Starting /dee2/code/volunteer_pipeline.sh SRR18694378 current disk space = 1515105820672 free memory = 1593417716 SRR18694378 SRAfilesize d36c31a88793971e4ef3fe28127ead29 SRR18694378.sra SRR18694378.sra file validated SRR18694378 is paired end SRR18694378 is conventional basespace SRR18694378 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694378_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.207 37.0 37.0 37.0 37.0 37.0 2 36.104 37.0 37.0 37.0 37.0 37.0 3 36.4515 37.0 37.0 37.0 37.0 37.0 4 36.6235 37.0 37.0 37.0 37.0 37.0 5 36.613 37.0 37.0 37.0 37.0 37.0 6 36.6085 37.0 37.0 37.0 37.0 37.0 7 36.502 37.0 37.0 37.0 37.0 37.0 8 36.577 37.0 37.0 37.0 37.0 37.0 9 36.6795 37.0 37.0 37.0 37.0 37.0 10-14 36.6425 37.0 37.0 37.0 37.0 37.0 15-19 36.628 37.0 37.0 37.0 37.0 37.0 20-24 36.641 37.0 37.0 37.0 37.0 37.0 25-29 36.618100000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.5669 37.0 37.0 37.0 37.0 37.0 35-39 36.7208 37.0 37.0 37.0 37.0 37.0 40-44 36.61370000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.4456 37.0 37.0 37.0 37.0 37.0 50-54 36.552 37.0 37.0 37.0 37.0 37.0 55-59 36.5515 37.0 37.0 37.0 37.0 37.0 60-64 36.504 37.0 37.0 37.0 37.0 37.0 65-69 36.337199999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.4679 37.0 37.0 37.0 37.0 37.0 75-79 36.561699999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.4349 37.0 37.0 37.0 37.0 37.0 85-89 36.2517 37.0 37.0 37.0 37.0 37.0 90-94 35.4165 37.0 37.0 37.0 29.8 37.0 95-99 36.2158 37.0 37.0 37.0 37.0 37.0 100-104 36.17190000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.2116 37.0 37.0 37.0 37.0 37.0 110-114 36.239599999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.482 37.0 37.0 37.0 37.0 37.0 120-124 36.5963 37.0 37.0 37.0 37.0 37.0 125-129 36.5964 37.0 37.0 37.0 37.0 37.0 130-134 36.577 37.0 37.0 37.0 37.0 37.0 135-139 36.501 37.0 37.0 37.0 37.0 37.0 140-144 36.3332 37.0 37.0 37.0 37.0 37.0 145-149 36.211 37.0 37.0 37.0 37.0 37.0 150-151 33.736 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 0.0 26 2.0 27 1.0 28 1.0 29 5.0 30 3.0 31 12.0 32 28.0 33 52.0 34 106.0 35 309.0 36 3304.0 37 176.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.175 9.875 4.925 38.025 2 22.01305220883534 11.39558232931727 35.16566265060241 31.42570281124498 3 20.05 14.75 24.9 40.300000000000004 4 25.05 21.925 23.7 29.325000000000003 5 27.825 27.1 22.975 22.1 6 23.200000000000003 31.424999999999997 22.975 22.400000000000002 7 17.1 25.474999999999998 39.875 17.549999999999997 8 19.7 23.325000000000003 31.075000000000003 25.900000000000002 9 19.325 21.525 32.525 26.625 10-14 22.91 26.86 25.72 24.51 15-19 22.42 25.645 26.265 25.669999999999998 20-24 22.6 25.629999999999995 25.83 25.94 25-29 23.330000000000002 25.369999999999997 25.71 25.590000000000003 30-34 22.935 24.654999999999998 26.090000000000003 26.32 35-39 22.625 25.19 25.965 26.22 40-44 22.825 25.679999999999996 25.8 25.695 45-49 23.0 25.424999999999997 25.44 26.135 50-54 23.115 24.875 25.64 26.369999999999997 55-59 22.939999999999998 25.535000000000004 25.83 25.695 60-64 22.79 25.515 26.27 25.424999999999997 65-69 22.98 25.455 26.33 25.235000000000003 70-74 23.78 25.545 25.365 25.31 75-79 22.835 24.990000000000002 26.125 26.05 80-84 23.44 24.88 25.874999999999996 25.805 85-89 23.615 24.84 25.605 25.94 90-94 23.630000000000003 24.815 25.745 25.81 95-99 22.625 24.73 27.04 25.605 100-104 23.7 25.235000000000003 25.430000000000003 25.635 105-109 23.674999999999997 25.729999999999997 25.130000000000003 25.465 110-114 23.47 25.259999999999998 25.685000000000002 25.585 115-119 23.01 25.259999999999998 25.81 25.919999999999998 120-124 22.955000000000002 25.505 24.905 26.634999999999998 125-129 23.62 25.240000000000002 25.335 25.805 130-134 23.335 24.505 25.995 26.165 135-139 23.34 25.105 25.5 26.055 140-144 23.56 25.775 24.445 26.22 145-149 23.735 24.740000000000002 25.080000000000002 26.445 150-151 23.962500000000002 24.775 25.2125 26.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.5 24 2.0 25 0.5 26 1.0 27 3.0 28 4.5 29 4.5 30 6.0 31 10.0 32 14.0 33 20.0 34 27.0 35 33.5 36 42.0 37 49.5 38 73.0 39 97.5 40 119.0 41 142.5 42 170.5 43 183.5 44 186.0 45 201.5 46 211.5 47 205.5 48 190.5 49 180.5 50 164.0 51 161.5 52 143.0 53 126.0 54 130.0 55 127.0 56 112.0 57 84.5 58 79.5 59 94.5 60 94.0 61 77.5 62 63.5 63 50.5 64 54.0 65 58.0 66 41.0 67 30.5 68 29.0 69 27.0 70 21.0 71 11.0 72 7.0 73 10.5 74 10.5 75 4.0 76 2.5 77 2.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.65 #Duplication Level Percentage of deduplicated Percentage of total 1 86.51488616462348 74.1 2 10.974897840046701 18.8 3 2.1015761821366024 5.4 4 0.23350846468184472 0.8 5 0.08756567425569177 0.375 6 0.05837711617046118 0.3 7 0.0 0.0 8 0.0 0.0 9 0.02918855808523059 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCTCAAAACGCACCACAATTCGTAGGACGAGATGCGCTTTTGGGGCGCG 9 0.22499999999999998 No Hit CCCCACTGCTGCCTCCCGTAGGAGTCTGGGCCGTGTCTCAGTCCCAGTGT 6 0.15 No Hit CTTCGGCGATGACATCGTGGAAGCCAGCATTCTCAAGCATCTTTCCATAG 6 0.15 No Hit CCACGTTTGTCGATGATTGTATTGTTCTCATTGATCCCCATAAATGTACC 5 0.125 No Hit GCCGCGATTTGCTCCTTCACCGTCGCAGCCTTTTTCTTGGCGGCGTCACC 5 0.125 No Hit CTGGCTGTCTTTGCACCCCCACCTCCTTTATCACTGAGCGGTCATTTAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0499999999999998 0.0 0.0 0.0 0.0 102-103 1.2375 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.425 0.0 0.0 0.0 0.0 108-109 1.7374999999999998 0.0 0.0 0.0 0.0 110-111 2.05 0.0 0.0 0.0 0.0 112-113 2.3 0.0 0.0 0.0 0.0 114-115 2.55 0.0 0.0 0.0 0.0 116-117 2.875 0.0 0.0 0.0 0.0 118-119 3.3375000000000004 0.0 0.0 0.0 0.0 120-121 3.5375 0.0 0.0 0.0 0.0 122-123 3.8625 0.0 0.0 0.0 0.0 124-125 4.1875 0.0 0.0 0.0 0.0 126-127 4.525 0.0 0.0 0.0 0.0 128-129 5.0375 0.0 0.0 0.0 0.0 130-131 5.4375 0.0 0.0 0.0 0.0 132-133 5.725 0.0 0.0 0.0 0.0 134-135 6.050000000000001 0.0 0.0 0.0 0.0 136-137 6.4125 0.0 0.0 0.0 0.0 138-139 6.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18694378 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694378_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.1975 37.0 37.0 37.0 25.0 37.0 2 34.9015 37.0 37.0 37.0 25.0 37.0 3 35.141 37.0 37.0 37.0 25.0 37.0 4 35.3145 37.0 37.0 37.0 25.0 37.0 5 35.223 37.0 37.0 37.0 25.0 37.0 6 35.4985 37.0 37.0 37.0 37.0 37.0 7 35.1815 37.0 37.0 37.0 25.0 37.0 8 35.4385 37.0 37.0 37.0 37.0 37.0 9 35.636 37.0 37.0 37.0 37.0 37.0 10-14 35.5823 37.0 37.0 37.0 37.0 37.0 15-19 35.6683 37.0 37.0 37.0 37.0 37.0 20-24 35.3726 37.0 37.0 37.0 32.2 37.0 25-29 35.5501 37.0 37.0 37.0 34.6 37.0 30-34 35.8309 37.0 37.0 37.0 37.0 37.0 35-39 35.665000000000006 37.0 37.0 37.0 37.0 37.0 40-44 35.361900000000006 37.0 37.0 37.0 29.8 37.0 45-49 35.5476 37.0 37.0 37.0 37.0 37.0 50-54 34.9885 37.0 37.0 37.0 29.4 37.0 55-59 34.304100000000005 37.0 37.0 37.0 25.0 37.0 60-64 35.0663 37.0 37.0 37.0 27.4 37.0 65-69 34.2376 37.0 34.6 37.0 27.4 37.0 70-74 33.0335 37.0 29.8 37.0 22.2 37.0 75-79 33.6053 37.0 34.6 37.0 22.2 37.0 80-84 34.607 37.0 37.0 37.0 25.0 37.0 85-89 32.75699999999999 37.0 32.2 37.0 19.4 37.0 90-94 34.0586 37.0 37.0 37.0 25.0 37.0 95-99 33.936899999999994 37.0 37.0 37.0 25.0 37.0 100-104 33.4387 37.0 37.0 37.0 25.0 37.0 105-109 34.209900000000005 37.0 37.0 37.0 25.0 37.0 110-114 34.573299999999996 37.0 37.0 37.0 25.0 37.0 115-119 34.431 37.0 37.0 37.0 25.0 37.0 120-124 34.0618 37.0 37.0 37.0 25.0 37.0 125-129 34.043600000000005 37.0 37.0 37.0 25.0 37.0 130-134 33.7088 37.0 37.0 37.0 25.0 37.0 135-139 32.1378 37.0 27.4 37.0 13.8 37.0 140-144 31.5156 37.0 25.0 37.0 11.0 37.0 145-149 31.1778 37.0 25.0 37.0 13.8 37.0 150-151 30.633000000000003 37.0 25.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 0.0 18 0.0 19 1.0 20 4.0 21 0.0 22 2.0 23 6.0 24 1.0 25 11.0 26 3.0 27 13.0 28 26.0 29 44.0 30 81.0 31 165.0 32 271.0 33 597.0 34 1213.0 35 1368.0 36 192.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.05 22.35 7.8 26.8 2 30.225 23.025000000000002 27.425 19.325 3 20.925 23.875 31.25 23.95 4 26.275 30.475 21.4 21.85 5 27.224999999999998 34.1 18.35 20.325 6 24.099999999999998 36.7 19.275000000000002 19.925 7 25.3 18.75 33.050000000000004 22.900000000000002 8 22.650000000000002 24.425 25.324999999999996 27.6 9 23.325000000000003 22.375 29.2 25.1 10-14 26.085 26.435 23.3 24.18 15-19 26.47 25.88 24.005000000000003 23.645 20-24 25.905 26.229999999999997 24.385 23.48 25-29 25.95 25.729999999999997 24.27 24.05 30-34 26.445 25.040000000000003 24.55 23.965 35-39 25.94 25.490000000000002 24.395 24.175 40-44 25.900000000000002 25.61 24.224999999999998 24.265 45-49 25.965 26.200000000000003 24.104999999999997 23.73 50-54 25.355 25.4 25.52 23.724999999999998 55-59 25.674999999999997 26.505000000000003 24.825 22.994999999999997 60-64 26.33 25.314999999999998 24.695 23.66 65-69 26.99 25.314999999999998 24.385 23.31 70-74 26.085 25.430000000000003 25.03 23.455000000000002 75-79 27.685 23.880000000000003 24.51 23.925 80-84 25.814999999999998 26.200000000000003 24.91 23.075000000000003 85-89 23.525 27.845 24.39 24.240000000000002 90-94 26.205000000000002 25.4 24.715 23.68 95-99 26.435 25.825 24.355 23.385 100-104 25.874999999999996 25.745 24.54 23.84 105-109 25.795 25.865 25.080000000000002 23.26 110-114 26.41 26.105 23.96 23.525 115-119 27.0 26.784999999999997 23.195 23.02 120-124 26.640000000000004 25.765 24.81 22.785 125-129 26.790000000000003 26.279999999999998 24.015 22.915 130-134 27.625 26.215 23.635 22.525000000000002 135-139 26.815 25.885 24.705 22.595000000000002 140-144 26.765 26.195 24.349999999999998 22.689999999999998 145-149 26.75 26.32 24.505 22.425 150-151 25.3 26.150000000000002 26.5 22.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.5 25 2.0 26 3.0 27 4.0 28 6.5 29 6.5 30 3.0 31 6.0 32 15.0 33 19.0 34 30.5 35 40.0 36 45.5 37 57.0 38 69.5 39 93.0 40 114.5 41 139.0 42 143.0 43 146.5 44 163.5 45 173.5 46 186.5 47 178.5 48 172.0 49 177.0 50 177.0 51 161.0 52 147.5 53 147.5 54 132.0 55 117.0 56 119.5 57 124.5 58 117.0 59 101.0 60 91.5 61 78.0 62 71.5 63 69.0 64 55.5 65 49.0 66 49.5 67 47.5 68 41.5 69 31.5 70 17.5 71 14.5 72 14.0 73 6.5 74 6.0 75 6.0 76 2.5 77 0.5 78 1.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 87.83939919121894 76.02499999999999 2 9.676487579433852 16.75 3 1.9930675909878681 5.175 4 0.34662045060658575 1.2 5 0.08665511265164644 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.028885037550548814 0.22499999999999998 >10 0.028885037550548814 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 10 0.25 No Hit GTGATACTGGAAGGACCTTCAGAATCGGCTGACGTGGCCAAGGGAATAGT 9 0.22499999999999998 No Hit GCACCGGAGACCTCAAGCTGAACCTCGCAGGCGTCGCGCTCGGCGATAGC 5 0.125 No Hit AACTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTC 5 0.125 No Hit GGATAAGCTTCATCGTCGAGAGGGAAACAGCCCGGATCACCAGCTAAGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 2.025 0.0 0.0 0.0 0.0 112-113 2.2750000000000004 0.0 0.0 0.0 0.0 114-115 2.525 0.0 0.0 0.0 0.0 116-117 2.85 0.0 0.0 0.0 0.0 118-119 3.3 0.0 0.0 0.0 0.0 120-121 3.4875 0.0 0.0 0.0 0.0 122-123 3.8125 0.0 0.0 0.0 0.0 124-125 4.137499999999999 0.0 0.0 0.0 0.0 126-127 4.4875 0.0 0.0 0.0 0.0 128-129 5.0875 0.0 0.0 0.0 0.0 130-131 5.4625 0.0 0.0 0.0 0.0 132-133 5.737500000000001 0.0 0.0 0.0 0.0 134-135 6.050000000000001 0.0 0.0 0.0 0.0 136-137 6.4125 0.0 0.0 0.0 0.0 138-139 6.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACGGAA 10 0.006830828 145.0 9 >>END_MODULE Read 847275 spots for SRR18694378.sra Written 847275 spots for SRR18694378.sra Read 847275 spots for SRR18694378.sra Written 847275 spots for SRR18694378.sra Read 847275 spots for SRR18694378.sra Written 847275 spots for SRR18694378.sra Read 847275 spots for SRR18694378.sra Written 847275 spots for SRR18694378.sra Read 847275 spots for SRR18694378.sra Written 847275 spots for SRR18694378.sra Read 847275 spots for SRR18694378.sra Written 847275 spots for SRR18694378.sra Read 847275 spots for SRR18694378.sra Written 847275 spots for SRR18694378.sra Read 847275 spots for SRR18694378.sra Written 847275 spots for SRR18694378.sra Read 847275 spots for SRR18694378.sra Written 847275 spots for SRR18694378.sra Read 847275 spots for SRR18694378.sra Written 847275 spots for SRR18694378.sra Read 847275 spots for SRR18694378.sra Written 847275 spots for SRR18694378.sra Read 847275 spots for SRR18694378.sra Written 847275 spots for SRR18694378.sra Read 847275 spots for SRR18694378.sra Written 847275 spots for SRR18694378.sra Read 847275 spots for SRR18694378.sra Written 847275 spots for SRR18694378.sra Read 847275 spots for SRR18694378.sra Written 847275 spots for SRR18694378.sra Read 847275 spots for SRR18694378.sra Written 847275 spots for SRR18694378.sra Read 847275 spots for SRR18694378.sra Written 847275 spots for SRR18694378.sra Read 847275 spots for SRR18694378.sra Written 847275 spots for SRR18694378.sra Read 847281 spots for SRR18694378.sra Written 847281 spots for SRR18694378.sra Read 847275 spots for SRR18694378.sra Written 847275 spots for SRR18694378.sra SRR ids: ['SRR18694378.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nxlq2wyc SRR18694378.sra spots: 16945506 blocks: [[1, 847275], [847276, 1694550], [1694551, 2541825], [2541826, 3389100], [3389101, 4236375], [4236376, 5083650], [5083651, 5930925], [5930926, 6778200], [6778201, 7625475], [7625476, 8472750], [8472751, 9320025], [9320026, 10167300], [10167301, 11014575], [11014576, 11861850], [11861851, 12709125], [12709126, 13556400], [13556401, 14403675], [14403676, 15250950], [15250951, 16098225], [16098226, 16945506]] SRR18694378 file size 5737123 SRR18694378 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694378 SRR18694378_1.fastq SRR18694378_2.fastq Input file: SRR18694378_1.fastq Paired file: SRR18694378_2.fastq trimmed: SRR18694378-trimmed-pair1.fastq, SRR18694378-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:30:48 2024 >> started Thu Dec 12 03:35:01 2024 >> done (253.522s) 16945506 read pairs processed; of these: 192 ( 0.00%) short read pairs filtered out after trimming by size control 2064 ( 0.01%) empty read pairs filtered out after trimming by size control 16943250 (99.99%) read pairs available; of these: 1702253 (10.05%) trimmed read pairs available after processing 15240997 (89.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 27 0.00% 19 17 0.00% 20 21 0.00% 21 16 0.00% 22 13 0.00% 23 28 0.00% 24 27 0.00% 25 29 0.00% 26 27 0.00% 27 25 0.00% 28 29 0.00% 29 32 0.00% 30 25 0.00% 31 51 0.00% 32 36 0.00% 33 28 0.00% 34 38 0.00% 35 44 0.00% 36 50 0.00% 37 56 0.00% 38 49 0.00% 39 55 0.00% 40 68 0.00% 41 55 0.00% 42 58 0.00% 43 69 0.00% 44 56 0.00% 45 60 0.00% 46 69 0.00% 47 82 0.00% 48 89 0.00% 49 81 0.00% 50 86 0.00% 51 101 0.00% 52 118 0.00% 53 133 0.00% 54 128 0.00% 55 121 0.00% 56 171 0.00% 57 181 0.00% 58 200 0.00% 59 219 0.00% 60 236 0.00% 61 288 0.00% 62 313 0.00% 63 410 0.00% 64 426 0.00% 65 445 0.00% 66 487 0.00% 67 511 0.00% 68 625 0.00% 69 766 0.00% 70 838 0.00% 71 907 0.01% 72 1080 0.01% 73 1153 0.01% 74 1296 0.01% 75 1443 0.01% 76 1681 0.01% 77 1750 0.01% 78 1944 0.01% 79 2258 0.01% 80 2528 0.01% 81 2775 0.02% 82 3139 0.02% 83 3418 0.02% 84 3494 0.02% 85 4195 0.02% 86 4416 0.03% 87 4735 0.03% 88 5210 0.03% 89 5301 0.03% 90 5909 0.03% 91 6397 0.04% 92 6860 0.04% 93 7273 0.04% 94 7826 0.05% 95 8375 0.05% 96 8697 0.05% 97 9413 0.06% 98 9593 0.06% 99 10053 0.06% 100 11089 0.07% 101 11492 0.07% 102 12311 0.07% 103 12761 0.08% 104 13308 0.08% 105 13986 0.08% 106 14884 0.09% 107 15139 0.09% 108 15552 0.09% 109 16480 0.10% 110 16858 0.10% 111 18088 0.11% 112 19111 0.11% 113 19317 0.11% 114 20940 0.12% 115 21529 0.13% 116 22331 0.13% 117 22763 0.13% 118 23407 0.14% 119 23856 0.14% 120 25185 0.15% 121 25412 0.15% 122 26585 0.16% 123 28505 0.17% 124 29203 0.17% 125 30282 0.18% 126 31195 0.18% 127 31427 0.19% 128 31902 0.19% 129 33602 0.20% 130 33942 0.20% 131 34563 0.20% 132 36570 0.22% 133 37425 0.22% 134 38017 0.22% 135 39212 0.23% 136 39901 0.24% 137 40185 0.24% 138 41097 0.24% 139 43177 0.25% 140 42939 0.25% 141 43557 0.26% 142 46048 0.27% 143 47501 0.28% 144 48543 0.29% 145 49823 0.29% 146 49748 0.29% 147 52009 0.31% 148 51904 0.31% 149 53038 0.31% 150 53222 0.31% 151 15240997 89.95% 16943250 reads passed initial QC criterion=sequence-density sequence-density=1.01 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=12 prefix-density=1.05 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=28 fanout-score=11.30 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=4.3 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=3.68 fanout-score-rank=13 prefix-density=0.77 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=29.40 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=6.9 sequence=AAGAACCTTACCAGGGCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGCCCTCGGGAACGCGGACACAGGTGGTGCATG SRR18694378 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:39:15 Started mapping on | Dec 12 03:39:16 Finished on | Dec 12 04:10:18 Mapping speed, Million of reads per hour | 32.76 Number of input reads | 16943250 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15238405 Uniquely mapped reads % | 89.94% Average mapped length | 295.80 Number of splices: Total | 16753064 Number of splices: Annotated (sjdb) | 15793133 Number of splices: GT/AG | 16523345 Number of splices: GC/AG | 196896 Number of splices: AT/AC | 6407 Number of splices: Non-canonical | 26416 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.01% Deletion average length | 2.30 Insertion rate per base | 0.01% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 512378 % of reads mapped to multiple loci | 3.02% Number of reads mapped to too many loci | 62938 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.11% % of reads unmapped: other | 3.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1192467 1192467 1192467 N_multimapping 512378 512378 512378 N_noFeature 855450 14846709 961878 N_ambiguous 343736 1898 59714 UnstrandedReadsAssigned:14039219 PositiveStrandReadsAssigned:389798 NegativeStrandReadsAssigned:14216813 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694378 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694378-trimmed-pair1.fastq SRR18694378-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,943,250 reads, 14,533,508 reads pseudoaligned [quant] estimated average fragment length: 261.73 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52973 SRR18694378.ke.tsv 35125 SRR18694378.se.tsv 88098 total ==> SRR18694378.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 675.709 0 0 PNS24247 1044 783.27 41.1638 5.24567 PNS24249 1928 1667.27 27.0883 1.62171 PNS24246 1044 783.27 41.1638 5.24567 PNS24248 1044 783.27 41.1638 5.24567 PNS24244 1471 1210.27 62.4203 5.14803 PNS24243 293 93.6179 0 0 KQK14069 1603 1342.27 1369.03 101.805 KQK14071 474 235.542 11.5264 4.88452 ==> SRR18694378.se.tsv <== BRADI_1g14170v3 1483 BRADI_1g53295v3 48 BRADI_1g59795v3 455 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 234 BRADI_1g74790v3 55 BRADI_1g09890v3 0 BRADI_1g77505v3 198 BRADI_1g48960v3 0 SRR18694378 completed mapping pipeline successfully