Starting /dee2/code/volunteer_pipeline.sh SRR18694374 current disk space = 1525669421056 free memory = 1401493660 SRR18694374 SRAfilesize ba7a18d891bbd3adc6e55ef58349b946 SRR18694374.sra SRR18694374.sra file validated SRR18694374 is paired end SRR18694374 is conventional basespace SRR18694374 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694374_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.117 37.0 37.0 37.0 37.0 37.0 2 36.139 37.0 37.0 37.0 37.0 37.0 3 36.438 37.0 37.0 37.0 37.0 37.0 4 36.583 37.0 37.0 37.0 37.0 37.0 5 36.6035 37.0 37.0 37.0 37.0 37.0 6 36.561 37.0 37.0 37.0 37.0 37.0 7 36.574 37.0 37.0 37.0 37.0 37.0 8 36.634 37.0 37.0 37.0 37.0 37.0 9 36.667 37.0 37.0 37.0 37.0 37.0 10-14 36.6666 37.0 37.0 37.0 37.0 37.0 15-19 36.6502 37.0 37.0 37.0 37.0 37.0 20-24 36.635 37.0 37.0 37.0 37.0 37.0 25-29 36.57619999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.5877 37.0 37.0 37.0 37.0 37.0 35-39 36.724399999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.638400000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4481 37.0 37.0 37.0 37.0 37.0 50-54 36.5659 37.0 37.0 37.0 37.0 37.0 55-59 36.5715 37.0 37.0 37.0 37.0 37.0 60-64 36.569 37.0 37.0 37.0 37.0 37.0 65-69 36.3382 37.0 37.0 37.0 37.0 37.0 70-74 36.4805 37.0 37.0 37.0 37.0 37.0 75-79 36.5441 37.0 37.0 37.0 37.0 37.0 80-84 36.44850000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.2762 37.0 37.0 37.0 37.0 37.0 90-94 35.5045 37.0 37.0 37.0 29.8 37.0 95-99 36.2085 37.0 37.0 37.0 37.0 37.0 100-104 36.1993 37.0 37.0 37.0 37.0 37.0 105-109 36.1541 37.0 37.0 37.0 37.0 37.0 110-114 36.2667 37.0 37.0 37.0 37.0 37.0 115-119 36.527 37.0 37.0 37.0 37.0 37.0 120-124 36.6228 37.0 37.0 37.0 37.0 37.0 125-129 36.557 37.0 37.0 37.0 37.0 37.0 130-134 36.5284 37.0 37.0 37.0 37.0 37.0 135-139 36.4979 37.0 37.0 37.0 37.0 37.0 140-144 36.3244 37.0 37.0 37.0 37.0 37.0 145-149 36.267300000000006 37.0 37.0 37.0 37.0 37.0 150-151 33.728500000000004 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 2.0 27 4.0 28 1.0 29 6.0 30 7.0 31 9.0 32 17.0 33 46.0 34 108.0 35 317.0 36 3271.0 37 210.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.6 9.950000000000001 4.75 36.7 2 22.54016064257028 10.015060240963855 35.86847389558233 31.576305220883533 3 19.175 14.875 25.025 40.925 4 25.575 21.275 22.05 31.1 5 28.199999999999996 26.075 23.275000000000002 22.45 6 23.7 28.725 24.275 23.3 7 19.775000000000002 22.875 38.875 18.475 8 19.3 21.9 31.125000000000004 27.675 9 20.275000000000002 18.7 35.3 25.724999999999998 10-14 23.615 25.855 26.13 24.4 15-19 24.41 23.715 25.28 26.595000000000002 20-24 24.0 24.45 25.64 25.91 25-29 24.135 24.490000000000002 25.064999999999998 26.31 30-34 23.715 24.65 25.335 26.3 35-39 24.725 24.044999999999998 24.795 26.435 40-44 24.32 24.29 25.185000000000002 26.205000000000002 45-49 23.845 23.385 25.75 27.02 50-54 24.535 23.695 25.46 26.31 55-59 24.060000000000002 24.065 25.155 26.72 60-64 24.32 23.849999999999998 25.27 26.56 65-69 23.919999999999998 24.169999999999998 25.435000000000002 26.474999999999998 70-74 24.215 24.325 25.009999999999998 26.450000000000003 75-79 24.365000000000002 24.93 24.465 26.240000000000002 80-84 24.834999999999997 23.474999999999998 24.79 26.900000000000002 85-89 24.345 24.665 24.335 26.655 90-94 24.495 24.32 25.4 25.785000000000004 95-99 25.1 24.285 24.22 26.395000000000003 100-104 24.404999999999998 24.75 24.08 26.765 105-109 25.27 24.32 24.560000000000002 25.85 110-114 25.205 24.39 24.43 25.974999999999998 115-119 24.635 24.560000000000002 24.63 26.174999999999997 120-124 24.805 23.945 24.875 26.375 125-129 25.22 23.955000000000002 24.169999999999998 26.655 130-134 25.305 24.095 24.560000000000002 26.040000000000003 135-139 25.045 24.11 24.84 26.005 140-144 25.290000000000003 24.545 23.925 26.240000000000002 145-149 24.585 24.355 24.565 26.495 150-151 24.875 24.7375 24.2 26.187500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.0 25 0.0 26 0.0 27 1.0 28 3.0 29 5.5 30 6.0 31 8.5 32 14.0 33 19.0 34 19.5 35 26.5 36 44.5 37 57.0 38 65.5 39 82.5 40 103.5 41 128.0 42 142.0 43 144.5 44 168.0 45 168.5 46 175.5 47 183.5 48 173.5 49 169.0 50 154.5 51 144.0 52 138.5 53 133.5 54 116.5 55 112.0 56 116.5 57 120.5 58 108.5 59 98.5 60 99.0 61 91.5 62 70.5 63 60.5 64 62.5 65 62.5 66 67.5 67 55.5 68 49.5 69 46.0 70 39.0 71 33.0 72 31.0 73 26.5 74 13.0 75 10.5 76 12.0 77 7.5 78 4.5 79 2.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.575 #Duplication Level Percentage of deduplicated Percentage of total 1 85.66361217853976 72.45 2 11.498669819686668 19.45 3 2.3352054389595036 5.925 4 0.2660360626662725 0.8999999999999999 5 0.11823825007389892 0.5 6 0.05911912503694946 0.3 7 0.0 0.0 8 0.02955956251847473 0.2 9 0.0 0.0 >10 0.02955956251847473 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGTGCTCCAGATAAGCCTATCTAGCATGACCTGGCGACGATCATAGGTG 11 0.27499999999999997 No Hit GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 8 0.2 No Hit GGTTCCACGAATTTTATTAATTATGCCGGACGAGGCAAGTTCAGTTTGTT 6 0.15 No Hit GTGTGTACAAGGCCCGGGAACGGATTCACCGCCGTATGGCTGACCGGCGA 6 0.15 No Hit GTGATTCCTTCCTCCTTGATATCTCCGCCAATGAAATCATTCTCCTTCGC 5 0.125 No Hit GGGCTGGACTCTGCCCTGACGATGAAGGGGGACTTCCTGGAGGAAGACGA 5 0.125 No Hit CTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCATTCTTGC 5 0.125 No Hit CTCCTCATCTCTGACTTTCACATGCAACATCTATCAGTCCTGACTCCTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.3875000000000002 0.0 0.0 0.0 0.0 100-101 1.5375 0.0 0.0 0.0 0.0 102-103 1.8 0.0 0.0 0.0 0.0 104-105 2.075 0.0 0.0 0.0 0.0 106-107 2.3499999999999996 0.0 0.0 0.0 0.0 108-109 2.7125000000000004 0.0 0.0 0.0 0.0 110-111 2.95 0.0 0.0 0.0 0.0 112-113 3.175 0.0 0.0 0.0 0.0 114-115 3.5125 0.0 0.0 0.0 0.0 116-117 3.7875 0.0 0.0 0.0 0.0 118-119 4.1125 0.0 0.0 0.0 0.0 120-121 4.375 0.0 0.0 0.0 0.0 122-123 4.85 0.0 0.0 0.0 0.0 124-125 5.475 0.0 0.0 0.0 0.0 126-127 5.95 0.0 0.0 0.0 0.0 128-129 6.612500000000001 0.0 0.0 0.0 0.0 130-131 7.1625 0.0 0.0 0.0 0.0 132-133 7.5 0.0 0.0 0.0 0.0 134-135 8.025 0.0 0.0 0.0 0.0 136-137 8.475000000000001 0.0 0.0 0.0 0.0 138-139 9.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTTATC 10 0.006830828 145.0 6 TGCGTTA 10 0.006830828 145.0 4 CCTGCGT 10 0.006830828 145.0 2 TATCTTT 10 0.006830828 145.0 9 GCGTTAT 10 0.006830828 145.0 5 CTCCACC 25 8.7132835E-4 87.0 1 >>END_MODULE SRR18694374 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694374_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.1175 37.0 37.0 37.0 25.0 37.0 2 35.066 37.0 37.0 37.0 25.0 37.0 3 35.163 37.0 37.0 37.0 25.0 37.0 4 35.202 37.0 37.0 37.0 25.0 37.0 5 35.226 37.0 37.0 37.0 25.0 37.0 6 35.3635 37.0 37.0 37.0 37.0 37.0 7 35.229 37.0 37.0 37.0 25.0 37.0 8 35.459 37.0 37.0 37.0 37.0 37.0 9 35.564 37.0 37.0 37.0 37.0 37.0 10-14 35.5376 37.0 37.0 37.0 37.0 37.0 15-19 35.615899999999996 37.0 37.0 37.0 37.0 37.0 20-24 35.3538 37.0 37.0 37.0 32.2 37.0 25-29 35.601600000000005 37.0 37.0 37.0 34.6 37.0 30-34 35.83970000000001 37.0 37.0 37.0 37.0 37.0 35-39 35.6706 37.0 37.0 37.0 37.0 37.0 40-44 35.3575 37.0 37.0 37.0 29.8 37.0 45-49 35.6097 37.0 37.0 37.0 37.0 37.0 50-54 34.9704 37.0 37.0 37.0 29.4 37.0 55-59 34.3563 37.0 37.0 37.0 25.0 37.0 60-64 35.0549 37.0 37.0 37.0 27.4 37.0 65-69 34.2508 37.0 34.6 37.0 27.4 37.0 70-74 32.952299999999994 37.0 29.8 37.0 22.2 37.0 75-79 33.5947 37.0 34.6 37.0 22.2 37.0 80-84 34.6259 37.0 37.0 37.0 25.0 37.0 85-89 32.841899999999995 37.0 32.2 37.0 19.4 37.0 90-94 34.111900000000006 37.0 37.0 37.0 25.0 37.0 95-99 34.0072 37.0 37.0 37.0 25.0 37.0 100-104 33.5567 37.0 37.0 37.0 25.0 37.0 105-109 34.3528 37.0 37.0 37.0 25.0 37.0 110-114 34.56399999999999 37.0 37.0 37.0 25.0 37.0 115-119 34.5717 37.0 37.0 37.0 25.0 37.0 120-124 34.2065 37.0 37.0 37.0 25.0 37.0 125-129 34.074200000000005 37.0 37.0 37.0 25.0 37.0 130-134 33.8039 37.0 37.0 37.0 25.0 37.0 135-139 32.1977 37.0 27.4 37.0 13.8 37.0 140-144 31.5192 37.0 25.0 37.0 11.0 37.0 145-149 30.950300000000006 37.0 25.0 37.0 11.0 37.0 150-151 30.717750000000002 37.0 25.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 2.0 17 2.0 18 1.0 19 1.0 20 1.0 21 6.0 22 4.0 23 4.0 24 2.0 25 7.0 26 13.0 27 17.0 28 24.0 29 44.0 30 79.0 31 133.0 32 272.0 33 555.0 34 1167.0 35 1484.0 36 181.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.875 20.5 6.65 27.975 2 28.849999999999998 22.675 29.7 18.775 3 21.6 22.475 29.925 26.0 4 26.150000000000002 30.349999999999998 19.925 23.575 5 28.7 31.874999999999996 18.75 20.674999999999997 6 23.75 34.775 18.55 22.925 7 24.775 19.225 34.050000000000004 21.95 8 23.775 21.275 24.05 30.9 9 22.85 21.775 27.05 28.325 10-14 26.919999999999998 25.335 22.065 25.679999999999996 15-19 26.745 24.455 23.015 25.785000000000004 20-24 26.290000000000003 25.224999999999998 23.755000000000003 24.73 25-29 26.66 24.485 23.625 25.230000000000004 30-34 26.265 25.345000000000002 23.325000000000003 25.064999999999998 35-39 26.1 25.564999999999998 23.275000000000002 25.06 40-44 26.82 24.875 22.625 25.679999999999996 45-49 26.450000000000003 25.505 22.685 25.36 50-54 25.56 24.88 24.395 25.165 55-59 26.424999999999997 24.959999999999997 22.900000000000002 25.715 60-64 27.0 24.615000000000002 22.830000000000002 25.555 65-69 26.590000000000003 24.64 23.77 25.0 70-74 26.97 24.45 23.505000000000003 25.074999999999996 75-79 27.76 22.525000000000002 24.55 25.165 80-84 27.18 23.810000000000002 23.685000000000002 25.324999999999996 85-89 24.54 26.21 24.099999999999998 25.15 90-94 26.715 24.81 23.565 24.91 95-99 26.91 24.525 23.275000000000002 25.290000000000003 100-104 27.034999999999997 25.21 22.400000000000002 25.355 105-109 26.834999999999997 24.349999999999998 23.825 24.990000000000002 110-114 27.405 24.610000000000003 23.415 24.57 115-119 27.485 25.25 22.215 25.05 120-124 26.834999999999997 25.355 23.47 24.34 125-129 27.439999999999998 24.94 23.615 24.005000000000003 130-134 27.83 25.485000000000003 23.29 23.395 135-139 27.894999999999996 26.119999999999997 22.665 23.32 140-144 28.255000000000003 25.39 23.09 23.265 145-149 29.035 25.61 22.325 23.03 150-151 27.375 24.637500000000003 24.625 23.3625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 0.5 25 1.0 26 2.5 27 3.0 28 3.0 29 3.5 30 5.5 31 9.0 32 12.0 33 14.5 34 14.0 35 20.5 36 26.0 37 40.0 38 70.0 39 91.0 40 101.0 41 113.0 42 117.5 43 128.0 44 147.0 45 158.0 46 159.5 47 159.0 48 173.5 49 171.5 50 141.0 51 147.0 52 151.0 53 124.0 54 124.5 55 126.5 56 116.0 57 116.0 58 112.0 59 110.0 60 106.0 61 92.0 62 92.0 63 89.5 64 72.0 65 65.5 66 71.5 67 61.0 68 60.5 69 61.0 70 54.5 71 49.0 72 34.0 73 22.5 74 17.0 75 12.5 76 9.0 77 5.0 78 2.5 79 2.5 80 2.0 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.325 #Duplication Level Percentage of deduplicated Percentage of total 1 87.43121922965538 75.47500000000001 2 10.165073848827106 17.549999999999997 3 1.9403417318273966 5.025 4 0.2896032435563278 1.0 5 0.08688097306689835 0.375 6 0.028960324355632783 0.15 7 0.028960324355632783 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.028960324355632783 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCTTCCTTGGGGTTTGGAAGATGGCTGGTTTCTTGTCGGAGAATCGCC 10 0.25 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 7 0.17500000000000002 No Hit GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 6 0.15 No Hit GCTTCGTCTGGGTCCCGACCTGGAACGGGTTCCGTCGAATCGATTGCCGC 5 0.125 No Hit CAGTGAACGGTTTCAGAGCACACACTTTCATCTCACCACACACTGCACTT 5 0.125 No Hit CATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.775 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.3624999999999998 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.7375 0.0 0.0 0.0 0.0 104-105 1.9749999999999999 0.0 0.0 0.0 0.0 106-107 2.25 0.0 0.0 0.0 0.0 108-109 2.6125 0.0 0.0 0.0 0.0 110-111 2.8499999999999996 0.0 0.0 0.0 0.0 112-113 3.075 0.0 0.0 0.0 0.0 114-115 3.4125 0.0 0.0 0.0 0.0 116-117 3.6875 0.0 0.0 0.0 0.0 118-119 4.0125 0.0 0.0 0.0 0.0 120-121 4.275 0.0 0.0 0.0 0.0 122-123 4.75 0.0 0.0 0.0 0.0 124-125 5.35 0.0 0.0 0.0 0.0 126-127 5.825 0.0 0.0 0.0 0.0 128-129 6.4625 0.0 0.0 0.0 0.0 130-131 7.0125 0.0 0.0 0.0 0.0 132-133 7.35 0.0 0.0 0.0 0.0 134-135 7.875 0.0 0.0 0.0 0.0 136-137 8.3125 0.0 0.0 0.0 0.0 138-139 9.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTAGTC 10 0.006830828 145.0 4 TTACTTA 10 0.006830828 145.0 7 TTATTTT 10 0.006830828 145.0 2 TTTTACT 10 0.006830828 145.0 5 ACTTATT 10 0.006830828 145.0 9 TATTTTA 10 0.006830828 145.0 3 TGCTAGT 10 0.006830828 145.0 3 TTTACTT 10 0.006830828 145.0 6 GTTATTT 10 0.006830828 145.0 1 TACTTAT 10 0.006830828 145.0 8 ATTTTAC 10 0.006830828 145.0 4 GGGGGGG 75 0.0012377208 13.533334 140-144 >>END_MODULE Read 438888 spots for SRR18694374.sra Written 438888 spots for SRR18694374.sra Read 438888 spots for SRR18694374.sra Written 438888 spots for SRR18694374.sra Read 438888 spots for SRR18694374.sra Written 438888 spots for SRR18694374.sra Read 438888 spots for SRR18694374.sra Written 438888 spots for SRR18694374.sra Read 438888 spots for SRR18694374.sra Written 438888 spots for SRR18694374.sra Read 438888 spots for SRR18694374.sra Written 438888 spots for SRR18694374.sra Read 438888 spots for SRR18694374.sra Written 438888 spots for SRR18694374.sra Read 438888 spots for SRR18694374.sra Written 438888 spots for SRR18694374.sra Read 438888 spots for SRR18694374.sra Written 438888 spots for SRR18694374.sra Read 438888 spots for SRR18694374.sra Written 438888 spots for SRR18694374.sra Read 438905 spots for SRR18694374.sra Written 438905 spots for SRR18694374.sra Read 438888 spots for SRR18694374.sra Written 438888 spots for SRR18694374.sra Read 438888 spots for SRR18694374.sra Written 438888 spots for SRR18694374.sra Read 438888 spots for SRR18694374.sra Written 438888 spots for SRR18694374.sra Read 438888 spots for SRR18694374.sra Written 438888 spots for SRR18694374.sra Read 438888 spots for SRR18694374.sra Written 438888 spots for SRR18694374.sra Read 438888 spots for SRR18694374.sra Written 438888 spots for SRR18694374.sra Read 438888 spots for SRR18694374.sra Written 438888 spots for SRR18694374.sra Read 438888 spots for SRR18694374.sra Written 438888 spots for SRR18694374.sra Read 438888 spots for SRR18694374.sra Written 438888 spots for SRR18694374.sra SRR ids: ['SRR18694374.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ep803en8 SRR18694374.sra spots: 8777777 blocks: [[1, 438888], [438889, 877776], [877777, 1316664], [1316665, 1755552], [1755553, 2194440], [2194441, 2633328], [2633329, 3072216], [3072217, 3511104], [3511105, 3949992], [3949993, 4388880], [4388881, 4827768], [4827769, 5266656], [5266657, 5705544], [5705545, 6144432], [6144433, 6583320], [6583321, 7022208], [7022209, 7461096], [7461097, 7899984], [7899985, 8338872], [8338873, 8777777]] SRR18694374 file size 2963759 SRR18694374 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694374 SRR18694374_1.fastq SRR18694374_2.fastq Input file: SRR18694374_1.fastq Paired file: SRR18694374_2.fastq trimmed: SRR18694374-trimmed-pair1.fastq, SRR18694374-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:12:25 2024 >> started Tue Dec 10 06:12:36 2024 >> done (10.637s) 8777777 read pairs processed; of these: 94 ( 0.00%) short read pairs filtered out after trimming by size control 1902 ( 0.02%) empty read pairs filtered out after trimming by size control 8775781 (99.98%) read pairs available; of these: 1279177 (14.58%) trimmed read pairs available after processing 7496604 (85.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 11 0.00% 20 4 0.00% 21 14 0.00% 22 14 0.00% 23 11 0.00% 24 13 0.00% 25 12 0.00% 26 6 0.00% 27 17 0.00% 28 18 0.00% 29 13 0.00% 30 29 0.00% 31 20 0.00% 32 16 0.00% 33 12 0.00% 34 14 0.00% 35 33 0.00% 36 26 0.00% 37 17 0.00% 38 35 0.00% 39 23 0.00% 40 39 0.00% 41 28 0.00% 42 27 0.00% 43 45 0.00% 44 26 0.00% 45 30 0.00% 46 44 0.00% 47 47 0.00% 48 61 0.00% 49 59 0.00% 50 67 0.00% 51 85 0.00% 52 96 0.00% 53 78 0.00% 54 125 0.00% 55 124 0.00% 56 149 0.00% 57 135 0.00% 58 189 0.00% 59 182 0.00% 60 233 0.00% 61 269 0.00% 62 321 0.00% 63 364 0.00% 64 352 0.00% 65 430 0.00% 66 464 0.01% 67 541 0.01% 68 630 0.01% 69 739 0.01% 70 806 0.01% 71 923 0.01% 72 1044 0.01% 73 1121 0.01% 74 1272 0.01% 75 1417 0.02% 76 1460 0.02% 77 1682 0.02% 78 1848 0.02% 79 2206 0.03% 80 2259 0.03% 81 2760 0.03% 82 3034 0.03% 83 3311 0.04% 84 3689 0.04% 85 4049 0.05% 86 4468 0.05% 87 4454 0.05% 88 4942 0.06% 89 5109 0.06% 90 5526 0.06% 91 5970 0.07% 92 6561 0.07% 93 6867 0.08% 94 7211 0.08% 95 7789 0.09% 96 8127 0.09% 97 8731 0.10% 98 8809 0.10% 99 9367 0.11% 100 9755 0.11% 101 10311 0.12% 102 10941 0.12% 103 11428 0.13% 104 12147 0.14% 105 11955 0.14% 106 12811 0.15% 107 13063 0.15% 108 13421 0.15% 109 14359 0.16% 110 14413 0.16% 111 15160 0.17% 112 15533 0.18% 113 16171 0.18% 114 16962 0.19% 115 17797 0.20% 116 18405 0.21% 117 18950 0.22% 118 18845 0.21% 119 18989 0.22% 120 20269 0.23% 121 20448 0.23% 122 20884 0.24% 123 22118 0.25% 124 22346 0.25% 125 23286 0.27% 126 23480 0.27% 127 23262 0.27% 128 23786 0.27% 129 24901 0.28% 130 24950 0.28% 131 25422 0.29% 132 26394 0.30% 133 26651 0.30% 134 27035 0.31% 135 27701 0.32% 136 28572 0.33% 137 29261 0.33% 138 28823 0.33% 139 29611 0.34% 140 29707 0.34% 141 29674 0.34% 142 30612 0.35% 143 31737 0.36% 144 32223 0.37% 145 32587 0.37% 146 33203 0.38% 147 33708 0.38% 148 33807 0.39% 149 33799 0.39% 150 34345 0.39% 151 7496604 85.42% 8775781 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=12 prefix-density=0.95 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=30 fanout-score=14.28 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=4.9 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=3.76 fanout-score-rank=12 prefix-density=0.65 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=75.23 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.1 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGC SRR18694374 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:13:41 Started mapping on | Dec 10 06:13:41 Finished on | Dec 10 06:14:55 Mapping speed, Million of reads per hour | 426.93 Number of input reads | 8775781 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 7839589 Uniquely mapped reads % | 89.33% Average mapped length | 293.26 Number of splices: Total | 8021158 Number of splices: Annotated (sjdb) | 7544962 Number of splices: GT/AG | 7910512 Number of splices: GC/AG | 93138 Number of splices: AT/AC | 3359 Number of splices: Non-canonical | 14149 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.33 Insertion rate per base | 0.01% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 264026 % of reads mapped to multiple loci | 3.01% Number of reads mapped to too many loci | 41158 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.49% % of reads unmapped: other | 3.70% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 672166 672166 672166 N_multimapping 264026 264026 264026 N_noFeature 405821 7639813 462852 N_ambiguous 171646 1021 29241 UnstrandedReadsAssigned:7262122 PositiveStrandReadsAssigned:198755 NegativeStrandReadsAssigned:7347496 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694374 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694374-trimmed-pair1.fastq SRR18694374-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,775,781 reads, 7,491,224 reads pseudoaligned [quant] estimated average fragment length: 245.769 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,047 rounds 52973 SRR18694374.ke.tsv 35125 SRR18694374.se.tsv 88098 total ==> SRR18694374.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 691.638 0 0 PNS24247 1044 799.231 15.5734 3.68712 PNS24249 1928 1683.23 38.2052 4.29493 PNS24246 1044 799.231 15.5734 3.68712 PNS24248 1044 799.231 15.5734 3.68712 PNS24244 1471 1226.23 30.0746 4.64093 PNS24243 293 101.689 0 0 KQK14069 1603 1358.23 880.603 122.683 KQK14071 474 246.955 6.09393 4.66936 ==> SRR18694374.se.tsv <== BRADI_1g14170v3 909 BRADI_1g53295v3 44 BRADI_1g59795v3 211 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 83 BRADI_1g74790v3 46 BRADI_1g09890v3 0 BRADI_1g77505v3 93 BRADI_1g48960v3 0 SRR18694374 completed mapping pipeline successfully