Starting /dee2/code/volunteer_pipeline.sh SRR18694373 current disk space = 1525668020224 free memory = 1599194304 SRR18694373 SRAfilesize b4105d5fda4667fa9f5985e62a2cc35b SRR18694373.sra SRR18694373.sra file validated SRR18694373 is paired end SRR18694373 is conventional basespace SRR18694373 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694373_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.094 37.0 37.0 37.0 37.0 37.0 2 36.01625 37.0 37.0 37.0 37.0 37.0 3 36.4465 37.0 37.0 37.0 37.0 37.0 4 36.4755 37.0 37.0 37.0 37.0 37.0 5 36.531 37.0 37.0 37.0 37.0 37.0 6 36.438 37.0 37.0 37.0 37.0 37.0 7 36.495 37.0 37.0 37.0 37.0 37.0 8 36.5555 37.0 37.0 37.0 37.0 37.0 9 36.644 37.0 37.0 37.0 37.0 37.0 10-14 36.591499999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.6248 37.0 37.0 37.0 37.0 37.0 20-24 36.5964 37.0 37.0 37.0 37.0 37.0 25-29 36.5293 37.0 37.0 37.0 37.0 37.0 30-34 36.4923 37.0 37.0 37.0 37.0 37.0 35-39 36.6558 37.0 37.0 37.0 37.0 37.0 40-44 36.5741 37.0 37.0 37.0 37.0 37.0 45-49 36.4129 37.0 37.0 37.0 37.0 37.0 50-54 36.490899999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.5374 37.0 37.0 37.0 37.0 37.0 60-64 36.5008 37.0 37.0 37.0 37.0 37.0 65-69 36.2737 37.0 37.0 37.0 37.0 37.0 70-74 36.4019 37.0 37.0 37.0 37.0 37.0 75-79 36.48629999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.409800000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.181200000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.446000000000005 37.0 37.0 37.0 29.8 37.0 95-99 36.124199999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.2411 37.0 37.0 37.0 37.0 37.0 105-109 36.2044 37.0 37.0 37.0 37.0 37.0 110-114 36.2579 37.0 37.0 37.0 37.0 37.0 115-119 36.497 37.0 37.0 37.0 37.0 37.0 120-124 36.5715 37.0 37.0 37.0 37.0 37.0 125-129 36.5379 37.0 37.0 37.0 37.0 37.0 130-134 36.554700000000004 37.0 37.0 37.0 37.0 37.0 135-139 36.3597 37.0 37.0 37.0 37.0 37.0 140-144 36.2371 37.0 37.0 37.0 37.0 37.0 145-149 36.2513 37.0 37.0 37.0 37.0 37.0 150-151 33.6835 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 0.0 27 0.0 28 2.0 29 9.0 30 6.0 31 22.0 32 31.0 33 49.0 34 107.0 35 344.0 36 3262.0 37 166.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.75 9.575 5.1 36.575 2 22.383939774153074 9.861982434127981 34.90589711417817 32.848180677540775 3 19.425 14.674999999999999 25.525 40.375 4 26.424999999999997 21.675 23.025000000000002 28.875 5 27.250000000000004 26.075 23.9 22.775000000000002 6 24.2 30.3 22.775000000000002 22.725 7 17.775 24.975 39.300000000000004 17.95 8 21.375 21.55 30.5 26.575 9 20.75 20.349999999999998 33.35 25.55 10-14 23.13 25.865 25.729999999999997 25.275 15-19 22.915 24.645 25.874999999999996 26.565 20-24 23.57 25.064999999999998 25.650000000000002 25.715 25-29 23.165 24.77 25.27 26.795 30-34 23.369999999999997 24.795 25.085 26.75 35-39 23.45 24.385 25.735000000000003 26.43 40-44 23.805 24.16 25.35 26.685 45-49 23.580000000000002 24.535 25.590000000000003 26.295 50-54 23.96 25.16 25.55 25.330000000000002 55-59 23.79 24.86 24.990000000000002 26.36 60-64 23.36 24.705 25.319999999999997 26.615 65-69 23.855 24.65 25.330000000000002 26.165 70-74 23.925 24.145 25.485000000000003 26.445 75-79 23.785 24.759999999999998 25.44 26.015 80-84 23.57 24.775 24.79 26.865 85-89 23.880000000000003 25.230000000000004 24.525 26.365 90-94 24.32 24.65 24.815 26.215 95-99 23.810000000000002 24.560000000000002 25.335 26.295 100-104 24.295 24.43 24.67 26.605 105-109 24.525 24.01 25.955000000000002 25.509999999999998 110-114 24.525 24.815 24.19 26.47 115-119 24.575 24.815 24.43 26.179999999999996 120-124 25.005 25.264999999999997 24.02 25.71 125-129 24.325 24.895 24.025 26.755000000000003 130-134 25.345000000000002 24.67 23.77 26.215 135-139 24.09 24.485 24.895 26.529999999999998 140-144 24.51 25.11 23.665 26.715 145-149 24.834999999999997 24.79 24.175 26.200000000000003 150-151 24.775 24.587500000000002 24.212500000000002 26.424999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.0 24 0.0 25 0.5 26 1.0 27 0.5 28 1.0 29 2.5 30 3.0 31 6.0 32 7.5 33 14.0 34 21.0 35 35.0 36 51.5 37 62.5 38 77.0 39 85.0 40 104.5 41 112.5 42 123.0 43 167.5 44 175.5 45 168.5 46 188.5 47 195.5 48 195.0 49 192.0 50 175.0 51 162.5 52 151.5 53 144.5 54 137.0 55 116.5 56 118.5 57 112.0 58 86.5 59 76.0 60 80.0 61 78.0 62 54.5 63 53.5 64 66.5 65 66.0 66 65.0 67 52.0 68 39.5 69 38.5 70 34.0 71 26.5 72 24.5 73 18.0 74 8.0 75 7.5 76 6.5 77 3.0 78 1.0 79 1.5 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.65 #Duplication Level Percentage of deduplicated Percentage of total 1 85.70584760779681 72.55 2 11.6066154754873 19.650000000000002 3 2.0968694624926165 5.325 4 0.29533372711163614 1.0 5 0.1772002362669817 0.75 6 0.029533372711163616 0.15 7 0.029533372711163616 0.17500000000000002 8 0.05906674542232723 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 8 0.2 No Hit ATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAGGCTATA 8 0.2 No Hit GGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTT 7 0.17500000000000002 No Hit CGATGAAAAAAACTTTGTTGATTTTGCCATGTTGATTTTGCCATGTCATT 6 0.15 No Hit CTTGGCAAATGCTTTCGCAGTTGTTCGTCTTTCATAAATCCAAGAATTTC 5 0.125 No Hit GCCTTGCGACCATACTCCCCCCGGAACCCAAAGACTTTGATTTCTCATAA 5 0.125 No Hit GCCCGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCG 5 0.125 No Hit GCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTA 5 0.125 No Hit GGTGATTGTCCCGTTTGGTTGGAAGGGAAATCCGGTGTCCGATTGGAGTT 5 0.125 No Hit CCTCGCGGTACTTGTTCGCTATCGGTCTCTCGCCTGTATTTAGCCTTGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 0.9624999999999999 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 1.9 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.2 0.0 0.0 0.0 0.0 116-117 2.5125 0.0 0.0 0.0 0.0 118-119 2.725 0.0 0.0 0.0 0.0 120-121 3.0125 0.0 0.0 0.0 0.0 122-123 3.3375 0.0 0.0 0.0 0.0 124-125 3.6500000000000004 0.0 0.0 0.0 0.0 126-127 3.9375 0.0 0.0 0.0 0.0 128-129 4.375 0.0 0.0 0.0 0.0 130-131 4.8125 0.0 0.0 0.0 0.0 132-133 5.25 0.0 0.0 0.0 0.0 134-135 5.675 0.0 0.0 0.0 0.0 136-137 6.0875 0.0 0.0 0.0 0.0 138-139 6.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18694373 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694373_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.039 37.0 37.0 37.0 25.0 37.0 2 35.1255 37.0 37.0 37.0 25.0 37.0 3 35.2405 37.0 37.0 37.0 25.0 37.0 4 35.0225 37.0 37.0 37.0 25.0 37.0 5 35.046 37.0 37.0 37.0 25.0 37.0 6 35.2245 37.0 37.0 37.0 25.0 37.0 7 35.252 37.0 37.0 37.0 25.0 37.0 8 35.4945 37.0 37.0 37.0 37.0 37.0 9 35.3865 37.0 37.0 37.0 37.0 37.0 10-14 35.460899999999995 37.0 37.0 37.0 37.0 37.0 15-19 35.5456 37.0 37.0 37.0 37.0 37.0 20-24 35.291700000000006 37.0 37.0 37.0 32.2 37.0 25-29 35.5413 37.0 37.0 37.0 32.2 37.0 30-34 35.7178 37.0 37.0 37.0 37.0 37.0 35-39 35.49050000000001 37.0 37.0 37.0 32.2 37.0 40-44 35.295100000000005 37.0 37.0 37.0 29.8 37.0 45-49 35.4861 37.0 37.0 37.0 34.6 37.0 50-54 34.9236 37.0 37.0 37.0 29.8 37.0 55-59 34.274499999999996 37.0 37.0 37.0 25.0 37.0 60-64 35.0894 37.0 37.0 37.0 27.4 37.0 65-69 34.22430000000001 37.0 34.6 37.0 27.4 37.0 70-74 32.981500000000004 37.0 29.8 37.0 22.2 37.0 75-79 33.5979 37.0 34.6 37.0 22.2 37.0 80-84 34.564 37.0 37.0 37.0 25.0 37.0 85-89 32.7057 37.0 32.2 37.0 19.4 37.0 90-94 34.0768 37.0 37.0 37.0 25.0 37.0 95-99 34.0225 37.0 37.0 37.0 25.0 37.0 100-104 33.5911 37.0 37.0 37.0 25.0 37.0 105-109 34.2333 37.0 37.0 37.0 25.0 37.0 110-114 34.5758 37.0 37.0 37.0 25.0 37.0 115-119 34.5287 37.0 37.0 37.0 25.0 37.0 120-124 34.1776 37.0 37.0 37.0 25.0 37.0 125-129 33.9568 37.0 37.0 37.0 25.0 37.0 130-134 33.7987 37.0 37.0 37.0 25.0 37.0 135-139 32.0419 37.0 27.4 37.0 13.8 37.0 140-144 31.441899999999997 37.0 25.0 37.0 11.0 37.0 145-149 31.059199999999997 37.0 25.0 37.0 11.0 37.0 150-151 30.796499999999998 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 3.0 19 2.0 20 1.0 21 4.0 22 3.0 23 10.0 24 6.0 25 9.0 26 7.0 27 16.0 28 28.0 29 48.0 30 82.0 31 141.0 32 286.0 33 572.0 34 1183.0 35 1386.0 36 211.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.175 20.325 7.675 27.825 2 32.074999999999996 22.8 25.224999999999998 19.900000000000002 3 23.0 24.575 27.950000000000003 24.474999999999998 4 28.025 29.425 19.875 22.675 5 28.299999999999997 32.725 18.625 20.349999999999998 6 24.3 33.925 19.400000000000002 22.375 7 21.375 20.5 34.425 23.7 8 24.775 21.875 23.775 29.575000000000003 9 23.75 21.6 26.875 27.775 10-14 25.905 26.025 22.915 25.155 15-19 26.415 24.325 24.525 24.735 20-24 26.805 24.855 23.56 24.779999999999998 25-29 25.825 25.83 23.630000000000003 24.715 30-34 25.77 25.174999999999997 23.919999999999998 25.135 35-39 26.145000000000003 25.735000000000003 23.3 24.82 40-44 26.435 25.045 23.635 24.884999999999998 45-49 25.96 25.19 23.625 25.224999999999998 50-54 24.69 25.495 24.279999999999998 25.535000000000004 55-59 25.715 25.27 24.255 24.759999999999998 60-64 26.8 24.925 23.849999999999998 24.425 65-69 26.810000000000002 24.709999999999997 23.48 25.0 70-74 26.91 24.185000000000002 24.11 24.795 75-79 27.975 23.39 24.08 24.555 80-84 26.865 24.605 24.240000000000002 24.29 85-89 24.625 26.784999999999997 23.635 24.955 90-94 26.150000000000002 25.285000000000004 23.95 24.615000000000002 95-99 26.545 25.319999999999997 23.82 24.315 100-104 26.895000000000003 24.75 24.224999999999998 24.13 105-109 26.915 24.905 23.95 24.23 110-114 26.745 25.115 24.279999999999998 23.86 115-119 27.150000000000002 25.695 23.35 23.805 120-124 26.71 25.324999999999996 24.055 23.91 125-129 27.3 25.374999999999996 24.02 23.305 130-134 27.735 25.069999999999997 23.64 23.555 135-139 27.61 25.505 23.82 23.064999999999998 140-144 27.889999999999997 25.35 23.169999999999998 23.59 145-149 27.265 25.569999999999997 23.54 23.625 150-151 26.325 25.9625 26.0375 21.675 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 0.0 26 0.0 27 1.0 28 2.5 29 3.5 30 5.0 31 5.5 32 7.5 33 11.0 34 19.0 35 27.5 36 36.0 37 48.0 38 65.5 39 93.5 40 104.0 41 116.5 42 140.5 43 142.0 44 156.5 45 160.0 46 165.0 47 187.0 48 194.0 49 176.5 50 168.0 51 157.0 52 149.0 53 147.0 54 120.5 55 117.0 56 116.0 57 109.0 58 96.0 59 80.5 60 81.0 61 83.0 62 78.0 63 72.5 64 64.5 65 63.5 66 64.5 67 67.5 68 61.5 69 47.0 70 41.0 71 35.5 72 29.0 73 22.5 74 14.5 75 13.0 76 9.0 77 5.0 78 7.5 79 3.5 80 0.5 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.375 #Duplication Level Percentage of deduplicated Percentage of total 1 87.58321273516643 75.64999999999999 2 10.043415340086831 17.349999999999998 3 1.9681620839363243 5.1 4 0.20260492040520983 0.7000000000000001 5 0.11577424023154848 0.5 6 0.0 0.0 7 0.02894356005788712 0.17500000000000002 8 0.0 0.0 9 0.02894356005788712 0.22499999999999998 >10 0.02894356005788712 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 12 0.3 No Hit GGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCA 9 0.22499999999999998 No Hit CACGGCCCTCGTGCCGGCGACGCATCATTCAAATTTCTGCCCTATCAACT 7 0.17500000000000002 No Hit ACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTTGAT 5 0.125 No Hit GCAAAACATCGGATATCTTCGAGAAAAAAACAAAACATTGGAGGAAGAAA 5 0.125 No Hit AGGGAATGAAGGGTCTGGTGTCTCAGTTGGTAAGTTGCTCAACTCACAAA 5 0.125 No Hit AGGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.025 0.0 0.0 0.0 94-95 0.5125 0.05 0.0 0.0 0.0 96-97 0.675 0.05 0.0 0.0 0.0 98-99 0.7875000000000001 0.05 0.0 0.0 0.0 100-101 0.8125 0.05 0.0 0.0 0.0 102-103 0.8875 0.05 0.0 0.0 0.0 104-105 1.1 0.05 0.0 0.0 0.0 106-107 1.3125 0.05 0.0 0.0 0.0 108-109 1.6375 0.05 0.0 0.0 0.0 110-111 1.825 0.05 0.0 0.0 0.0 112-113 1.975 0.05 0.0 0.0 0.0 114-115 2.125 0.05 0.0 0.0 0.0 116-117 2.4375 0.05 0.0 0.0 0.0 118-119 2.6624999999999996 0.05 0.0 0.0 0.0 120-121 2.9625 0.05 0.0 0.0 0.0 122-123 3.2625 0.05 0.0 0.0 0.0 124-125 3.55 0.05 0.0 0.0 0.0 126-127 3.8375000000000004 0.05 0.0 0.0 0.0 128-129 4.275 0.05 0.0 0.0 0.0 130-131 4.7 0.05 0.0 0.0 0.0 132-133 5.125 0.05 0.0 0.0 0.0 134-135 5.525 0.05 0.0 0.0 0.0 136-137 5.9375 0.05 0.0 0.0 0.0 138-139 6.3125 0.05 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 586926 spots for SRR18694373.sra Written 586926 spots for SRR18694373.sra Read 586926 spots for SRR18694373.sra Written 586926 spots for SRR18694373.sra Read 586926 spots for SRR18694373.sra Written 586926 spots for SRR18694373.sra Read 586926 spots for SRR18694373.sra Written 586926 spots for SRR18694373.sra Read 586926 spots for SRR18694373.sra Written 586926 spots for SRR18694373.sra Read 586926 spots for SRR18694373.sra Written 586926 spots for SRR18694373.sra Read 586926 spots for SRR18694373.sra Written 586926 spots for SRR18694373.sra Read 586926 spots for SRR18694373.sra Written 586926 spots for SRR18694373.sra Read 586926 spots for SRR18694373.sra Written 586926 spots for SRR18694373.sra Read 586926 spots for SRR18694373.sra Written 586926 spots for SRR18694373.sra Read 586926 spots for SRR18694373.sra Written 586926 spots for SRR18694373.sra Read 586926 spots for SRR18694373.sra Written 586926 spots for SRR18694373.sra Read 586926 spots for SRR18694373.sra Written 586926 spots for SRR18694373.sra Read 586926 spots for SRR18694373.sra Written 586926 spots for SRR18694373.sra Read 586938 spots for SRR18694373.sra Written 586938 spots for SRR18694373.sra Read 586926 spots for SRR18694373.sra Written 586926 spots for SRR18694373.sra Read 586926 spots for SRR18694373.sra Written 586926 spots for SRR18694373.sra Read 586926 spots for SRR18694373.sra Written 586926 spots for SRR18694373.sra Read 586926 spots for SRR18694373.sra Written 586926 spots for SRR18694373.sra Read 586926 spots for SRR18694373.sra Written 586926 spots for SRR18694373.sra SRR ids: ['SRR18694373.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__qio5gbz SRR18694373.sra spots: 11738532 blocks: [[1, 586926], [586927, 1173852], [1173853, 1760778], [1760779, 2347704], [2347705, 2934630], [2934631, 3521556], [3521557, 4108482], [4108483, 4695408], [4695409, 5282334], [5282335, 5869260], [5869261, 6456186], [6456187, 7043112], [7043113, 7630038], [7630039, 8216964], [8216965, 8803890], [8803891, 9390816], [9390817, 9977742], [9977743, 10564668], [10564669, 11151594], [11151595, 11738532]] SRR18694373 file size 3967566 SRR18694373 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694373 SRR18694373_1.fastq SRR18694373_2.fastq Input file: SRR18694373_1.fastq Paired file: SRR18694373_2.fastq trimmed: SRR18694373-trimmed-pair1.fastq, SRR18694373-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:11:30 2024 >> started Tue Dec 10 06:11:43 2024 >> done (13.108s) 11738532 read pairs processed; of these: 140 ( 0.00%) short read pairs filtered out after trimming by size control 2373 ( 0.02%) empty read pairs filtered out after trimming by size control 11736019 (99.98%) read pairs available; of these: 1352512 (11.52%) trimmed read pairs available after processing 10383507 (88.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 19 0.00% 20 12 0.00% 21 15 0.00% 22 14 0.00% 23 22 0.00% 24 12 0.00% 25 12 0.00% 26 15 0.00% 27 20 0.00% 28 20 0.00% 29 22 0.00% 30 30 0.00% 31 24 0.00% 32 30 0.00% 33 36 0.00% 34 35 0.00% 35 25 0.00% 36 31 0.00% 37 37 0.00% 38 37 0.00% 39 31 0.00% 40 38 0.00% 41 28 0.00% 42 62 0.00% 43 46 0.00% 44 41 0.00% 45 46 0.00% 46 43 0.00% 47 39 0.00% 48 51 0.00% 49 58 0.00% 50 55 0.00% 51 93 0.00% 52 77 0.00% 53 99 0.00% 54 72 0.00% 55 80 0.00% 56 89 0.00% 57 122 0.00% 58 146 0.00% 59 163 0.00% 60 160 0.00% 61 218 0.00% 62 233 0.00% 63 230 0.00% 64 243 0.00% 65 275 0.00% 66 333 0.00% 67 393 0.00% 68 454 0.00% 69 492 0.00% 70 602 0.01% 71 618 0.01% 72 755 0.01% 73 793 0.01% 74 946 0.01% 75 895 0.01% 76 1119 0.01% 77 1230 0.01% 78 1365 0.01% 79 1543 0.01% 80 1710 0.01% 81 1935 0.02% 82 2234 0.02% 83 2282 0.02% 84 2751 0.02% 85 2998 0.03% 86 3392 0.03% 87 3571 0.03% 88 3983 0.03% 89 4114 0.04% 90 4352 0.04% 91 4796 0.04% 92 5357 0.05% 93 5574 0.05% 94 6060 0.05% 95 6692 0.06% 96 7392 0.06% 97 7174 0.06% 98 7845 0.07% 99 8279 0.07% 100 8702 0.07% 101 9325 0.08% 102 9899 0.08% 103 10583 0.09% 104 10920 0.09% 105 11485 0.10% 106 11782 0.10% 107 12399 0.11% 108 12757 0.11% 109 13687 0.12% 110 14113 0.12% 111 14670 0.12% 112 15636 0.13% 113 16116 0.14% 114 17233 0.15% 115 17873 0.15% 116 18270 0.16% 117 19077 0.16% 118 19157 0.16% 119 19930 0.17% 120 21358 0.18% 121 21074 0.18% 122 22026 0.19% 123 23817 0.20% 124 24626 0.21% 125 24486 0.21% 126 25460 0.22% 127 25352 0.22% 128 25975 0.22% 129 26752 0.23% 130 27171 0.23% 131 28355 0.24% 132 29575 0.25% 133 30012 0.26% 134 30181 0.26% 135 30929 0.26% 136 32272 0.27% 137 32611 0.28% 138 32143 0.27% 139 33054 0.28% 140 33990 0.29% 141 34646 0.30% 142 35740 0.30% 143 36726 0.31% 144 37736 0.32% 145 37489 0.32% 146 38192 0.33% 147 39554 0.34% 148 39761 0.34% 149 40210 0.34% 150 40279 0.34% 151 10383507 88.48% 11736019 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=4.02 fanout-score-rank=29 prefix-density=0.16 prefix-fanout=3.4 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=20 fanout-score=462.43 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=34.9 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=7.02 fanout-score-rank=23 prefix-density=0.21 prefix-fanout=5.0 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=696.50 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=17.5 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR18694373 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:12:51 Started mapping on | Dec 10 06:12:52 Finished on | Dec 10 06:16:36 Mapping speed, Million of reads per hour | 188.61 Number of input reads | 11736019 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 9011087 Uniquely mapped reads % | 76.78% Average mapped length | 295.09 Number of splices: Total | 9519627 Number of splices: Annotated (sjdb) | 8949867 Number of splices: GT/AG | 9391584 Number of splices: GC/AG | 106750 Number of splices: AT/AC | 6459 Number of splices: Non-canonical | 14834 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.01% Deletion average length | 2.50 Insertion rate per base | 0.01% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 117234 % of reads mapped to multiple loci | 1.00% Number of reads mapped to too many loci | 144415 % of reads mapped to too many loci | 1.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.45% % of reads unmapped: other | 11.54% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2607698 2607698 2607698 N_multimapping 117234 117234 117234 N_noFeature 298323 8800179 363646 N_ambiguous 173160 1039 28072 UnstrandedReadsAssigned:8539604 PositiveStrandReadsAssigned:209869 NegativeStrandReadsAssigned:8619369 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694373 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694373-trimmed-pair1.fastq SRR18694373-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,736,019 reads, 8,804,749 reads pseudoaligned [quant] estimated average fragment length: 258.985 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,239 rounds 52973 SRR18694373.ke.tsv 35125 SRR18694373.se.tsv 88098 total ==> SRR18694373.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 678.511 0 0 PNS24247 1044 786.015 30.8202 6.73902 PNS24249 1928 1670.01 56.583 5.82315 PNS24246 1044 786.015 30.8202 6.73902 PNS24248 1044 786.015 30.8202 6.73902 PNS24244 1471 1213.01 28.9564 4.10271 PNS24243 293 96.4922 0 0 KQK14069 1603 1345.01 2550.59 325.917 KQK14071 474 238.707 15.6191 11.2456 ==> SRR18694373.se.tsv <== BRADI_1g14170v3 2634 BRADI_1g53295v3 46 BRADI_1g59795v3 120 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 282 BRADI_1g74790v3 148 BRADI_1g09890v3 0 BRADI_1g77505v3 77 BRADI_1g48960v3 0 SRR18694373 completed mapping pipeline successfully