Starting /dee2/code/volunteer_pipeline.sh SRR18694375 current disk space = 1525648822272 free memory = 1602345952 SRR18694375 SRAfilesize afef188dce6a4c93806139e935201fc7 SRR18694375.sra SRR18694375.sra file validated SRR18694375 is paired end SRR18694375 is conventional basespace SRR18694375 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694375_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1385 37.0 37.0 37.0 37.0 37.0 2 35.972 37.0 37.0 37.0 37.0 37.0 3 36.4295 37.0 37.0 37.0 37.0 37.0 4 36.4795 37.0 37.0 37.0 37.0 37.0 5 36.5855 37.0 37.0 37.0 37.0 37.0 6 36.515 37.0 37.0 37.0 37.0 37.0 7 36.494 37.0 37.0 37.0 37.0 37.0 8 36.62 37.0 37.0 37.0 37.0 37.0 9 36.5735 37.0 37.0 37.0 37.0 37.0 10-14 36.5875 37.0 37.0 37.0 37.0 37.0 15-19 36.5554 37.0 37.0 37.0 37.0 37.0 20-24 36.6306 37.0 37.0 37.0 37.0 37.0 25-29 36.5458 37.0 37.0 37.0 37.0 37.0 30-34 36.538199999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.653800000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.5621 37.0 37.0 37.0 37.0 37.0 45-49 36.3778 37.0 37.0 37.0 37.0 37.0 50-54 36.51649999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.4836 37.0 37.0 37.0 37.0 37.0 60-64 36.48780000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.267900000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.406000000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.4786 37.0 37.0 37.0 37.0 37.0 80-84 36.336 37.0 37.0 37.0 37.0 37.0 85-89 36.1906 37.0 37.0 37.0 37.0 37.0 90-94 35.3544 37.0 37.0 37.0 29.8 37.0 95-99 36.091699999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.117900000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.1613 37.0 37.0 37.0 37.0 37.0 110-114 36.1336 37.0 37.0 37.0 37.0 37.0 115-119 36.476600000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.4895 37.0 37.0 37.0 37.0 37.0 125-129 36.4636 37.0 37.0 37.0 37.0 37.0 130-134 36.44449999999999 37.0 37.0 37.0 37.0 37.0 135-139 36.3544 37.0 37.0 37.0 37.0 37.0 140-144 36.1896 37.0 37.0 37.0 37.0 37.0 145-149 36.146300000000004 37.0 37.0 37.0 37.0 37.0 150-151 33.673 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 3.0 25 1.0 26 1.0 27 2.0 28 3.0 29 8.0 30 9.0 31 15.0 32 30.0 33 79.0 34 123.0 35 313.0 36 3249.0 37 162.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.1 9.049999999999999 5.3 39.550000000000004 2 20.12072434607646 10.236418511066399 36.31790744466801 33.32494969818913 3 19.6 11.899999999999999 27.450000000000003 41.05 4 26.075 19.400000000000002 22.5 32.025 5 27.1 25.575 22.650000000000002 24.675 6 24.15 28.875 24.099999999999998 22.875 7 17.025000000000002 25.3 39.6 18.075 8 19.6 23.7 30.8 25.900000000000002 9 17.724999999999998 22.2 35.6 24.474999999999998 10-14 21.89 26.865 26.895000000000003 24.349999999999998 15-19 22.825 24.404999999999998 27.439999999999998 25.330000000000002 20-24 22.74 25.195 27.185 24.88 25-29 21.87 25.52 27.105 25.505 30-34 21.95 25.324999999999996 26.640000000000004 26.085 35-39 22.16 24.85 26.68 26.31 40-44 22.535 25.619999999999997 26.185000000000002 25.66 45-49 22.575 25.44 26.77 25.215 50-54 22.8 25.155 26.57 25.474999999999998 55-59 22.035 25.77 26.584999999999997 25.61 60-64 22.165000000000003 24.57 27.445000000000004 25.82 65-69 21.755 24.895 27.415 25.935000000000002 70-74 22.025 25.14 26.965 25.869999999999997 75-79 22.75 25.28 26.540000000000003 25.430000000000003 80-84 22.065 24.355 27.405 26.174999999999997 85-89 22.009999999999998 25.224999999999998 26.815 25.95 90-94 22.695 24.915000000000003 26.71 25.679999999999996 95-99 21.884999999999998 25.235000000000003 26.779999999999998 26.1 100-104 22.314999999999998 25.31 26.405 25.97 105-109 22.55 24.575 26.465 26.41 110-114 23.0 25.355 26.195 25.45 115-119 22.36 26.045 25.580000000000002 26.015 120-124 22.869999999999997 25.729999999999997 26.575 24.825 125-129 22.455 25.835 26.045 25.665 130-134 22.95 25.535000000000004 25.405 26.11 135-139 22.665 25.990000000000002 25.96 25.385 140-144 23.51 25.16 25.22 26.11 145-149 22.97 25.775 25.77 25.485000000000003 150-151 22.3 25.674999999999997 25.4625 26.5625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 2.0 26 3.5 27 3.5 28 3.5 29 7.0 30 10.5 31 11.0 32 15.0 33 20.5 34 34.0 35 50.5 36 65.5 37 73.5 38 89.0 39 110.0 40 130.5 41 145.5 42 160.5 43 181.5 44 187.0 45 190.5 46 199.5 47 202.5 48 196.0 49 185.0 50 182.0 51 184.5 52 157.5 53 131.5 54 129.0 55 118.5 56 106.0 57 93.5 58 80.5 59 69.0 60 59.5 61 49.5 62 44.5 63 48.0 64 39.0 65 32.5 66 33.0 67 31.5 68 28.0 69 20.5 70 16.5 71 14.5 72 14.0 73 10.0 74 6.0 75 6.5 76 5.0 77 3.5 78 2.0 79 2.0 80 2.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.6 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.825 #Duplication Level Percentage of deduplicated Percentage of total 1 85.23710110348941 71.45 2 11.720847002684163 19.650000000000002 3 2.3560990158067403 5.925 4 0.3877124962719952 1.3 5 0.08947211452430659 0.375 6 0.11929615269907547 0.6 7 0.05964807634953773 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.029824038174768867 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCCTTTAATCACACAGACATATTTGAAATAAGAAACTGCAATTGGCTC 14 0.35000000000000003 No Hit GTCGTCTGCAAAGGATTTATCCCCTCCAAAATCTAATATTATCTTTCGTC 7 0.17500000000000002 No Hit GCCGCAGGCTCCACGCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTT 7 0.17500000000000002 No Hit GTCCCTCTAAGAAGCTAGCTGCGGAGGGATGGCTCCGCATAGCTAGTTAG 6 0.15 No Hit CTCCACTTCAGTCTTCAAAGTTCTCATTTGAATATTTGCTACTACCACCA 6 0.15 No Hit GGTGTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGC 6 0.15 No Hit TATTTTTTGAGTGGAGGTGATGGTTTGTTGAATGGCTTTTTGGATGGCGT 6 0.15 No Hit CCGGGACCAGCTTCGAGGTGAGTTGGCTTGCCTGGTTGAACACCTCGTTC 5 0.125 No Hit GTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTCGCAGTTGTTCGT 5 0.125 No Hit GCTTCACAATGATAGGAAGAGCCGACATCGAAGGATCAAAAAGCAACGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.23750000000000002 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 1.0499999999999998 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.2 0.0 0.0 0.0 0.0 110-111 1.3250000000000002 0.0 0.0 0.0 0.0 112-113 1.45 0.0 0.0 0.0 0.0 114-115 1.6125 0.0 0.0 0.0 0.0 116-117 1.8125 0.0 0.0 0.0 0.0 118-119 2.0625 0.0 0.0 0.0 0.0 120-121 2.2875 0.0 0.0 0.0 0.0 122-123 2.4875 0.0 0.0 0.0 0.0 124-125 2.9125 0.0 0.0 0.0 0.0 126-127 3.2375 0.0 0.0 0.0 0.0 128-129 3.5374999999999996 0.0 0.0 0.0 0.0 130-131 3.9125 0.0 0.0 0.0 0.0 132-133 4.3125 0.0 0.0 0.0 0.0 134-135 4.625 0.0 0.0 0.0 0.0 136-137 5.025 0.0 0.0 0.0 0.0 138-139 5.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATGGAA 10 0.006830828 145.0 8 >>END_MODULE SRR18694375 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694375_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.084 37.0 37.0 37.0 25.0 37.0 2 34.925 37.0 37.0 37.0 25.0 37.0 3 35.0065 37.0 37.0 37.0 25.0 37.0 4 35.2 37.0 37.0 37.0 25.0 37.0 5 34.9305 37.0 37.0 37.0 25.0 37.0 6 35.1445 37.0 37.0 37.0 25.0 37.0 7 35.1505 37.0 37.0 37.0 25.0 37.0 8 35.4185 37.0 37.0 37.0 37.0 37.0 9 35.353 37.0 37.0 37.0 37.0 37.0 10-14 35.4331 37.0 37.0 37.0 37.0 37.0 15-19 35.499300000000005 37.0 37.0 37.0 37.0 37.0 20-24 35.3787 37.0 37.0 37.0 34.6 37.0 25-29 35.477799999999995 37.0 37.0 37.0 34.6 37.0 30-34 35.6736 37.0 37.0 37.0 37.0 37.0 35-39 35.547999999999995 37.0 37.0 37.0 34.6 37.0 40-44 35.27139999999999 37.0 37.0 37.0 29.8 37.0 45-49 35.4406 37.0 37.0 37.0 34.6 37.0 50-54 34.8392 37.0 37.0 37.0 29.4 37.0 55-59 34.2196 37.0 37.0 37.0 25.0 37.0 60-64 34.984500000000004 37.0 37.0 37.0 27.4 37.0 65-69 34.19109999999999 37.0 34.6 37.0 27.4 37.0 70-74 33.0155 37.0 29.8 37.0 25.0 37.0 75-79 33.4564 37.0 34.6 37.0 22.2 37.0 80-84 34.4091 37.0 37.0 37.0 25.0 37.0 85-89 32.6033 37.0 32.2 37.0 19.4 37.0 90-94 34.0213 37.0 37.0 37.0 25.0 37.0 95-99 33.760799999999996 37.0 37.0 37.0 25.0 37.0 100-104 33.3514 37.0 37.0 37.0 25.0 37.0 105-109 34.045100000000005 37.0 37.0 37.0 25.0 37.0 110-114 34.436899999999994 37.0 37.0 37.0 25.0 37.0 115-119 34.3786 37.0 37.0 37.0 25.0 37.0 120-124 33.9962 37.0 37.0 37.0 25.0 37.0 125-129 33.9148 37.0 37.0 37.0 25.0 37.0 130-134 33.603699999999996 37.0 34.6 37.0 25.0 37.0 135-139 32.0356 37.0 25.0 37.0 13.8 37.0 140-144 31.5191 37.0 25.0 37.0 11.0 37.0 145-149 31.1646 37.0 25.0 37.0 11.0 37.0 150-151 30.7885 37.0 25.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 3.0 18 4.0 19 4.0 20 0.0 21 4.0 22 4.0 23 8.0 24 8.0 25 5.0 26 8.0 27 24.0 28 26.0 29 53.0 30 96.0 31 179.0 32 257.0 33 566.0 34 1152.0 35 1433.0 36 165.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.1 21.15 8.649999999999999 27.1 2 29.975 23.375 29.225 17.424999999999997 3 22.5 25.75 29.625 22.125 4 27.925 30.049999999999997 20.95 21.075 5 28.625 33.95 18.775 18.65 6 23.1 35.825 19.725 21.349999999999998 7 23.150000000000002 21.375 33.550000000000004 21.925 8 24.075 24.625 24.575 26.724999999999998 9 23.0 24.675 26.775 25.55 10-14 25.765 27.450000000000003 23.485 23.3 15-19 26.32 26.11 24.205 23.365 20-24 25.775 26.58 24.585 23.06 25-29 25.729999999999997 25.97 25.335 22.965 30-34 26.08 26.935 24.455 22.53 35-39 25.555 27.105 24.77 22.57 40-44 25.27 26.505000000000003 24.85 23.375 45-49 25.495 26.96 25.14 22.405 50-54 24.455 26.465 26.435 22.645 55-59 24.82 26.919999999999998 24.895 23.365 60-64 26.474999999999998 26.14 24.87 22.515 65-69 25.805 26.445 25.005 22.745 70-74 26.179999999999996 26.245 25.025 22.55 75-79 26.985 24.59 24.560000000000002 23.865 80-84 25.355 27.345000000000002 24.98 22.32 85-89 23.165 28.694999999999997 24.525 23.615 90-94 25.8 26.424999999999997 25.255 22.52 95-99 25.36 26.995 24.965 22.68 100-104 25.345000000000002 26.479999999999997 25.335 22.84 105-109 25.790000000000003 26.325 25.655 22.23 110-114 26.314999999999998 26.77 24.81 22.105 115-119 26.06 26.395000000000003 25.06 22.485 120-124 25.419999999999998 26.695 25.41 22.475 125-129 25.96 26.855 24.54 22.645 130-134 25.745 26.619999999999997 25.264999999999997 22.37 135-139 25.5 26.55 25.1 22.85 140-144 26.490000000000002 27.29 24.275 21.945 145-149 26.775 27.150000000000002 24.315 21.759999999999998 150-151 24.762500000000003 27.175 26.35 21.712500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 0.0 24 0.0 25 2.0 26 3.5 27 3.5 28 7.5 29 9.0 30 8.5 31 17.5 32 21.0 33 22.5 34 41.5 35 59.0 36 65.5 37 80.0 38 105.5 39 127.5 40 140.5 41 150.0 42 167.5 43 173.0 44 177.0 45 189.5 46 176.5 47 171.5 48 185.5 49 177.5 50 143.0 51 130.5 52 141.0 53 133.0 54 126.0 55 117.0 56 95.0 57 83.0 58 75.0 59 71.5 60 62.5 61 58.0 62 64.5 63 54.5 64 42.0 65 42.0 66 50.0 67 48.0 68 41.5 69 36.5 70 27.5 71 20.0 72 13.0 73 7.0 74 4.5 75 7.0 76 6.5 77 3.0 78 1.5 79 0.5 80 0.5 81 1.0 82 1.0 83 0.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 1.0 97 1.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 87.75332947307469 75.775 2 9.901563404748117 17.1 3 1.910828025477707 4.95 4 0.23161551823972204 0.8 5 0.028951939779965255 0.125 6 0.028951939779965255 0.15 7 0.05790387955993051 0.35000000000000003 8 0.0 0.0 9 0.028951939779965255 0.22499999999999998 >10 0.05790387955993051 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGACGACAATATGAGGCGCACAATAGCCAAAGCATGGACTGACGCTAG 11 0.27499999999999997 No Hit CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 10 0.25 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 9 0.22499999999999998 No Hit GGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCA 7 0.17500000000000002 No Hit AGGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGC 7 0.17500000000000002 No Hit AAAGTCTCTCCATCCTTGTAAATAAACTTGAAGGAGAAATCGATTATCTC 6 0.15 No Hit CGTCGATCAGGGTGTACGACACCGACGAGGCGGTCCTGAACTCGATGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.23750000000000002 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 1.0499999999999998 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.2 0.0 0.0 0.0 0.0 110-111 1.3250000000000002 0.0 0.0 0.0 0.0 112-113 1.45 0.0 0.0 0.0 0.0 114-115 1.6125 0.0 0.0 0.0 0.0 116-117 1.8125 0.0 0.0 0.0 0.0 118-119 2.0625 0.0 0.0 0.0 0.0 120-121 2.2875 0.0 0.0 0.0 0.0 122-123 2.4875 0.0 0.0 0.0 0.0 124-125 2.9125 0.0 0.0 0.0 0.0 126-127 3.2375 0.0 0.0 0.0 0.0 128-129 3.55 0.0 0.0 0.0 0.0 130-131 3.9375 0.0 0.0 0.0 0.0 132-133 4.3375 0.0 0.0 0.0 0.0 134-135 4.65 0.0 0.0 0.0 0.0 136-137 5.050000000000001 0.0 0.0 0.0 0.0 138-139 5.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCTGG 10 0.006830828 145.0 1 >>END_MODULE Read 797459 spots for SRR18694375.sra Written 797459 spots for SRR18694375.sra Read 797459 spots for SRR18694375.sra Written 797459 spots for SRR18694375.sra Read 797459 spots for SRR18694375.sra Written 797459 spots for SRR18694375.sra Read 797459 spots for SRR18694375.sra Written 797459 spots for SRR18694375.sra Read 797459 spots for SRR18694375.sra Written 797459 spots for SRR18694375.sra Read 797459 spots for SRR18694375.sra Written 797459 spots for SRR18694375.sra Read 797459 spots for SRR18694375.sra Written 797459 spots for SRR18694375.sra Read 797459 spots for SRR18694375.sra Written 797459 spots for SRR18694375.sra Read 797459 spots for SRR18694375.sra Written 797459 spots for SRR18694375.sra Read 797459 spots for SRR18694375.sra Written 797459 spots for SRR18694375.sra Read 797459 spots for SRR18694375.sra Written 797459 spots for SRR18694375.sra Read 797459 spots for SRR18694375.sra Written 797459 spots for SRR18694375.sra Read 797459 spots for SRR18694375.sra Written 797459 spots for SRR18694375.sra Read 797472 spots for SRR18694375.sra Written 797472 spots for SRR18694375.sra Read 797459 spots for SRR18694375.sra Written 797459 spots for SRR18694375.sra Read 797459 spots for SRR18694375.sra Written 797459 spots for SRR18694375.sra Read 797459 spots for SRR18694375.sra Written 797459 spots for SRR18694375.sra Read 797459 spots for SRR18694375.sra Written 797459 spots for SRR18694375.sra Read 797459 spots for SRR18694375.sra Written 797459 spots for SRR18694375.sra Read 797459 spots for SRR18694375.sra Written 797459 spots for SRR18694375.sra SRR ids: ['SRR18694375.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7fz1tsow SRR18694375.sra spots: 15949193 blocks: [[1, 797459], [797460, 1594918], [1594919, 2392377], [2392378, 3189836], [3189837, 3987295], [3987296, 4784754], [4784755, 5582213], [5582214, 6379672], [6379673, 7177131], [7177132, 7974590], [7974591, 8772049], [8772050, 9569508], [9569509, 10366967], [10366968, 11164426], [11164427, 11961885], [11961886, 12759344], [12759345, 13556803], [13556804, 14354262], [14354263, 15151721], [15151722, 15949193]] SRR18694375 file size 5398533 SRR18694375 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694375 SRR18694375_1.fastq SRR18694375_2.fastq Input file: SRR18694375_1.fastq Paired file: SRR18694375_2.fastq trimmed: SRR18694375-trimmed-pair1.fastq, SRR18694375-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:13:41 2024 >> started Tue Dec 10 06:13:58 2024 >> done (17.522s) 15949193 read pairs processed; of these: 97 ( 0.00%) short read pairs filtered out after trimming by size control 2722 ( 0.02%) empty read pairs filtered out after trimming by size control 15946374 (99.98%) read pairs available; of these: 1432000 ( 8.98%) trimmed read pairs available after processing 14514374 (91.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 14 0.00% 20 9 0.00% 21 14 0.00% 22 19 0.00% 23 22 0.00% 24 20 0.00% 25 19 0.00% 26 25 0.00% 27 19 0.00% 28 32 0.00% 29 34 0.00% 30 20 0.00% 31 36 0.00% 32 28 0.00% 33 27 0.00% 34 32 0.00% 35 33 0.00% 36 41 0.00% 37 30 0.00% 38 31 0.00% 39 37 0.00% 40 44 0.00% 41 42 0.00% 42 50 0.00% 43 42 0.00% 44 46 0.00% 45 53 0.00% 46 48 0.00% 47 55 0.00% 48 66 0.00% 49 77 0.00% 50 59 0.00% 51 93 0.00% 52 80 0.00% 53 99 0.00% 54 114 0.00% 55 106 0.00% 56 84 0.00% 57 134 0.00% 58 154 0.00% 59 135 0.00% 60 159 0.00% 61 197 0.00% 62 260 0.00% 63 222 0.00% 64 255 0.00% 65 273 0.00% 66 290 0.00% 67 314 0.00% 68 369 0.00% 69 460 0.00% 70 458 0.00% 71 543 0.00% 72 648 0.00% 73 716 0.00% 74 829 0.01% 75 854 0.01% 76 988 0.01% 77 1082 0.01% 78 1190 0.01% 79 1325 0.01% 80 1531 0.01% 81 1798 0.01% 82 1966 0.01% 83 2078 0.01% 84 2339 0.01% 85 2531 0.02% 86 2908 0.02% 87 3090 0.02% 88 3271 0.02% 89 3758 0.02% 90 3962 0.02% 91 4352 0.03% 92 4694 0.03% 93 5192 0.03% 94 5629 0.04% 95 6003 0.04% 96 6605 0.04% 97 6806 0.04% 98 7251 0.05% 99 7822 0.05% 100 8417 0.05% 101 8327 0.05% 102 9096 0.06% 103 9996 0.06% 104 10266 0.06% 105 10463 0.07% 106 10879 0.07% 107 12173 0.08% 108 12156 0.08% 109 12866 0.08% 110 13175 0.08% 111 13849 0.09% 112 14729 0.09% 113 15346 0.10% 114 16269 0.10% 115 17243 0.11% 116 17868 0.11% 117 18725 0.12% 118 19247 0.12% 119 20060 0.13% 120 21324 0.13% 121 21132 0.13% 122 22330 0.14% 123 23755 0.15% 124 24927 0.16% 125 25147 0.16% 126 26301 0.16% 127 26906 0.17% 128 27407 0.17% 129 29111 0.18% 130 29185 0.18% 131 29666 0.19% 132 31206 0.20% 133 32073 0.20% 134 33003 0.21% 135 33172 0.21% 136 35025 0.22% 137 36112 0.23% 138 36509 0.23% 139 38141 0.24% 140 39097 0.25% 141 39602 0.25% 142 41363 0.26% 143 41759 0.26% 144 43284 0.27% 145 43040 0.27% 146 44540 0.28% 147 46704 0.29% 148 46158 0.29% 149 47575 0.30% 150 48142 0.30% 151 14514374 91.02% 15946374 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=4.98 fanout-score-rank=8 prefix-density=1.25 prefix-fanout=2.6 sequence=ATCTTTCCCTCATCAACTTCAGCAGGTAATCGGATGGATCTGCGATAACG criterion=fanout-score sequence-density=0.04 sequence-density-rank=35 fanout-score=10.86 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=1.4 sequence=GCATCGCCGGCCCCCATCCGCTTCCCTCCCGGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTCGCTATCGGTCTCTCGCCTGTATTTAGCCTTGGACGGAGTCTACCGCCCGATTTGGGCTGCATTCCCAAACAACCCGACTCGTTGACGGCGCCTCGTGGGGCGACAGGGTCCGGGCCGGACGGGGCTCTCACCCTCCCAGGCGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGTCGCTGAGGACGCCTCTCCAGACTACAATTCGGACGGCACGGCCGCCCGATTCTCAAGCTGGGCTGCTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTCTCCTCCGCTTATTTATATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTG criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=4.28 fanout-score-rank=11 prefix-density=0.89 prefix-fanout=3.3 sequence=CCTTATCCAAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=31.35 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.8 sequence=GAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCATGCCTTACACATGCAAGTCGAACGGTAACAGGTTAAGCTGACGAGTGGCGAACGGGTGAGTAATGTATCGGAACGTGCCCAGTAGTGGGGGATAGCCCGGCGAAAGCCGGATTAATACCGCATACGACCTACGGGTGAAAGGGGGGGATCGCAAGACCTCTCGCTATTGGAGCGGCCGATATCAGATTAGGTAGTTGGTGGGGTAAAGGCCCACCA SRR18694375 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:15:07 Started mapping on | Dec 10 06:15:07 Finished on | Dec 10 06:24:26 Mapping speed, Million of reads per hour | 102.70 Number of input reads | 15946374 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 10231466 Uniquely mapped reads % | 64.16% Average mapped length | 296.18 Number of splices: Total | 8538755 Number of splices: Annotated (sjdb) | 7768064 Number of splices: GT/AG | 8424007 Number of splices: GC/AG | 90341 Number of splices: AT/AC | 903 Number of splices: Non-canonical | 23504 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.02% Deletion average length | 2.31 Insertion rate per base | 0.01% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 276945 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 199510 % of reads mapped to too many loci | 1.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 18.46% % of reads unmapped: other | 14.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5437963 5437963 5437963 N_multimapping 276945 276945 276945 N_noFeature 1190623 9860728 1414662 N_ambiguous 179924 1672 33172 UnstrandedReadsAssigned:8860919 PositiveStrandReadsAssigned:369066 NegativeStrandReadsAssigned:8783632 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694375 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694375-trimmed-pair1.fastq SRR18694375-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,946,374 reads, 9,043,496 reads pseudoaligned [quant] estimated average fragment length: 260.904 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52973 SRR18694375.ke.tsv 35125 SRR18694375.se.tsv 88098 total ==> SRR18694375.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 676.746 21.7231 5.69413 PNS24247 1044 784.096 42.9072 9.70716 PNS24249 1928 1668.1 81.5193 8.66905 PNS24246 1044 784.096 42.9072 9.70716 PNS24248 1044 784.096 42.9072 9.70716 PNS24244 1471 1211.1 61.0361 8.94005 PNS24243 293 91.2343 0 0 KQK14069 1603 1343.1 61.2063 8.08389 KQK14071 474 235.211 0 0 ==> SRR18694375.se.tsv <== BRADI_1g14170v3 62 BRADI_1g53295v3 730 BRADI_1g59795v3 188 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 31 BRADI_1g74790v3 1654 BRADI_1g09890v3 0 BRADI_1g77505v3 25 BRADI_1g48960v3 0 SRR18694375 completed mapping pipeline successfully