Starting /dee2/code/volunteer_pipeline.sh SRR18694376 current disk space = 1525745401856 free memory = 1557569296 SRR18694376 SRAfilesize 7df23063bfc5bfbabaf1ce83cd6da4d9 SRR18694376.sra SRR18694376.sra file validated SRR18694376 is paired end SRR18694376 is conventional basespace SRR18694376 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694376_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1265 37.0 37.0 37.0 37.0 37.0 2 36.0475 37.0 37.0 37.0 37.0 37.0 3 36.403 37.0 37.0 37.0 37.0 37.0 4 36.464 37.0 37.0 37.0 37.0 37.0 5 36.543 37.0 37.0 37.0 37.0 37.0 6 36.5335 37.0 37.0 37.0 37.0 37.0 7 36.526 37.0 37.0 37.0 37.0 37.0 8 36.576 37.0 37.0 37.0 37.0 37.0 9 36.623 37.0 37.0 37.0 37.0 37.0 10-14 36.632 37.0 37.0 37.0 37.0 37.0 15-19 36.6222 37.0 37.0 37.0 37.0 37.0 20-24 36.6408 37.0 37.0 37.0 37.0 37.0 25-29 36.5817 37.0 37.0 37.0 37.0 37.0 30-34 36.54600000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.659 37.0 37.0 37.0 37.0 37.0 40-44 36.585 37.0 37.0 37.0 37.0 37.0 45-49 36.37660000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.474900000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.49209999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.4638 37.0 37.0 37.0 37.0 37.0 65-69 36.2667 37.0 37.0 37.0 37.0 37.0 70-74 36.411 37.0 37.0 37.0 37.0 37.0 75-79 36.486000000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.3906 37.0 37.0 37.0 37.0 37.0 85-89 36.1949 37.0 37.0 37.0 37.0 37.0 90-94 35.407300000000006 37.0 37.0 37.0 29.8 37.0 95-99 36.132099999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.139399999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.171 37.0 37.0 37.0 37.0 37.0 110-114 36.2405 37.0 37.0 37.0 37.0 37.0 115-119 36.4685 37.0 37.0 37.0 37.0 37.0 120-124 36.513099999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.488099999999996 37.0 37.0 37.0 37.0 37.0 130-134 36.4525 37.0 37.0 37.0 37.0 37.0 135-139 36.368 37.0 37.0 37.0 37.0 37.0 140-144 36.193 37.0 37.0 37.0 37.0 37.0 145-149 36.064800000000005 37.0 37.0 37.0 37.0 37.0 150-151 33.6505 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 2.0 26 0.0 27 1.0 28 2.0 29 5.0 30 12.0 31 14.0 32 26.0 33 60.0 34 122.0 35 370.0 36 3208.0 37 175.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.8 9.700000000000001 5.3 35.199999999999996 2 22.889447236180903 9.045226130653267 34.095477386934675 33.969849246231156 3 20.1 16.125 25.6 38.175 4 24.45 22.225 22.900000000000002 30.425 5 26.35 27.950000000000003 23.925 21.775 6 24.025 29.65 24.375 21.95 7 18.099999999999998 23.425 40.949999999999996 17.525 8 19.400000000000002 23.075000000000003 30.975 26.55 9 19.625 20.525 34.375 25.474999999999998 10-14 22.32 26.090000000000003 26.590000000000003 25.0 15-19 23.080000000000002 24.695 26.685 25.540000000000003 20-24 22.830000000000002 25.36 26.71 25.1 25-29 21.884999999999998 25.345000000000002 26.419999999999998 26.35 30-34 22.935 24.605 26.674999999999997 25.785000000000004 35-39 22.405 25.674999999999997 25.855 26.064999999999998 40-44 22.46 25.3 26.640000000000004 25.6 45-49 22.55 24.375 26.72 26.355 50-54 22.98 25.009999999999998 26.384999999999998 25.624999999999996 55-59 22.205 25.88 25.705 26.21 60-64 22.32 25.56 26.43 25.69 65-69 22.42 25.11 26.3 26.169999999999998 70-74 22.615 25.245 26.195 25.945 75-79 23.05 25.324999999999996 26.02 25.605 80-84 23.06 24.635 25.7 26.605 85-89 22.905 25.624999999999996 26.040000000000003 25.430000000000003 90-94 22.6 24.66 26.295 26.445 95-99 22.994999999999997 24.765 25.569999999999997 26.669999999999998 100-104 21.955 26.115 26.27 25.66 105-109 23.305 25.119999999999997 25.595000000000002 25.979999999999997 110-114 23.015 25.775 25.335 25.874999999999996 115-119 23.150000000000002 25.115 26.255 25.480000000000004 120-124 23.435 25.074999999999996 25.314999999999998 26.174999999999997 125-129 23.5 25.25 25.205 26.045 130-134 23.25 25.52 25.259999999999998 25.97 135-139 23.31 25.44 25.14 26.11 140-144 23.625 25.825 24.82 25.729999999999997 145-149 23.51 25.564999999999998 24.745 26.179999999999996 150-151 24.05 26.1 25.4 24.45 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 0.0 24 0.5 25 1.5 26 1.0 27 2.0 28 5.5 29 4.5 30 5.5 31 13.5 32 19.5 33 21.0 34 34.0 35 45.0 36 43.5 37 60.5 38 77.5 39 86.5 40 106.5 41 118.5 42 144.5 43 189.5 44 194.5 45 200.5 46 209.5 47 193.5 48 207.5 49 201.0 50 173.0 51 167.5 52 153.5 53 144.0 54 141.5 55 125.0 56 109.5 57 99.0 58 96.0 59 82.5 60 69.0 61 59.5 62 44.5 63 41.5 64 41.5 65 49.5 66 43.5 67 36.0 68 30.0 69 25.0 70 25.5 71 15.5 72 9.0 73 7.0 74 6.0 75 6.0 76 5.0 77 1.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 85.66736339205733 71.72500000000001 2 10.988354732756047 18.4 3 2.299193789190803 5.775 4 0.686772170797253 2.3 5 0.17915795759928338 0.75 6 0.059719319199761124 0.3 7 0.08957897879964169 0.525 8 0.0 0.0 9 0.029859659599880562 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTT 9 0.22499999999999998 No Hit GTGTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCT 7 0.17500000000000002 No Hit CTTTTGTTCCACACGAGATTTCTGTTCTCGTTGAGCTCATCTTAGGACAC 7 0.17500000000000002 No Hit GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 7 0.17500000000000002 No Hit GTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCAC 6 0.15 No Hit GGGGCCGTGTCTCAGTCCCAGTGTGGCTGGTCGTCCTCTCAGACCAGCTA 6 0.15 No Hit GGTGTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGC 5 0.125 No Hit CGTCAATCTTGACCCAGGGGGCTGCCTTCGCCATCGGTGTTCCTCCACAT 5 0.125 No Hit TCATTTTCTGATTTATCGTAGTCCTTGTCAAGTGCTCGGAGTCCAAGTCT 5 0.125 No Hit GTACTTTTGGATTCATGTCCACTTGAAGGGACCTCGATATCCTTTGCATG 5 0.125 No Hit GTCAGCATTCGCACTTCTGATACCTCCAGCAGACCTCACGATCCACCTTC 5 0.125 No Hit CCCATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAGGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.025 0.0 0.0 3 0.0 0.0 0.025 0.0 0.0 4 0.0 0.0 0.025 0.0 0.0 5 0.0 0.0 0.025 0.0 0.0 6 0.0 0.0 0.025 0.0 0.0 7 0.0 0.0 0.025 0.0 0.0 8 0.0 0.0 0.025 0.0 0.0 9 0.0 0.0 0.025 0.0 0.0 10-11 0.0 0.0 0.025 0.0 0.0 12-13 0.0 0.0 0.025 0.0 0.0 14-15 0.0 0.0 0.025 0.0 0.0 16-17 0.0 0.0 0.025 0.0 0.0 18-19 0.0 0.0 0.025 0.0 0.0 20-21 0.0 0.0 0.025 0.0 0.0 22-23 0.0 0.0 0.025 0.0 0.0 24-25 0.0 0.0 0.025 0.0 0.0 26-27 0.0 0.0 0.025 0.0 0.0 28-29 0.0 0.0 0.025 0.0 0.0 30-31 0.0 0.0 0.025 0.0 0.0 32-33 0.0 0.0 0.025 0.0 0.0 34-35 0.0 0.0 0.025 0.0 0.0 36-37 0.0 0.0 0.025 0.0 0.0 38-39 0.0 0.0 0.025 0.0 0.0 40-41 0.0 0.0 0.025 0.0 0.0 42-43 0.0 0.0 0.025 0.0 0.0 44-45 0.0 0.0 0.025 0.0 0.0 46-47 0.0 0.0 0.025 0.0 0.0 48-49 0.025 0.0 0.025 0.0 0.0 50-51 0.025 0.0 0.025 0.0 0.0 52-53 0.025 0.0 0.025 0.0 0.0 54-55 0.025 0.0 0.025 0.0 0.0 56-57 0.025 0.0 0.025 0.0 0.0 58-59 0.025 0.0 0.025 0.0 0.0 60-61 0.025 0.0 0.025 0.0 0.0 62-63 0.025 0.0 0.025 0.0 0.0 64-65 0.025 0.0 0.025 0.0 0.0 66-67 0.025 0.0 0.025 0.0 0.0 68-69 0.025 0.0 0.025 0.0 0.0 70-71 0.025 0.0 0.025 0.0 0.0 72-73 0.025 0.0 0.025 0.0 0.0 74-75 0.07500000000000001 0.0 0.025 0.0 0.0 76-77 0.15 0.0 0.025 0.0 0.0 78-79 0.2 0.0 0.025 0.0 0.0 80-81 0.225 0.0 0.025 0.0 0.0 82-83 0.225 0.0 0.025 0.0 0.0 84-85 0.25 0.0 0.025 0.0 0.0 86-87 0.275 0.0 0.025 0.0 0.0 88-89 0.3375 0.0 0.025 0.0 0.0 90-91 0.4 0.0 0.025 0.0 0.0 92-93 0.5375 0.0 0.025 0.0 0.0 94-95 0.75 0.0 0.025 0.0 0.0 96-97 0.9375 0.0 0.025 0.0 0.0 98-99 0.9874999999999999 0.0 0.025 0.0 0.0 100-101 1.2 0.0 0.025 0.0 0.0 102-103 1.4 0.0 0.025 0.0 0.0 104-105 1.6 0.0 0.025 0.0 0.0 106-107 1.75 0.0 0.025 0.0 0.0 108-109 2.1 0.0 0.025 0.0 0.0 110-111 2.5125 0.0 0.025 0.0 0.0 112-113 2.925 0.0 0.025 0.0 0.0 114-115 3.25 0.0 0.025 0.0 0.0 116-117 3.725 0.0 0.025 0.0 0.0 118-119 4.2125 0.0 0.025 0.0 0.0 120-121 4.6 0.0 0.025 0.0 0.0 122-123 5.050000000000001 0.0 0.025 0.0 0.0 124-125 5.362500000000001 0.0 0.025 0.0 0.0 126-127 5.8625 0.0 0.025 0.0 0.0 128-129 6.525 0.0 0.025 0.0 0.0 130-131 7.15 0.0 0.025 0.0 0.0 132-133 7.6625 0.0 0.025 0.0 0.0 134-135 8.1 0.0 0.025 0.0 0.0 136-137 8.662500000000001 0.0 0.025 0.0 0.0 138-139 9.4375 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18694376 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694376_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.1625 37.0 37.0 37.0 25.0 37.0 2 35.0665 37.0 37.0 37.0 25.0 37.0 3 35.251 37.0 37.0 37.0 25.0 37.0 4 35.0625 37.0 37.0 37.0 25.0 37.0 5 35.2945 37.0 37.0 37.0 25.0 37.0 6 35.359 37.0 37.0 37.0 25.0 37.0 7 35.3105 37.0 37.0 37.0 25.0 37.0 8 35.4075 37.0 37.0 37.0 37.0 37.0 9 35.444 37.0 37.0 37.0 37.0 37.0 10-14 35.56269999999999 37.0 37.0 37.0 37.0 37.0 15-19 35.579600000000006 37.0 37.0 37.0 37.0 37.0 20-24 35.341300000000004 37.0 37.0 37.0 34.6 37.0 25-29 35.5837 37.0 37.0 37.0 32.2 37.0 30-34 35.7661 37.0 37.0 37.0 37.0 37.0 35-39 35.5825 37.0 37.0 37.0 37.0 37.0 40-44 35.2982 37.0 37.0 37.0 29.8 37.0 45-49 35.4505 37.0 37.0 37.0 34.6 37.0 50-54 34.795399999999994 37.0 37.0 37.0 27.0 37.0 55-59 34.2657 37.0 37.0 37.0 25.0 37.0 60-64 35.0464 37.0 37.0 37.0 27.4 37.0 65-69 34.277100000000004 37.0 34.6 37.0 27.4 37.0 70-74 32.951800000000006 37.0 29.8 37.0 25.0 37.0 75-79 33.4993 37.0 34.6 37.0 22.2 37.0 80-84 34.4403 37.0 37.0 37.0 25.0 37.0 85-89 32.55929999999999 37.0 32.2 37.0 19.4 37.0 90-94 34.05630000000001 37.0 37.0 37.0 25.0 37.0 95-99 33.8705 37.0 37.0 37.0 25.0 37.0 100-104 33.3361 37.0 34.6 37.0 25.0 37.0 105-109 34.163799999999995 37.0 37.0 37.0 25.0 37.0 110-114 34.5355 37.0 37.0 37.0 25.0 37.0 115-119 34.405499999999996 37.0 37.0 37.0 25.0 37.0 120-124 34.0681 37.0 37.0 37.0 25.0 37.0 125-129 33.8885 37.0 37.0 37.0 25.0 37.0 130-134 33.6796 37.0 34.6 37.0 25.0 37.0 135-139 32.1796 37.0 27.4 37.0 13.8 37.0 140-144 31.412799999999997 37.0 25.0 37.0 11.0 37.0 145-149 31.0117 37.0 25.0 37.0 11.0 37.0 150-151 30.71425 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 4.0 17 3.0 18 6.0 19 2.0 20 6.0 21 5.0 22 4.0 23 3.0 24 7.0 25 8.0 26 8.0 27 17.0 28 19.0 29 44.0 30 77.0 31 167.0 32 266.0 33 557.0 34 1196.0 35 1406.0 36 194.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.175 22.25 7.55 24.025 2 33.95 22.7 25.45 17.9 3 23.150000000000002 25.3 29.575000000000003 21.975 4 25.45 31.8 21.099999999999998 21.65 5 29.075 35.475 16.375 19.075 6 23.799999999999997 36.85 19.375 19.975 7 22.925 20.775 34.300000000000004 22.0 8 23.849999999999998 22.85 27.075 26.224999999999998 9 23.95 22.625 26.150000000000002 27.275 10-14 26.545 26.58 23.549999999999997 23.325000000000003 15-19 26.400000000000002 26.334999999999997 24.02 23.244999999999997 20-24 26.275 25.44 24.89 23.395 25-29 26.715 26.145000000000003 24.715 22.425 30-34 25.629999999999995 25.91 25.295 23.165 35-39 26.055 26.495 24.065 23.385 40-44 26.345000000000002 25.46 24.91 23.285 45-49 25.965 26.435 24.58 23.02 50-54 24.175 26.44 26.275 23.11 55-59 25.445 26.615 24.47 23.47 60-64 26.02 25.124999999999996 25.705 23.150000000000002 65-69 26.27 25.874999999999996 24.495 23.36 70-74 26.43 25.61 24.959999999999997 23.0 75-79 27.189999999999998 24.615000000000002 25.215 22.98 80-84 26.174999999999997 26.474999999999998 24.375 22.975 85-89 23.555 28.804999999999996 24.77 22.869999999999997 90-94 26.884999999999998 26.465 23.91 22.74 95-99 25.885 26.57 24.455 23.09 100-104 25.72 26.445 25.06 22.775000000000002 105-109 25.66 26.35 25.155 22.835 110-114 26.064999999999998 26.56 24.75 22.625 115-119 26.795 26.945000000000004 24.125 22.134999999999998 120-124 26.72 25.795 24.985 22.5 125-129 27.165 26.165 24.79 21.88 130-134 27.450000000000003 26.655 24.205 21.69 135-139 27.295 26.72 24.3 21.685 140-144 28.22 27.155 23.115 21.51 145-149 28.07 26.83 23.76 21.34 150-151 26.487500000000004 26.5625 26.125 20.825 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.5 25 3.0 26 3.5 27 1.5 28 2.5 29 6.5 30 10.5 31 14.0 32 18.5 33 24.0 34 25.5 35 40.5 36 64.0 37 69.5 38 85.0 39 115.5 40 131.5 41 128.0 42 138.0 43 171.0 44 192.5 45 192.5 46 187.5 47 184.5 48 183.5 49 177.5 50 170.0 51 152.0 52 144.5 53 159.0 54 137.0 55 114.5 56 102.0 57 87.0 58 80.5 59 65.0 60 54.0 61 55.0 62 64.0 63 57.0 64 42.5 65 42.0 66 49.0 67 49.5 68 48.5 69 40.5 70 23.0 71 16.0 72 16.0 73 12.5 74 8.0 75 5.5 76 6.0 77 5.0 78 4.0 79 3.5 80 0.0 81 1.0 82 1.0 83 0.5 84 1.0 85 0.5 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 1.0 95 1.0 96 0.0 97 0.5 98 1.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.425 #Duplication Level Percentage of deduplicated Percentage of total 1 87.38659642961663 74.65 2 9.833187006145742 16.8 3 1.9315188762071993 4.95 4 0.46824700029265437 1.6 5 0.2048580626280363 0.8750000000000001 6 0.058530875036581796 0.3 7 0.058530875036581796 0.35000000000000003 8 0.0 0.0 9 0.029265437518290898 0.22499999999999998 >10 0.029265437518290898 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTGATCCTGGCTCAGATTGAACGCTGGCGGCATGCCTTACACATGCAA 10 0.25 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 9 0.22499999999999998 No Hit GTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGG 7 0.17500000000000002 No Hit GTTAGTTTTACCCTACTGATGACCGTGCCGCGATAGTAATTCAACCTAGT 7 0.17500000000000002 No Hit GGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCA 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CCCAGGGGTTCGGCAGCTCGGCGTGCTTCAGCCGCACGGCTTTCTCTGGC 5 0.125 No Hit GGCAACAAAGGGTCACAAATTTCCGAAAGTTCCATCTCACCAGTGAAGCC 5 0.125 No Hit GTGAAATACCACTACTTTTAACGTTATTTTACTTATTCCGTGGGTCGGAA 5 0.125 No Hit ACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTTGAT 5 0.125 No Hit GCGGTTTTGTAAGTCTGACGTGAAAGCCCCGGGCTTAACCTGGGAATTGC 5 0.125 No Hit AGGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGC 5 0.125 No Hit GGCTCAGACGAGCGCAGAAGTAAAGCATTAAGCGACTACAGGAAGAAGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.025 0.0 0.0 0.0 50-51 0.025 0.025 0.0 0.0 0.0 52-53 0.025 0.025 0.0 0.0 0.0 54-55 0.025 0.025 0.0 0.0 0.0 56-57 0.025 0.025 0.0 0.0 0.0 58-59 0.025 0.025 0.0 0.0 0.0 60-61 0.025 0.025 0.0 0.0 0.0 62-63 0.025 0.025 0.0 0.0 0.0 64-65 0.025 0.025 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.025 0.025 0.0 0.0 0.0 74-75 0.05 0.025 0.0 0.0 0.0 76-77 0.1 0.025 0.0 0.0 0.0 78-79 0.15 0.025 0.0 0.0 0.0 80-81 0.175 0.025 0.0 0.0 0.0 82-83 0.175 0.025 0.0 0.0 0.0 84-85 0.2 0.025 0.0 0.0 0.0 86-87 0.225 0.025 0.0 0.0 0.0 88-89 0.2875 0.025 0.0 0.0 0.0 90-91 0.35 0.025 0.0 0.0 0.0 92-93 0.4875 0.025 0.0 0.0 0.0 94-95 0.7 0.025 0.0 0.0 0.0 96-97 0.8875 0.025 0.0 0.0 0.0 98-99 0.9375 0.025 0.0 0.0 0.0 100-101 1.15 0.025 0.0 0.0 0.0 102-103 1.35 0.025 0.0 0.0 0.0 104-105 1.525 0.025 0.0 0.0 0.0 106-107 1.675 0.025 0.0 0.0 0.0 108-109 2.0125 0.025 0.0 0.0 0.0 110-111 2.4 0.025 0.0 0.0 0.0 112-113 2.825 0.025 0.0 0.0 0.0 114-115 3.15 0.025 0.0 0.0 0.0 116-117 3.625 0.025 0.0 0.0 0.0 118-119 4.15 0.025 0.0 0.0 0.0 120-121 4.525 0.025 0.0 0.0 0.0 122-123 4.9625 0.025 0.0 0.0 0.0 124-125 5.262499999999999 0.025 0.0 0.0 0.0 126-127 5.775 0.025 0.0 0.0 0.0 128-129 6.3625 0.025 0.0 0.0 0.0 130-131 6.975 0.025 0.0 0.0 0.0 132-133 7.4875 0.025 0.0 0.0 0.0 134-135 7.9 0.025 0.0 0.0 0.0 136-137 8.462499999999999 0.025 0.0 0.0 0.0 138-139 9.2125 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATAAT 10 0.006830828 145.0 1 >>END_MODULE Read 700362 spots for SRR18694376.sra Written 700362 spots for SRR18694376.sra Read 700362 spots for SRR18694376.sra Written 700362 spots for SRR18694376.sra Read 700362 spots for SRR18694376.sra Written 700362 spots for SRR18694376.sra Read 700362 spots for SRR18694376.sra Written 700362 spots for SRR18694376.sra Read 700362 spots for SRR18694376.sra Written 700362 spots for SRR18694376.sra Read 700362 spots for SRR18694376.sra Written 700362 spots for SRR18694376.sra Read 700362 spots for SRR18694376.sra Written 700362 spots for SRR18694376.sra Read 700362 spots for SRR18694376.sra Written 700362 spots for SRR18694376.sra Read 700362 spots for SRR18694376.sra Written 700362 spots for SRR18694376.sra Read 700362 spots for SRR18694376.sra Written 700362 spots for SRR18694376.sra Read 700362 spots for SRR18694376.sra Written 700362 spots for SRR18694376.sra Read 700362 spots for SRR18694376.sra Written 700362 spots for SRR18694376.sra Read 700362 spots for SRR18694376.sra Written 700362 spots for SRR18694376.sra Read 700362 spots for SRR18694376.sra Written 700362 spots for SRR18694376.sra Read 700362 spots for SRR18694376.sra Written 700362 spots for SRR18694376.sra Read 700362 spots for SRR18694376.sra Written 700362 spots for SRR18694376.sra Read 700362 spots for SRR18694376.sra Written 700362 spots for SRR18694376.sra Read 700362 spots for SRR18694376.sra Written 700362 spots for SRR18694376.sra Read 700362 spots for SRR18694376.sra Written 700362 spots for SRR18694376.sra Read 700362 spots for SRR18694376.sra Written 700362 spots for SRR18694376.sra SRR ids: ['SRR18694376.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5s672ww6 SRR18694376.sra spots: 14007240 blocks: [[1, 700362], [700363, 1400724], [1400725, 2101086], [2101087, 2801448], [2801449, 3501810], [3501811, 4202172], [4202173, 4902534], [4902535, 5602896], [5602897, 6303258], [6303259, 7003620], [7003621, 7703982], [7703983, 8404344], [8404345, 9104706], [9104707, 9805068], [9805069, 10505430], [10505431, 11205792], [11205793, 11906154], [11906155, 12606516], [12606517, 13306878], [13306879, 14007240]] SRR18694376 file size 4738572 SRR18694376 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694376 SRR18694376_1.fastq SRR18694376_2.fastq Input file: SRR18694376_1.fastq Paired file: SRR18694376_2.fastq trimmed: SRR18694376-trimmed-pair1.fastq, SRR18694376-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:15:14 2024 >> started Tue Dec 10 06:15:30 2024 >> done (15.670s) 14007240 read pairs processed; of these: 177 ( 0.00%) short read pairs filtered out after trimming by size control 5293 ( 0.04%) empty read pairs filtered out after trimming by size control 14001770 (99.96%) read pairs available; of these: 1919009 (13.71%) trimmed read pairs available after processing 12082761 (86.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 15 0.00% 20 15 0.00% 21 13 0.00% 22 18 0.00% 23 15 0.00% 24 12 0.00% 25 28 0.00% 26 19 0.00% 27 31 0.00% 28 23 0.00% 29 26 0.00% 30 36 0.00% 31 28 0.00% 32 41 0.00% 33 41 0.00% 34 34 0.00% 35 35 0.00% 36 37 0.00% 37 41 0.00% 38 40 0.00% 39 47 0.00% 40 51 0.00% 41 56 0.00% 42 61 0.00% 43 66 0.00% 44 31 0.00% 45 49 0.00% 46 56 0.00% 47 59 0.00% 48 92 0.00% 49 107 0.00% 50 94 0.00% 51 140 0.00% 52 123 0.00% 53 140 0.00% 54 132 0.00% 55 145 0.00% 56 176 0.00% 57 258 0.00% 58 227 0.00% 59 274 0.00% 60 305 0.00% 61 315 0.00% 62 364 0.00% 63 416 0.00% 64 506 0.00% 65 439 0.00% 66 546 0.00% 67 612 0.00% 68 710 0.01% 69 808 0.01% 70 934 0.01% 71 1118 0.01% 72 1292 0.01% 73 1457 0.01% 74 1573 0.01% 75 1792 0.01% 76 1978 0.01% 77 2116 0.02% 78 2323 0.02% 79 2585 0.02% 80 3078 0.02% 81 3386 0.02% 82 3804 0.03% 83 4278 0.03% 84 4808 0.03% 85 5071 0.04% 86 5797 0.04% 87 5966 0.04% 88 6284 0.04% 89 6891 0.05% 90 7613 0.05% 91 8060 0.06% 92 8843 0.06% 93 9766 0.07% 94 10190 0.07% 95 11010 0.08% 96 11529 0.08% 97 11466 0.08% 98 12139 0.09% 99 13210 0.09% 100 13633 0.10% 101 14337 0.10% 102 15483 0.11% 103 15960 0.11% 104 16843 0.12% 105 17099 0.12% 106 17622 0.13% 107 18544 0.13% 108 18876 0.13% 109 19785 0.14% 110 20967 0.15% 111 21648 0.15% 112 22906 0.16% 113 24167 0.17% 114 25005 0.18% 115 25714 0.18% 116 27183 0.19% 117 27052 0.19% 118 27630 0.20% 119 28187 0.20% 120 30182 0.22% 121 29270 0.21% 122 31319 0.22% 123 33443 0.24% 124 35091 0.25% 125 34664 0.25% 126 35485 0.25% 127 36409 0.26% 128 36508 0.26% 129 38001 0.27% 130 38278 0.27% 131 38332 0.27% 132 40682 0.29% 133 41922 0.30% 134 41673 0.30% 135 43353 0.31% 136 44862 0.32% 137 45653 0.33% 138 45164 0.32% 139 45462 0.32% 140 45517 0.33% 141 46768 0.33% 142 48711 0.35% 143 49405 0.35% 144 51681 0.37% 145 51438 0.37% 146 51995 0.37% 147 53661 0.38% 148 51519 0.37% 149 52757 0.38% 150 52836 0.38% 151 12082761 86.29% 14001770 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=4.99 fanout-score-rank=9 prefix-density=1.20 prefix-fanout=2.4 sequence=ATCTTTCCCTCATCAACTTCAGCAGGTAATCGGATGGATCTGCGATAACG criterion=fanout-score sequence-density=0.13 sequence-density-rank=26 fanout-score=14.41 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=1.8 sequence=GGTACTTGTTCACTATCGGTCGATTACGAGTATTTAGCCT criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=34 prefix-density=0.63 prefix-fanout=2.0 sequence=ACGTGAGCTGGGTTTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=103.59 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=2.9 sequence=GCCGCAAGGCGTGTCCCTCGGGGCACTGCGCTGCAACGGCCTGCGGGCTCCCCATCCGACCCGTCTTGAAACACGGACCAAGGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGGAAGCTGACGAGCGGGAGGCCCTCACGGGCCGCACCGCTGGCCGACCCTGATCTTCTGTGAAGGGTTCGAGTTGGAGCACGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGAAGCGATACTGACGTGCAAATCGTTCGTCTGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGAGCCCATTACGAGTTCTATCAGGTAAAGCCAATGATTAGAGGCATCGGGGGCGCAACGCCCTCGACCTATTCTCAAACTTTAAATAGGTAGGACGGCGCGGCTGCTCCGGTGAGCC SRR18694376 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:16:43 Started mapping on | Dec 10 06:16:43 Finished on | Dec 10 06:25:31 Mapping speed, Million of reads per hour | 95.47 Number of input reads | 14001770 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 8373382 Uniquely mapped reads % | 59.80% Average mapped length | 293.49 Number of splices: Total | 6782463 Number of splices: Annotated (sjdb) | 6158653 Number of splices: GT/AG | 6690390 Number of splices: GC/AG | 69858 Number of splices: AT/AC | 880 Number of splices: Non-canonical | 21335 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.02% Deletion average length | 2.25 Insertion rate per base | 0.01% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 231306 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 212644 % of reads mapped to too many loci | 1.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 20.93% % of reads unmapped: other | 16.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5397082 5397082 5397082 N_multimapping 231306 231306 231306 N_noFeature 1001846 8047692 1207087 N_ambiguous 147227 1435 26678 UnstrandedReadsAssigned:7224309 PositiveStrandReadsAssigned:324255 NegativeStrandReadsAssigned:7139617 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694376 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694376-trimmed-pair1.fastq SRR18694376-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,001,770 reads, 7,412,088 reads pseudoaligned [quant] estimated average fragment length: 248.48 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52973 SRR18694376.ke.tsv 35125 SRR18694376.se.tsv 88098 total ==> SRR18694376.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 688.98 76.1666 23.7275 PNS24247 1044 796.52 17.5615 4.73215 PNS24249 1928 1680.52 97.7476 12.4841 PNS24246 1044 796.52 17.5615 4.73215 PNS24248 1044 796.52 17.5615 4.73215 PNS24244 1471 1223.52 39.4014 6.91185 PNS24243 293 99.8885 1 2.14871 KQK14069 1603 1355.52 47.1993 7.47349 KQK14071 474 246.02 3.00074 2.61789 ==> SRR18694376.se.tsv <== BRADI_1g14170v3 56 BRADI_1g53295v3 757 BRADI_1g59795v3 160 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 22 BRADI_1g74790v3 1587 BRADI_1g09890v3 0 BRADI_1g77505v3 12 BRADI_1g48960v3 0 SRR18694376 completed mapping pipeline successfully