0 0.0 0.0 126-127 4.275 0.0 0.0 0.0 0.0 128-129 4.7625 0.0 0.0 0.0 0.0 130-131 5.2125 0.0 0.0 0.0 0.0 132-133 5.575 0.0 0.0 0.0 0.0 134-135 5.9125 0.0 0.0 0.0 0.0 136-137 6.4625 0.0 0.0 0.0 0.0 138-139 6.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAAGGA 10 0.006830828 145.0 9 >>END_MODULE SRR18694372 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694372_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.2965 37.0 37.0 37.0 25.0 37.0 2 35.059 37.0 37.0 37.0 25.0 37.0 3 35.008 37.0 37.0 37.0 25.0 37.0 4 35.271 37.0 37.0 37.0 25.0 37.0 5 35.139 37.0 37.0 37.0 25.0 37.0 6 35.346 37.0 37.0 37.0 25.0 37.0 7 35.334 37.0 37.0 37.0 25.0 37.0 8 35.644 37.0 37.0 37.0 37.0 37.0 9 35.558 37.0 37.0 37.0 37.0 37.0 10-14 35.504200000000004 37.0 37.0 37.0 37.0 37.0 15-19 35.662099999999995 37.0 37.0 37.0 37.0 37.0 20-24 35.4788 37.0 37.0 37.0 34.6 37.0 25-29 35.6014 37.0 37.0 37.0 32.2 37.0 30-34 35.8584 37.0 37.0 37.0 37.0 37.0 35-39 35.7051 37.0 37.0 37.0 37.0 37.0 40-44 35.39569999999999 37.0 37.0 37.0 29.8 37.0 45-49 35.5821 37.0 37.0 37.0 37.0 37.0 50-54 35.0731 37.0 37.0 37.0 32.2 37.0 55-59 34.2244 37.0 37.0 37.0 25.0 37.0 60-64 35.1315 37.0 37.0 37.0 27.4 37.0 65-69 34.3005 37.0 34.6 37.0 27.4 37.0 70-74 33.049 37.0 29.8 37.0 22.2 37.0 75-79 33.6591 37.0 34.6 37.0 22.2 37.0 80-84 34.6681 37.0 37.0 37.0 25.0 37.0 85-89 32.54449999999999 37.0 32.2 37.0 19.4 37.0 90-94 34.2078 37.0 37.0 37.0 25.0 37.0 95-99 33.9639 37.0 37.0 37.0 25.0 37.0 100-104 33.4488 37.0 37.0 37.0 25.0 37.0 105-109 34.297700000000006 37.0 37.0 37.0 25.0 37.0 110-114 34.59080000000001 37.0 37.0 37.0 25.0 37.0 115-119 34.535700000000006 37.0 37.0 37.0 25.0 37.0 120-124 34.1232 37.0 37.0 37.0 25.0 37.0 125-129 34.0129 37.0 37.0 37.0 25.0 37.0 130-134 33.8152 37.0 37.0 37.0 25.0 37.0 135-139 32.237100000000005 37.0 27.4 37.0 13.8 37.0 140-144 31.720999999999997 37.0 25.0 37.0 11.0 37.0 145-149 31.226 37.0 25.0 37.0 11.0 37.0 150-151 31.022750000000002 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 4.0 19 2.0 20 1.0 21 2.0 22 3.0 23 5.0 24 4.0 25 6.0 26 10.0 27 14.0 28 23.0 29 48.0 30 75.0 31 140.0 32 257.0 33 569.0 34 1164.0 35 1480.0 36 192.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.15 18.425 7.75 31.674999999999997 2 28.999999999999996 23.225 29.549999999999997 18.224999999999998 3 20.525 25.275 30.275000000000002 23.925 4 26.75 30.325000000000003 20.75 22.175 5 28.1 33.6 19.15 19.15 6 22.6 36.0 19.8 21.6 7 22.875 21.349999999999998 34.125 21.65 8 22.8 23.075000000000003 26.075 28.050000000000004 9 22.5 20.625 31.225 25.650000000000002 10-14 25.27 27.365000000000002 23.865 23.5 15-19 25.840000000000003 26.145000000000003 24.335 23.68 20-24 25.855 26.400000000000002 24.555 23.189999999999998 25-29 25.97 25.89 25.240000000000002 22.900000000000002 30-34 26.16 26.02 25.064999999999998 22.755 35-39 25.014999999999997 26.169999999999998 25.045 23.77 40-44 25.415 25.965 24.91 23.71 45-49 25.31 25.695 25.729999999999997 23.265 50-54 24.349999999999998 26.215 26.185000000000002 23.25 55-59 25.509999999999998 26.645000000000003 25.16 22.685 60-64 26.245 26.305 24.08 23.369999999999997 65-69 26.31 26.26 24.83 22.6 70-74 25.974999999999998 26.179999999999996 24.92 22.925 75-79 26.505000000000003 24.695 26.32 22.48 80-84 26.845000000000002 24.735 25.885 22.535 85-89 23.705000000000002 28.444999999999997 25.11 22.74 90-94 25.590000000000003 26.384999999999998 25.180000000000003 22.845 95-99 26.16 26.19 25.224999999999998 22.425 100-104 25.905 26.724999999999998 24.995 22.375 105-109 26.095000000000002 25.69 25.5 22.715 110-114 25.89 26.505000000000003 25.21 22.395 115-119 25.629999999999995 25.919999999999998 25.264999999999997 23.185 120-124 25.624999999999996 26.275 25.679999999999996 22.42 125-129 26.115 26.155 25.66 22.07 130-134 26.295 26.400000000000002 24.955 22.35 135-139 26.27 26.729999999999997 25.25 21.75 140-144 26.305 26.83 24.895 21.97 145-149 27.07 26.735 24.675 21.52 150-151 25.112499999999997 27.287499999999998 26.137500000000003 21.462500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.0 24 2.5 25 3.0 26 3.5 27 7.0 28 7.0 29 5.0 30 5.5 31 10.0 32 14.0 33 13.5 34 26.0 35 35.5 36 39.0 37 56.5 38 74.0 39 99.5 40 122.0 41 129.5 42 165.0 43 179.5 44 176.0 45 191.5 46 194.5 47 190.0 48 200.5 49 208.5 50 189.5 51 184.0 52 175.0 53 153.0 54 142.5 55 125.5 56 117.5 57 98.5 58 81.5 59 83.0 60 71.0 61 60.0 62 51.5 63 45.0 64 45.5 65 54.5 66 43.5 67 28.5 68 24.5 69 16.0 70 12.0 71 12.0 72 10.0 73 4.5 74 2.0 75 1.5 76 1.5 77 2.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.925 #Duplication Level Percentage of deduplicated Percentage of total 1 87.54727960430608 75.225 2 9.863252836776258 16.950000000000003 3 1.862089031131801 4.8 4 0.3782368344486471 1.3 5 0.2618562700029095 1.125 6 0.02909514111143439 0.15 7 0.0 0.0 8 0.02909514111143439 0.2 9 0.0 0.0 >10 0.02909514111143439 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 10 0.25 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 8 0.2 No Hit GCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATT 6 0.15 No Hit GTTTGATCCTGGCTCAGATTGAACGCTGGCGGCATGCCTTACACATGCAA 5 0.125 No Hit GCCACGGCGAACTGATAGGGAGGATAGTGTGCGGAGAACTGTCTATGTTT 5 0.125 No Hit GAGAAGGTGCAGGACCTTCTCCTCCTTGATGTGACTCCACTGTCTCTTGG 5 0.125 No Hit GTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGG 5 0.125 No Hit GGACAAGACAACTGGCCAGAAGAACAAGATCACCATCACCAACGACAAGG 5 0.125 No Hit ACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGACACG 5 0.125 No Hit GTTCTGGGCCGCACGCGCGCTACACTGATGTATTCAACGAGTATATAGCC 5 0.125 No Hit CTCCTGTTGTCTCCTTCCGTGAGACTGTTCTTGAGAAGTCCAGCCGTACT 5 0.125 No Hit GCCCTTTGTACTTGACAAGGATCAATGCTGGGTCCTGGCTGAGAACCAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 0.9625 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.325 0.0 0.0 0.0 0.0 108-109 1.45 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.175 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 3.0625 0.0 0.0 0.0 0.0 120-121 3.325 0.0 0.0 0.0 0.0 122-123 3.6375 0.0 0.0 0.0 0.0 124-125 3.8875 0.0 0.0 0.0 0.0 126-127 4.325 0.0 0.0 0.0 0.0 128-129 4.824999999999999 0.0 0.0 0.0 0.0 130-131 5.3 0.0 0.0 0.0 0.0 132-133 5.675 0.0 0.0 0.0 0.0 134-135 6.012499999999999 0.0 0.0 0.0 0.0 136-137 6.55 0.0 0.0 0.0 0.0 138-139 6.987500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 687881 spots for SRR18694372.sra Written 687881 spots for SRR18694372.sra Read 687881 spots for SRR18694372.sra Written 687881 spots for SRR18694372.sra Read 687881 spots for SRR18694372.sra Written 687881 spots for SRR18694372.sra Read 687881 spots for SRR18694372.sra Written 687881 spots for SRR18694372.sra Read 687881 spots for SRR18694372.sra Written 687881 spots for SRR18694372.sra Read 687881 spots for SRR18694372.sra Written 687881 spots for SRR18694372.sra Read 687881 spots for SRR18694372.sra Written 687881 spots for SRR18694372.sra Read 687881 spots for SRR18694372.sra Written 687881 spots for SRR18694372.sra Read 687881 spots for SRR18694372.sra Written 687881 spots for SRR18694372.sra Read 687881 spots for SRR18694372.sra Written 687881 spots for SRR18694372.sra Read 687886 spots for SRR18694372.sra Written 687886 spots for SRR18694372.sra Read 687881 spots for SRR18694372.sra Written 687881 spots for SRR18694372.sra Read 687881 spots for SRR18694372.sra Written 687881 spots for SRR18694372.sra Read 687881 spots for SRR18694372.sra Written 687881 spots for SRR18694372.sra Read 687881 spots for SRR18694372.sra Written 687881 spots for SRR18694372.sra Read 687881 spots for SRR18694372.sra Written 687881 spots for SRR18694372.sra Read 687881 spots for SRR18694372.sra Written 687881 spots for SRR18694372.sra Read 687881 spots for SRR18694372.sra Written 687881 spots for SRR18694372.sra Read 687881 spots for SRR18694372.sra Written 687881 spots for SRR18694372.sra Read 687881 spots for SRR18694372.sra Written 687881 spots for SRR18694372.sra SRR ids: ['SRR18694372.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_66othb4m SRR18694372.sra spots: 13757625 blocks: [[1, 687881], [687882, 1375762], [1375763, 2063643], [2063644, 2751524], [2751525, 3439405], [3439406, 4127286], [4127287, 4815167], [4815168, 5503048], [5503049, 6190929], [6190930, 6878810], [6878811, 7566691], [7566692, 8254572], [8254573, 8942453], [8942454, 9630334], [9630335, 10318215], [10318216, 11006096], [11006097, 11693977], [11693978, 12381858], [12381859, 13069739], [13069740, 13757625]] SRR18694372 file size 4653742 SRR18694372 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694372 SRR18694372_1.fastq SRR18694372_2.fastq Input file: SRR18694372_1.fastq Paired file: SRR18694372_2.fastq trimmed: SRR18694372-trimmed-pair1.fastq, SRR18694372-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:09:28 2024 >> started Tue Dec 10 06:09:43 2024 >> done (14.891s) 13757625 read pairs processed; of these: 127 ( 0.00%) short read pairs filtered out after trimming by size control 977 ( 0.01%) empty read pairs filtered out after trimming by size control 13756521 (99.99%) read pairs available; of these: 1412146 (10.27%) trimmed read pairs available after processing 12344375 (89.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 10 0.00% 20 8 0.00% 21 16 0.00% 22 19 0.00% 23 12 0.00% 24 16 0.00% 25 18 0.00% 26 15 0.00% 27 32 0.00% 28 30 0.00% 29 32 0.00% 30 30 0.00% 31 30 0.00% 32 37 0.00% 33 22 0.00% 34 27 0.00% 35 32 0.00% 36 34 0.00% 37 30 0.00% 38 39 0.00% 39 41 0.00% 40 37 0.00% 41 67 0.00% 42 60 0.00% 43 40 0.00% 44 46 0.00% 45 34 0.00% 46 53 0.00% 47 63 0.00% 48 72 0.00% 49 79 0.00% 50 96 0.00% 51 84 0.00% 52 75 0.00% 53 122 0.00% 54 112 0.00% 55 128 0.00% 56 130 0.00% 57 156 0.00% 58 192 0.00% 59 228 0.00% 60 231 0.00% 61 222 0.00% 62 241 0.00% 63 246 0.00% 64 319 0.00% 65 376 0.00% 66 397 0.00% 67 420 0.00% 68 490 0.00% 69 497 0.00% 70 645 0.00% 71 733 0.01% 72 826 0.01% 73 926 0.01% 74 957 0.01% 75 1082 0.01% 76 1218 0.01% 77 1278 0.01% 78 1457 0.01% 79 1678 0.01% 80 1885 0.01% 81 2042 0.01% 82 2259 0.02% 83 2388 0.02% 84 2617 0.02% 85 3147 0.02% 86 3644 0.03% 87 3667 0.03% 88 4121 0.03% 89 4165 0.03% 90 4535 0.03% 91 4914 0.04% 92 5202 0.04% 93 5779 0.04% 94 6164 0.04% 95 6674 0.05% 96 7110 0.05% 97 7482 0.05% 98 7853 0.06% 99 8090 0.06% 100 8768 0.06% 101 8848 0.06% 102 9363 0.07% 103 9918 0.07% 104 10523 0.08% 105 11245 0.08% 106 11682 0.08% 107 12395 0.09% 108 12584 0.09% 109 13198 0.10% 110 13522 0.10% 111 14338 0.10% 112 15385 0.11% 113 15384 0.11% 114 16301 0.12% 115 17512 0.13% 116 17591 0.13% 117 18750 0.14% 118 19021 0.14% 119 19981 0.15% 120 21625 0.16% 121 20974 0.15% 122 22090 0.16% 123 23976 0.17% 124 24128 0.18% 125 24767 0.18% 126 25394 0.18% 127 26313 0.19% 128 27278 0.20% 129 28229 0.21% 130 28532 0.21% 131 29093 0.21% 132 30728 0.22% 133 30599 0.22% 134 30860 0.22% 135 32714 0.24% 136 33804 0.25% 137 34371 0.25% 138 34896 0.25% 139 36560 0.27% 140 37590 0.27% 141 37963 0.28% 142 38783 0.28% 143 39384 0.29% 144 41060 0.30% 145 40907 0.30% 146 41797 0.30% 147 44097 0.32% 148 44926 0.33% 149 46160 0.34% 150 45848 0.33% 151 12344375 89.73% 13756521 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=4.18 fanout-score-rank=23 prefix-density=0.21 prefix-fanout=3.6 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=35.48 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=1.2 sequence=CAAACTCCCCAGTGCAGAGAGCTTGATCAAATGTACCAATTACACACACAGACACACAGATACATACATACTCACAAGGAAGGATACACCAATTAAGAGCAAGTAAACAACAACACAATCACACCACACGCTCTGACTCGGCGCTTATTTACTAACCACAAGTTCATCATGATTAATGGACTAACAGTTACAAGGGTTGCACTTGCAGTTGTCGCCGCAGCTGCACCCTTCGCCGGACACGCCGGCCATCTCGAACTGCTCCTGTTTCTTCTCCGGCGCCATGCCGAGAACCACCACCTGGGCCTGGGTGCTGCTGGTGGTGCTGGCCTGCTCTGCCAGGTCTGGGTACATCTTCCCGCAAGTGCAGTTTGAGCCACAGTTGCAGCTTGATCCACAGCTGCAAGACATCTTCCAAATCTCTCTAACCTCAAGCTGATGAAATCAAGGAGGAGAATATGAAGAGCTTTGGTATTAAACAAGATGATGAGC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=28 prefix-density=0.27 prefix-fanout=2.6 sequence=CTGAACGCCTCTAAGTCAGAATCCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=136.79 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=9.5 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATG SRR18694372 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:10:49 Started mapping on | Dec 10 06:10:49 Finished on | Dec 10 06:16:30 Mapping speed, Million of reads per hour | 145.23 Number of input reads | 13756521 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 10053059 Uniquely mapped reads % | 73.08% Average mapped length | 295.86 Number of splices: Total | 11243605 Number of splices: Annotated (sjdb) | 10614423 Number of splices: GT/AG | 11097317 Number of splices: GC/AG | 122910 Number of splices: AT/AC | 7085 Number of splices: Non-canonical | 16293 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.38 Insertion rate per base | 0.01% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 130153 % of reads mapped to multiple loci | 0.95% Number of reads mapped to too many loci | 144457 % of reads mapped to too many loci | 1.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.52% % of reads unmapped: other | 12.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3573309 3573309 3573309 N_multimapping 130153 130153 130153 N_noFeature 363597 9800920 437559 N_ambiguous 211132 1213 33522 UnstrandedReadsAssigned:9478330 PositiveStrandReadsAssigned:250926 NegativeStrandReadsAssigned:9581978 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694372 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694372-trimmed-pair1.fastq SRR18694372-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,756,521 reads, 9,788,231 reads pseudoaligned [quant] estimated average fragment length: 256.297 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52973 SRR18694372.ke.tsv 35125 SRR18694372.se.tsv 88098 total ==> SRR18694372.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 681.229 0 0 PNS24247 1044 788.703 52.773 10.766 PNS24249 1928 1672.7 43.5584 4.18997 PNS24246 1044 788.703 52.773 10.766 PNS24248 1044 788.703 52.773 10.766 PNS24244 1471 1215.7 93.1226 12.3249 PNS24243 293 93.4935 0 0 KQK14069 1603 1347.7 1818.03 217.052 KQK14071 474 238.858 19.8138 13.3471 ==> SRR18694372.se.tsv <== BRADI_1g14170v3 2046 BRADI_1g53295v3 55 BRADI_1g59795v3 200 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 226 BRADI_1g74790v3 199 BRADI_1g09890v3 0 BRADI_1g77505v3 64 BRADI_1g48960v3 0 SRR18694372 completed mapping pipeline successfully