Starting /dee2/code/volunteer_pipeline.sh SRR18694377 current disk space = 1525756719104 free memory = 1557564912 SRR18694377 SRAfilesize b75756c320fc86339920f1700e0a977a SRR18694377.sra SRR18694377.sra file validated SRR18694377 is paired end SRR18694377 is conventional basespace SRR18694377 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694377_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.159 37.0 37.0 37.0 37.0 37.0 2 36.10325 37.0 37.0 37.0 37.0 37.0 3 36.4805 37.0 37.0 37.0 37.0 37.0 4 36.579 37.0 37.0 37.0 37.0 37.0 5 36.5785 37.0 37.0 37.0 37.0 37.0 6 36.5835 37.0 37.0 37.0 37.0 37.0 7 36.532 37.0 37.0 37.0 37.0 37.0 8 36.668 37.0 37.0 37.0 37.0 37.0 9 36.6445 37.0 37.0 37.0 37.0 37.0 10-14 36.6931 37.0 37.0 37.0 37.0 37.0 15-19 36.637600000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.6334 37.0 37.0 37.0 37.0 37.0 25-29 36.5973 37.0 37.0 37.0 37.0 37.0 30-34 36.535700000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.6894 37.0 37.0 37.0 37.0 37.0 40-44 36.6294 37.0 37.0 37.0 37.0 37.0 45-49 36.4563 37.0 37.0 37.0 37.0 37.0 50-54 36.53959999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.537400000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.516 37.0 37.0 37.0 37.0 37.0 65-69 36.3707 37.0 37.0 37.0 37.0 37.0 70-74 36.425 37.0 37.0 37.0 37.0 37.0 75-79 36.555899999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.4296 37.0 37.0 37.0 37.0 37.0 85-89 36.224 37.0 37.0 37.0 37.0 37.0 90-94 35.53439999999999 37.0 37.0 37.0 29.8 37.0 95-99 36.2393 37.0 37.0 37.0 37.0 37.0 100-104 36.207100000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.186400000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.2719 37.0 37.0 37.0 37.0 37.0 115-119 36.4765 37.0 37.0 37.0 37.0 37.0 120-124 36.6279 37.0 37.0 37.0 37.0 37.0 125-129 36.546800000000005 37.0 37.0 37.0 37.0 37.0 130-134 36.5178 37.0 37.0 37.0 37.0 37.0 135-139 36.3989 37.0 37.0 37.0 37.0 37.0 140-144 36.198 37.0 37.0 37.0 37.0 37.0 145-149 36.1562 37.0 37.0 37.0 37.0 37.0 150-151 33.671499999999995 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 1.0 26 0.0 27 2.0 28 3.0 29 3.0 30 8.0 31 9.0 32 30.0 33 52.0 34 104.0 35 348.0 36 3247.0 37 192.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.3 9.125 4.05 38.525 2 20.175658720200754 9.335006273525721 37.41530740276035 33.07402760351317 3 20.200000000000003 12.425 26.900000000000002 40.475 4 28.000000000000004 17.075000000000003 22.775000000000002 32.15 5 27.200000000000003 27.400000000000002 23.150000000000002 22.25 6 23.35 29.175 23.375 24.099999999999998 7 19.45 23.9 38.574999999999996 18.075 8 20.275000000000002 22.325 31.525 25.874999999999996 9 21.25 21.175 33.15 24.425 10-14 23.76 25.919999999999998 26.085 24.235 15-19 22.814999999999998 24.605 26.125 26.455000000000002 20-24 23.45 24.82 26.055 25.674999999999997 25-29 23.0 24.91 25.869999999999997 26.22 30-34 22.98 24.945 25.755 26.32 35-39 22.84 25.2 25.545 26.415 40-44 23.66 25.729999999999997 25.324999999999996 25.285000000000004 45-49 23.485 25.679999999999996 25.35 25.485000000000003 50-54 22.900000000000002 24.64 26.200000000000003 26.26 55-59 22.869999999999997 25.259999999999998 26.229999999999997 25.64 60-64 23.205000000000002 24.63 25.86 26.305 65-69 23.635 24.625 25.605 26.135 70-74 24.025 25.91 24.415 25.650000000000002 75-79 23.28 25.095 25.465 26.16 80-84 23.395 25.155 25.679999999999996 25.77 85-89 23.549999999999997 25.45 25.419999999999998 25.580000000000002 90-94 24.095 24.59 25.61 25.705 95-99 23.82 24.725 25.56 25.895000000000003 100-104 23.75 25.7 24.935 25.615 105-109 23.7 25.415 24.98 25.905 110-114 24.490000000000002 24.685000000000002 25.34 25.485000000000003 115-119 23.71 25.779999999999998 25.080000000000002 25.430000000000003 120-124 24.625 25.115 24.705 25.555 125-129 23.955000000000002 25.235000000000003 24.715 26.095000000000002 130-134 24.42 25.1 24.705 25.775 135-139 24.54 24.875 24.84 25.745 140-144 24.3 25.8 24.665 25.235000000000003 145-149 24.575 25.05 24.595 25.779999999999998 150-151 23.275000000000002 25.2375 24.7 26.787499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 0.0 25 1.0 26 2.0 27 1.5 28 2.5 29 5.5 30 7.5 31 11.5 32 14.5 33 16.5 34 22.5 35 33.0 36 39.0 37 57.0 38 73.0 39 93.5 40 110.0 41 126.5 42 160.0 43 171.0 44 168.0 45 196.0 46 212.0 47 194.5 48 192.0 49 180.5 50 162.5 51 154.0 52 144.0 53 135.0 54 124.0 55 120.5 56 121.5 57 107.5 58 100.0 59 94.0 60 79.5 61 59.5 62 63.0 63 71.0 64 63.0 65 57.0 66 48.5 67 41.5 68 35.5 69 29.5 70 26.0 71 18.5 72 12.5 73 13.0 74 10.5 75 7.0 76 3.0 77 1.0 78 1.5 79 1.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.325 #Duplication Level Percentage of deduplicated Percentage of total 1 87.14161598609904 75.225 2 10.454677092383434 18.05 3 1.9403417318273966 5.025 4 0.40544454097885896 1.4000000000000001 5 0.028960324355632783 0.125 6 0.0 0.0 7 0.028960324355632783 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 7 0.17500000000000002 No Hit GCCTTGCGACCATACTCCCCCCGGAACCCAAAGACTTTGATTTCTCATAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 1.05 0.0 0.0 0.0 0.0 102-103 1.1375 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.8250000000000002 0.0 0.0 0.0 0.0 110-111 2.1125 0.0 0.0 0.0 0.0 112-113 2.4124999999999996 0.0 0.0 0.0 0.0 114-115 2.6875 0.0 0.0 0.0 0.0 116-117 2.9 0.0 0.0 0.0 0.0 118-119 3.325 0.0 0.0 0.0 0.0 120-121 3.6625 0.0 0.0 0.0 0.0 122-123 3.8875 0.0 0.0 0.0 0.0 124-125 4.199999999999999 0.0 0.0 0.0 0.0 126-127 4.7875 0.0 0.0 0.0 0.0 128-129 5.35 0.0 0.0 0.0 0.0 130-131 5.8625 0.0 0.0 0.0 0.0 132-133 6.375 0.0 0.0 0.0 0.0 134-135 7.050000000000001 0.0 0.0 0.0 0.0 136-137 7.612500000000001 0.0 0.0 0.0 0.0 138-139 7.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACCAC 10 0.006830828 145.0 145 >>END_MODULE SRR18694377 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694377_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.6605 37.0 37.0 37.0 25.0 37.0 2 35.2515 37.0 37.0 37.0 25.0 37.0 3 35.4405 37.0 37.0 37.0 37.0 37.0 4 35.437 37.0 37.0 37.0 37.0 37.0 5 35.249 37.0 37.0 37.0 25.0 37.0 6 35.4325 37.0 37.0 37.0 37.0 37.0 7 35.3625 37.0 37.0 37.0 37.0 37.0 8 35.7125 37.0 37.0 37.0 37.0 37.0 9 35.7115 37.0 37.0 37.0 37.0 37.0 10-14 35.7461 37.0 37.0 37.0 37.0 37.0 15-19 35.8094 37.0 37.0 37.0 37.0 37.0 20-24 35.6295 37.0 37.0 37.0 37.0 37.0 25-29 35.7492 37.0 37.0 37.0 37.0 37.0 30-34 35.9485 37.0 37.0 37.0 37.0 37.0 35-39 35.7882 37.0 37.0 37.0 37.0 37.0 40-44 35.508799999999994 37.0 37.0 37.0 32.2 37.0 45-49 35.6673 37.0 37.0 37.0 37.0 37.0 50-54 35.146499999999996 37.0 37.0 37.0 32.2 37.0 55-59 34.4243 37.0 37.0 37.0 25.0 37.0 60-64 35.117200000000004 37.0 37.0 37.0 27.4 37.0 65-69 34.3481 37.0 34.6 37.0 27.4 37.0 70-74 33.087199999999996 37.0 29.8 37.0 22.2 37.0 75-79 33.610499999999995 37.0 34.6 37.0 22.2 37.0 80-84 34.6643 37.0 37.0 37.0 25.0 37.0 85-89 32.8257 37.0 32.2 37.0 19.4 37.0 90-94 34.2513 37.0 37.0 37.0 25.0 37.0 95-99 34.0859 37.0 37.0 37.0 25.0 37.0 100-104 33.6884 37.0 37.0 37.0 25.0 37.0 105-109 34.4068 37.0 37.0 37.0 25.0 37.0 110-114 34.664699999999996 37.0 37.0 37.0 25.0 37.0 115-119 34.5383 37.0 37.0 37.0 25.0 37.0 120-124 34.4496 37.0 37.0 37.0 25.0 37.0 125-129 34.2465 37.0 37.0 37.0 25.0 37.0 130-134 34.008300000000006 37.0 37.0 37.0 25.0 37.0 135-139 32.3438 37.0 27.4 37.0 16.6 37.0 140-144 32.0467 37.0 25.0 37.0 11.0 37.0 145-149 31.438599999999997 37.0 25.0 37.0 13.8 37.0 150-151 31.070500000000003 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 4.0 18 6.0 19 2.0 20 1.0 21 3.0 22 7.0 23 8.0 24 6.0 25 8.0 26 1.0 27 10.0 28 19.0 29 33.0 30 55.0 31 120.0 32 231.0 33 494.0 34 1121.0 35 1616.0 36 254.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.85 20.25 6.950000000000001 25.95 2 28.675 23.9 27.975 19.45 3 23.9 24.025 29.025000000000002 23.05 4 26.25 30.675 20.9 22.175 5 28.9 32.2 18.65 20.25 6 21.85 36.0 20.125 22.025 7 24.175 19.8 33.45 22.575 8 21.725 24.425 25.3 28.549999999999997 9 23.375 20.925 27.625 28.075 10-14 26.75 25.729999999999997 23.27 24.25 15-19 26.815 25.019999999999996 24.060000000000002 24.104999999999997 20-24 25.779999999999998 26.150000000000002 23.93 24.14 25-29 26.314999999999998 25.415 23.974999999999998 24.295 30-34 25.645 25.174999999999997 24.285 24.895 35-39 25.91 25.674999999999997 24.13 24.285 40-44 25.8 25.135 24.775 24.29 45-49 26.905 24.68 24.145 24.27 50-54 25.47 25.480000000000004 25.005 24.044999999999998 55-59 25.28 25.805 24.785 24.13 60-64 26.35 25.165 24.335 24.15 65-69 26.255 24.55 24.775 24.42 70-74 26.810000000000002 24.69 24.77 23.73 75-79 27.525 23.995 24.154999999999998 24.325 80-84 26.395000000000003 25.074999999999996 24.77 23.76 85-89 24.240000000000002 27.634999999999998 24.295 23.830000000000002 90-94 26.979999999999997 25.395 24.125 23.5 95-99 26.08 26.064999999999998 24.18 23.674999999999997 100-104 26.029999999999998 25.525 24.18 24.265 105-109 26.005 25.085 24.525 24.385 110-114 26.745 25.759999999999998 24.465 23.03 115-119 26.995 25.15 24.18 23.674999999999997 120-124 26.705000000000002 25.835 24.26 23.200000000000003 125-129 26.505000000000003 26.08 24.27 23.145 130-134 26.155 26.735 24.29 22.82 135-139 27.16 26.075 24.425 22.34 140-144 26.900000000000002 26.490000000000002 23.91 22.7 145-149 27.355 25.679999999999996 23.794999999999998 23.169999999999998 150-151 25.4875 25.7 27.237499999999997 21.575 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 2.5 22 2.5 23 1.0 24 0.5 25 1.0 26 2.0 27 2.0 28 4.5 29 7.5 30 7.0 31 7.0 32 13.5 33 20.0 34 27.5 35 35.5 36 37.0 37 48.5 38 70.5 39 88.5 40 108.0 41 125.5 42 140.0 43 161.0 44 168.0 45 174.0 46 181.0 47 172.0 48 171.5 49 171.5 50 161.5 51 150.5 52 136.0 53 132.0 54 142.5 55 135.0 56 109.0 57 92.0 58 97.5 59 101.5 60 92.0 61 91.5 62 87.0 63 76.5 64 69.5 65 59.0 66 51.5 67 55.5 68 52.5 69 42.5 70 30.5 71 22.0 72 17.0 73 8.5 74 5.0 75 2.5 76 2.5 77 2.5 78 1.0 79 2.5 80 2.0 81 1.0 82 1.5 83 1.5 84 1.0 85 1.0 86 1.0 87 0.0 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.5 98 1.0 99 1.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.125 #Duplication Level Percentage of deduplicated Percentage of total 1 87.97704447632711 76.64999999999999 2 10.071736011477762 17.549999999999997 3 1.3486370157819225 3.5249999999999995 4 0.4878048780487805 1.7000000000000002 5 0.0860832137733142 0.375 6 0.0 0.0 7 0.0 0.0 8 0.028694404591104734 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit GATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAAGTCG 5 0.125 No Hit GCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGA 5 0.125 No Hit GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.05 0.0 0.0 0.0 0.0 102-103 1.1375 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.8250000000000002 0.0 0.0 0.0 0.0 110-111 2.1125 0.0 0.0 0.0 0.0 112-113 2.4124999999999996 0.0 0.0 0.0 0.0 114-115 2.6875 0.0 0.0 0.0 0.0 116-117 2.925 0.0 0.0 0.0 0.0 118-119 3.3499999999999996 0.0 0.0 0.0 0.0 120-121 3.6875 0.0 0.0 0.0 0.0 122-123 3.9125 0.0 0.0 0.0 0.0 124-125 4.2125 0.0 0.0 0.0 0.0 126-127 4.7875 0.0 0.0 0.0 0.0 128-129 5.35 0.0 0.0 0.0 0.0 130-131 5.8375 0.0 0.0 0.0 0.0 132-133 6.35 0.0 0.0 0.0 0.0 134-135 7.0125 0.0 0.0 0.0 0.0 136-137 7.5625 0.0 0.0 0.0 0.0 138-139 7.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAACAG 10 0.006830828 145.0 8 TATAAAC 10 0.006830828 145.0 6 ATAAACA 10 0.006830828 145.0 7 TTGATCA 10 0.006830828 145.0 2 CTTGATC 10 0.006830828 145.0 1 GTTGTTG 10 0.006830828 145.0 3 ATATAAA 10 0.006830828 145.0 5 >>END_MODULE Read 577737 spots for SRR18694377.sra Written 577737 spots for SRR18694377.sra Read 577737 spots for SRR18694377.sra Written 577737 spots for SRR18694377.sra Read 577737 spots for SRR18694377.sra Written 577737 spots for SRR18694377.sra Read 577737 spots for SRR18694377.sra Written 577737 spots for SRR18694377.sra Read 577737 spots for SRR18694377.sra Written 577737 spots for SRR18694377.sra Read 577737 spots for SRR18694377.sra Written 577737 spots for SRR18694377.sra Read 577737 spots for SRR18694377.sra Written 577737 spots for SRR18694377.sra Read 577737 spots for SRR18694377.sra Written 577737 spots for SRR18694377.sra Read 577737 spots for SRR18694377.sra Written 577737 spots for SRR18694377.sra Read 577737 spots for SRR18694377.sra Written 577737 spots for SRR18694377.sra Read 577737 spots for SRR18694377.sra Written 577737 spots for SRR18694377.sra Read 577737 spots for SRR18694377.sra Written 577737 spots for SRR18694377.sra Read 577737 spots for SRR18694377.sra Written 577737 spots for SRR18694377.sra Read 577737 spots for SRR18694377.sra Written 577737 spots for SRR18694377.sra Read 577737 spots for SRR18694377.sra Written 577737 spots for SRR18694377.sra Read 577737 spots for SRR18694377.sra Written 577737 spots for SRR18694377.sra Read 577737 spots for SRR18694377.sra Written 577737 spots for SRR18694377.sra Read 577737 spots for SRR18694377.sra Written 577737 spots for SRR18694377.sra Read 577737 spots for SRR18694377.sra Written 577737 spots for SRR18694377.sra Read 577737 spots for SRR18694377.sra Written 577737 spots for SRR18694377.sra SRR ids: ['SRR18694377.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_php289a5 SRR18694377.sra spots: 11554740 blocks: [[1, 577737], [577738, 1155474], [1155475, 1733211], [1733212, 2310948], [2310949, 2888685], [2888686, 3466422], [3466423, 4044159], [4044160, 4621896], [4621897, 5199633], [5199634, 5777370], [5777371, 6355107], [6355108, 6932844], [6932845, 7510581], [7510582, 8088318], [8088319, 8666055], [8666056, 9243792], [9243793, 9821529], [9821530, 10399266], [10399267, 10977003], [10977004, 11554740]] SRR18694377 file size 3905105 SRR18694377 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694377 SRR18694377_1.fastq SRR18694377_2.fastq Input file: SRR18694377_1.fastq Paired file: SRR18694377_2.fastq trimmed: SRR18694377-trimmed-pair1.fastq, SRR18694377-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:15:05 2024 >> started Tue Dec 10 06:15:18 2024 >> done (13.763s) 11554740 read pairs processed; of these: 147 ( 0.00%) short read pairs filtered out after trimming by size control 2789 ( 0.02%) empty read pairs filtered out after trimming by size control 11551804 (99.97%) read pairs available; of these: 1354955 (11.73%) trimmed read pairs available after processing 10196849 (88.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 15 0.00% 20 13 0.00% 21 17 0.00% 22 12 0.00% 23 15 0.00% 24 25 0.00% 25 16 0.00% 26 9 0.00% 27 20 0.00% 28 13 0.00% 29 24 0.00% 30 17 0.00% 31 26 0.00% 32 28 0.00% 33 31 0.00% 34 34 0.00% 35 29 0.00% 36 26 0.00% 37 31 0.00% 38 43 0.00% 39 29 0.00% 40 53 0.00% 41 36 0.00% 42 31 0.00% 43 30 0.00% 44 43 0.00% 45 32 0.00% 46 48 0.00% 47 39 0.00% 48 60 0.00% 49 64 0.00% 50 64 0.00% 51 84 0.00% 52 113 0.00% 53 78 0.00% 54 99 0.00% 55 109 0.00% 56 122 0.00% 57 135 0.00% 58 186 0.00% 59 193 0.00% 60 199 0.00% 61 250 0.00% 62 285 0.00% 63 311 0.00% 64 320 0.00% 65 372 0.00% 66 386 0.00% 67 454 0.00% 68 541 0.00% 69 605 0.01% 70 684 0.01% 71 748 0.01% 72 934 0.01% 73 1003 0.01% 74 1124 0.01% 75 1101 0.01% 76 1427 0.01% 77 1504 0.01% 78 1748 0.02% 79 1910 0.02% 80 2108 0.02% 81 2321 0.02% 82 2554 0.02% 83 2776 0.02% 84 3023 0.03% 85 3392 0.03% 86 3699 0.03% 87 4002 0.03% 88 4360 0.04% 89 4593 0.04% 90 4911 0.04% 91 5315 0.05% 92 5694 0.05% 93 5906 0.05% 94 6466 0.06% 95 7039 0.06% 96 7358 0.06% 97 7943 0.07% 98 8057 0.07% 99 8625 0.07% 100 9033 0.08% 101 9475 0.08% 102 9992 0.09% 103 10503 0.09% 104 11019 0.10% 105 11903 0.10% 106 11997 0.10% 107 12842 0.11% 108 13204 0.11% 109 13516 0.12% 110 14050 0.12% 111 14959 0.13% 112 15568 0.13% 113 15850 0.14% 114 16906 0.15% 115 17227 0.15% 116 18010 0.16% 117 18967 0.16% 118 18998 0.16% 119 19674 0.17% 120 20687 0.18% 121 21142 0.18% 122 21370 0.18% 123 23142 0.20% 124 23467 0.20% 125 24026 0.21% 126 24868 0.22% 127 25259 0.22% 128 25723 0.22% 129 26923 0.23% 130 26996 0.23% 131 27769 0.24% 132 29198 0.25% 133 29461 0.26% 134 29418 0.25% 135 31050 0.27% 136 31356 0.27% 137 31651 0.27% 138 32354 0.28% 139 33404 0.29% 140 33961 0.29% 141 34383 0.30% 142 35528 0.31% 143 36138 0.31% 144 37231 0.32% 145 37838 0.33% 146 37817 0.33% 147 39531 0.34% 148 39888 0.35% 149 40343 0.35% 150 41191 0.36% 151 10196849 88.27% 11551804 reads passed initial QC criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=12 prefix-density=0.96 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=34 fanout-score=13.53 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=4.8 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=3.71 fanout-score-rank=13 prefix-density=0.69 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=38.25 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.1 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR18694377 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:16:06 Started mapping on | Dec 10 06:16:06 Finished on | Dec 10 06:17:39 Mapping speed, Million of reads per hour | 447.17 Number of input reads | 11551804 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10255248 Uniquely mapped reads % | 88.78% Average mapped length | 295.11 Number of splices: Total | 11033635 Number of splices: Annotated (sjdb) | 10383969 Number of splices: GT/AG | 10883879 Number of splices: GC/AG | 126990 Number of splices: AT/AC | 4401 Number of splices: Non-canonical | 18365 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.01% Deletion average length | 2.33 Insertion rate per base | 0.01% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 352104 % of reads mapped to multiple loci | 3.05% Number of reads mapped to too many loci | 57456 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.53% % of reads unmapped: other | 4.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 944452 944452 944452 N_multimapping 352104 352104 352104 N_noFeature 568259 9992414 641740 N_ambiguous 226826 1322 38081 UnstrandedReadsAssigned:9460163 PositiveStrandReadsAssigned:261512 NegativeStrandReadsAssigned:9575427 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694377 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694377-trimmed-pair1.fastq SRR18694377-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,551,804 reads, 9,788,008 reads pseudoaligned [quant] estimated average fragment length: 254.489 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52973 SRR18694377.ke.tsv 35125 SRR18694377.se.tsv 88098 total ==> SRR18694377.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 682.91 0 0 PNS24247 1044 790.511 37.1305 6.9693 PNS24249 1928 1674.51 15.2201 1.34864 PNS24246 1044 790.511 37.1305 6.9693 PNS24248 1044 790.511 37.1305 6.9693 PNS24244 1471 1217.51 65.3884 7.96881 PNS24243 293 97.2308 0 0 KQK14069 1603 1349.51 937.953 103.127 KQK14071 474 241.39 1.34408 0.826173 ==> SRR18694377.se.tsv <== BRADI_1g14170v3 987 BRADI_1g53295v3 52 BRADI_1g59795v3 280 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 184 BRADI_1g74790v3 80 BRADI_1g09890v3 0 BRADI_1g77505v3 100 BRADI_1g48960v3 0 SRR18694377 completed mapping pipeline successfully