Starting /dee2/code/volunteer_pipeline.sh SRR18694379 current disk space = 1515126489088 free memory = 1595461300 SRR18694379 SRAfilesize 6cb192333b6d94bf1b8fa01eeb332a8e SRR18694379.sra SRR18694379.sra file validated SRR18694379 is paired end SRR18694379 is conventional basespace SRR18694379 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694379_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.111 37.0 37.0 37.0 37.0 37.0 2 35.90325 37.0 37.0 37.0 37.0 37.0 3 36.386 37.0 37.0 37.0 37.0 37.0 4 36.536 37.0 37.0 37.0 37.0 37.0 5 36.5425 37.0 37.0 37.0 37.0 37.0 6 36.507 37.0 37.0 37.0 37.0 37.0 7 36.535 37.0 37.0 37.0 37.0 37.0 8 36.519 37.0 37.0 37.0 37.0 37.0 9 36.657 37.0 37.0 37.0 37.0 37.0 10-14 36.598 37.0 37.0 37.0 37.0 37.0 15-19 36.588 37.0 37.0 37.0 37.0 37.0 20-24 36.6077 37.0 37.0 37.0 37.0 37.0 25-29 36.579 37.0 37.0 37.0 37.0 37.0 30-34 36.51090000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.6266 37.0 37.0 37.0 37.0 37.0 40-44 36.5828 37.0 37.0 37.0 37.0 37.0 45-49 36.36149999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.4901 37.0 37.0 37.0 37.0 37.0 55-59 36.5073 37.0 37.0 37.0 37.0 37.0 60-64 36.5286 37.0 37.0 37.0 37.0 37.0 65-69 36.2681 37.0 37.0 37.0 37.0 37.0 70-74 36.4003 37.0 37.0 37.0 37.0 37.0 75-79 36.4724 37.0 37.0 37.0 37.0 37.0 80-84 36.39319999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.228300000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.4846 37.0 37.0 37.0 29.8 37.0 95-99 36.22410000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.1645 37.0 37.0 37.0 37.0 37.0 105-109 36.18 37.0 37.0 37.0 37.0 37.0 110-114 36.208600000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.5132 37.0 37.0 37.0 37.0 37.0 120-124 36.5646 37.0 37.0 37.0 37.0 37.0 125-129 36.5532 37.0 37.0 37.0 37.0 37.0 130-134 36.4808 37.0 37.0 37.0 37.0 37.0 135-139 36.402300000000004 37.0 37.0 37.0 37.0 37.0 140-144 36.185500000000005 37.0 37.0 37.0 37.0 37.0 145-149 36.1682 37.0 37.0 37.0 37.0 37.0 150-151 33.77175 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 0.0 24 0.0 25 2.0 26 3.0 27 3.0 28 3.0 29 5.0 30 6.0 31 23.0 32 27.0 33 55.0 34 105.0 35 314.0 36 3279.0 37 174.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.5 9.3 4.475 34.725 2 21.36215129429505 10.052777079668259 37.421462679065094 31.1636089469716 3 18.725 14.524999999999999 27.224999999999998 39.525 4 24.95 22.3 22.775000000000002 29.975 5 27.700000000000003 26.325 23.75 22.225 6 22.8 30.675 23.45 23.075000000000003 7 16.875 25.55 39.6 17.974999999999998 8 18.65 23.625 32.6 25.124999999999996 9 17.2 21.625 36.175000000000004 25.0 10-14 22.05 27.034999999999997 26.515 24.4 15-19 22.605 25.235000000000003 27.169999999999998 24.990000000000002 20-24 22.39 25.074999999999996 27.12 25.415 25-29 22.29 24.985 27.334999999999997 25.39 30-34 22.745 25.095 26.479999999999997 25.679999999999996 35-39 21.790000000000003 25.025 27.265 25.919999999999998 40-44 22.325 25.665 26.77 25.240000000000002 45-49 22.775000000000002 25.124999999999996 26.900000000000002 25.2 50-54 22.355 25.669999999999998 26.705000000000002 25.27 55-59 22.42 25.590000000000003 26.83 25.16 60-64 22.245 24.88 26.935 25.94 65-69 22.03 25.095 27.365000000000002 25.509999999999998 70-74 22.095000000000002 25.729999999999997 26.650000000000002 25.525 75-79 23.075000000000003 24.9 26.8 25.224999999999998 80-84 22.105 25.605 26.915 25.374999999999996 85-89 22.655 25.005 26.87 25.47 90-94 23.015 24.995 26.419999999999998 25.569999999999997 95-99 22.009999999999998 25.345000000000002 26.355 26.290000000000003 100-104 22.67 25.575 26.1 25.655 105-109 22.78 24.825 26.805 25.590000000000003 110-114 23.265 25.650000000000002 26.705000000000002 24.38 115-119 22.96 25.705 25.15 26.185000000000002 120-124 22.655 25.669999999999998 26.450000000000003 25.224999999999998 125-129 23.294999999999998 25.740000000000002 25.545 25.419999999999998 130-134 23.505000000000003 25.7 24.98 25.814999999999998 135-139 23.16 25.805 25.395 25.64 140-144 23.465 25.924999999999997 25.009999999999998 25.6 145-149 23.31 25.619999999999997 25.740000000000002 25.330000000000002 150-151 22.4375 26.5625 26.0375 24.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 3.0 25 3.5 26 4.0 27 4.5 28 5.0 29 7.5 30 9.5 31 16.5 32 19.5 33 20.0 34 35.5 35 58.5 36 60.5 37 67.0 38 91.0 39 106.0 40 127.5 41 148.0 42 168.5 43 176.0 44 180.5 45 187.0 46 196.5 47 212.5 48 198.0 49 179.0 50 168.0 51 165.0 52 169.0 53 155.0 54 133.5 55 116.0 56 113.5 57 102.5 58 81.0 59 74.5 60 61.5 61 40.5 62 41.0 63 48.5 64 40.0 65 40.5 66 39.5 67 28.5 68 20.5 69 17.5 70 12.5 71 9.0 72 9.0 73 6.5 74 5.5 75 3.5 76 2.0 77 2.5 78 4.0 79 2.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.525 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.075 #Duplication Level Percentage of deduplicated Percentage of total 1 84.92417484388939 71.39999999999999 2 12.39964317573595 20.849999999999998 3 1.8435920309247695 4.65 4 0.6541778174249182 2.1999999999999997 5 0.08920606601248886 0.375 6 0.02973535533749628 0.15 7 0.02973535533749628 0.17500000000000002 8 0.02973535533749628 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTGTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGC 8 0.2 No Hit GTCGGGGCAGGCGGCGGGCGCAGGCGCCGCTTGCTAGCTTGGATTCTGAC 7 0.17500000000000002 No Hit GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 6 0.15 No Hit GTCAGATTCCCCTTGTCCGTACCAGTTCTAAGTTGGTTGTTAATTGTAGA 5 0.125 No Hit CTCATAAACAACGATCTAGCACGGAGAGGAGGGGTCGAGGAGAATCGGAG 5 0.125 No Hit GTTCTAGGTTAGCGCGCAGTTGGGCACCGTAACCCGGCTTCCGGTTCATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8999999999999999 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.45 0.0 0.0 0.0 0.0 108-109 1.5750000000000002 0.0 0.0 0.0 0.0 110-111 1.775 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.2875 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 2.9625 0.0 0.0 0.0 0.0 120-121 3.25 0.0 0.0 0.0 0.0 122-123 3.5250000000000004 0.0 0.0 0.0 0.0 124-125 4.0875 0.0 0.0 0.0 0.0 126-127 4.425 0.0 0.0 0.0 0.0 128-129 4.7875 0.0 0.0 0.0 0.0 130-131 5.1625 0.0 0.0 0.0 0.0 132-133 5.475 0.0 0.0 0.0 0.0 134-135 6.0625 0.0 0.0 0.0 0.0 136-137 6.875 0.0 0.0 0.0 0.0 138-139 7.449999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18694379 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694379_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.127 37.0 37.0 37.0 25.0 37.0 2 34.6375 37.0 37.0 37.0 25.0 37.0 3 34.9485 37.0 37.0 37.0 25.0 37.0 4 34.9455 37.0 37.0 37.0 25.0 37.0 5 34.981 37.0 37.0 37.0 25.0 37.0 6 35.1305 37.0 37.0 37.0 25.0 37.0 7 35.1625 37.0 37.0 37.0 25.0 37.0 8 35.3795 37.0 37.0 37.0 37.0 37.0 9 35.355 37.0 37.0 37.0 37.0 37.0 10-14 35.4086 37.0 37.0 37.0 37.0 37.0 15-19 35.453900000000004 37.0 37.0 37.0 34.6 37.0 20-24 35.2768 37.0 37.0 37.0 29.8 37.0 25-29 35.4135 37.0 37.0 37.0 32.2 37.0 30-34 35.6151 37.0 37.0 37.0 37.0 37.0 35-39 35.4207 37.0 37.0 37.0 32.2 37.0 40-44 35.223200000000006 37.0 37.0 37.0 29.8 37.0 45-49 35.3973 37.0 37.0 37.0 32.2 37.0 50-54 34.850300000000004 37.0 37.0 37.0 27.0 37.0 55-59 34.248000000000005 37.0 37.0 37.0 25.0 37.0 60-64 35.0106 37.0 37.0 37.0 27.4 37.0 65-69 34.223699999999994 37.0 34.6 37.0 27.4 37.0 70-74 33.1002 37.0 29.8 37.0 25.0 37.0 75-79 33.581999999999994 37.0 34.6 37.0 22.2 37.0 80-84 34.5206 37.0 37.0 37.0 25.0 37.0 85-89 32.5627 37.0 32.2 37.0 19.4 37.0 90-94 34.0539 37.0 37.0 37.0 25.0 37.0 95-99 33.861900000000006 37.0 37.0 37.0 25.0 37.0 100-104 33.4454 37.0 37.0 37.0 25.0 37.0 105-109 34.1711 37.0 37.0 37.0 25.0 37.0 110-114 34.5254 37.0 37.0 37.0 25.0 37.0 115-119 34.4267 37.0 37.0 37.0 25.0 37.0 120-124 34.138 37.0 37.0 37.0 25.0 37.0 125-129 33.9749 37.0 37.0 37.0 25.0 37.0 130-134 33.6851 37.0 34.6 37.0 25.0 37.0 135-139 32.2457 37.0 25.0 37.0 13.8 37.0 140-144 31.786700000000003 37.0 25.0 37.0 11.0 37.0 145-149 31.226 37.0 25.0 37.0 11.0 37.0 150-151 30.67 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 3.0 18 3.0 19 1.0 20 2.0 21 4.0 22 2.0 23 6.0 24 7.0 25 7.0 26 15.0 27 27.0 28 23.0 29 42.0 30 70.0 31 177.0 32 256.0 33 594.0 34 1182.0 35 1380.0 36 197.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.4 22.2 7.6 24.8 2 32.775 21.05 26.75 19.425 3 22.725 23.825 31.974999999999998 21.475 4 25.4 31.624999999999996 22.05 20.925 5 28.1 33.975 19.725 18.2 6 22.5 37.95 19.275000000000002 20.275000000000002 7 23.325000000000003 21.55 34.075 21.05 8 22.95 21.8 26.200000000000003 29.049999999999997 9 23.974999999999998 24.15 27.474999999999998 24.4 10-14 25.509999999999998 27.485 24.005000000000003 23.0 15-19 25.635 26.525 24.529999999999998 23.31 20-24 25.759999999999998 25.974999999999998 25.480000000000004 22.785 25-29 25.555 26.025 25.485000000000003 22.935 30-34 24.81 26.43 25.34 23.419999999999998 35-39 24.884999999999998 27.400000000000002 24.47 23.244999999999997 40-44 25.805 26.955000000000002 24.545 22.695 45-49 25.715 26.529999999999998 25.03 22.725 50-54 23.995 27.08 26.605 22.32 55-59 24.845 26.855 25.069999999999997 23.23 60-64 26.165 25.88 24.795 23.16 65-69 25.655 26.125 24.62 23.599999999999998 70-74 25.695 26.040000000000003 25.27 22.994999999999997 75-79 26.845000000000002 25.319999999999997 25.205 22.63 80-84 25.755 26.415 25.165 22.665 85-89 23.185 28.53 24.85 23.435 90-94 26.26 26.040000000000003 25.19 22.509999999999998 95-99 25.97 26.810000000000002 24.735 22.485 100-104 25.41 26.61 25.66 22.32 105-109 25.45 26.540000000000003 25.97 22.040000000000003 110-114 25.319999999999997 26.640000000000004 26.035000000000004 22.005 115-119 25.97 27.08 24.529999999999998 22.42 120-124 25.790000000000003 26.185000000000002 25.655 22.37 125-129 26.490000000000002 26.575 24.895 22.040000000000003 130-134 26.16 26.064999999999998 25.5 22.275 135-139 26.265 26.424999999999997 25.419999999999998 21.89 140-144 26.640000000000004 27.134999999999998 24.38 21.845 145-149 26.47 27.595 23.965 21.97 150-151 25.637500000000003 25.45 28.125 20.7875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 4.0 26 8.0 27 6.5 28 3.5 29 8.5 30 13.5 31 16.5 32 23.5 33 27.5 34 37.5 35 48.0 36 56.5 37 75.0 38 98.0 39 111.0 40 132.0 41 151.5 42 162.5 43 169.5 44 172.0 45 185.5 46 198.5 47 206.5 48 200.5 49 180.5 50 162.0 51 155.0 52 139.0 53 119.0 54 119.0 55 109.0 56 97.0 57 86.5 58 78.0 59 75.5 60 64.0 61 60.0 62 57.5 63 46.5 64 39.5 65 39.5 66 35.5 67 38.5 68 41.0 69 30.5 70 23.5 71 24.0 72 17.0 73 11.0 74 8.5 75 6.5 76 6.5 77 2.5 78 0.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.5 93 0.5 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.675 #Duplication Level Percentage of deduplicated Percentage of total 1 86.86898161657426 74.425 2 10.942515319521446 18.75 3 1.517362124306974 3.9 4 0.40852057192880076 1.4000000000000001 5 0.08754012255617158 0.375 6 0.11672016340822876 0.6 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05836008170411438 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 12 0.3 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 10 0.25 No Hit AAACTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTT 6 0.15 No Hit GGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCA 6 0.15 No Hit GGACTACCCGCTGAGTTTAAGCATATAAATAAGCGGAGGAGAAGAAACTT 6 0.15 No Hit AGGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGC 6 0.15 No Hit GCACACCCCCGAGAGCTAGGTTTTTCCAACACACCCCTCCTCCCTCGCCT 5 0.125 No Hit GAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAA 5 0.125 No Hit ACTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 1.0125000000000002 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.2249999999999996 0.0 0.0 0.0 0.0 116-117 2.475 0.0 0.0 0.0 0.0 118-119 2.8875 0.0 0.0 0.0 0.0 120-121 3.175 0.0 0.0 0.0 0.0 122-123 3.45 0.0 0.0 0.0 0.0 124-125 4.012499999999999 0.0 0.0 0.0 0.0 126-127 4.35 0.0 0.0 0.0 0.0 128-129 4.7125 0.0 0.0 0.0 0.0 130-131 5.0875 0.0 0.0 0.0 0.0 132-133 5.4 0.0 0.0 0.0 0.0 134-135 6.025 0.0 0.0 0.0 0.0 136-137 6.85 0.0 0.0 0.0 0.0 138-139 7.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGAGA 10 0.006830828 145.0 1 >>END_MODULE Read 574202 spots for SRR18694379.sra Written 574202 spots for SRR18694379.sra Read 574202 spots for SRR18694379.sra Written 574202 spots for SRR18694379.sra Read 574202 spots for SRR18694379.sra Written 574202 spots for SRR18694379.sra Read 574207 spots for SRR18694379.sra Written 574207 spots for SRR18694379.sra Read 574202 spots for SRR18694379.sra Written 574202 spots for SRR18694379.sra Read 574202 spots for SRR18694379.sra Written 574202 spots for SRR18694379.sra Read 574202 spots for SRR18694379.sra Written 574202 spots for SRR18694379.sra Read 574202 spots for SRR18694379.sra Written 574202 spots for SRR18694379.sra Read 574202 spots for SRR18694379.sra Written 574202 spots for SRR18694379.sra Read 574202 spots for SRR18694379.sra Written 574202 spots for SRR18694379.sra Read 574202 spots for SRR18694379.sra Written 574202 spots for SRR18694379.sra Read 574202 spots for SRR18694379.sra Written 574202 spots for SRR18694379.sra Read 574202 spots for SRR18694379.sra Written 574202 spots for SRR18694379.sra Read 574202 spots for SRR18694379.sra Written 574202 spots for SRR18694379.sra Read 574202 spots for SRR18694379.sra Written 574202 spots for SRR18694379.sra Read 574202 spots for SRR18694379.sra Written 574202 spots for SRR18694379.sra Read 574202 spots for SRR18694379.sra Written 574202 spots for SRR18694379.sra Read 574202 spots for SRR18694379.sra Written 574202 spots for SRR18694379.sra Read 574202 spots for SRR18694379.sra Written 574202 spots for SRR18694379.sra Read 574202 spots for SRR18694379.sra Written 574202 spots for SRR18694379.sra SRR ids: ['SRR18694379.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yk7izfgw SRR18694379.sra spots: 11484045 blocks: [[1, 574202], [574203, 1148404], [1148405, 1722606], [1722607, 2296808], [2296809, 2871010], [2871011, 3445212], [3445213, 4019414], [4019415, 4593616], [4593617, 5167818], [5167819, 5742020], [5742021, 6316222], [6316223, 6890424], [6890425, 7464626], [7464627, 8038828], [8038829, 8613030], [8613031, 9187232], [9187233, 9761434], [9761435, 10335636], [10335637, 10909838], [10909839, 11484045]] SRR18694379 file size 3881080 SRR18694379 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694379 SRR18694379_1.fastq SRR18694379_2.fastq Input file: SRR18694379_1.fastq Paired file: SRR18694379_2.fastq trimmed: SRR18694379-trimmed-pair1.fastq, SRR18694379-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:23:09 2024 >> started Thu Dec 12 03:23:23 2024 >> done (14.069s) 11484045 read pairs processed; of these: 80 ( 0.00%) short read pairs filtered out after trimming by size control 1182 ( 0.01%) empty read pairs filtered out after trimming by size control 11482783 (99.99%) read pairs available; of these: 1085354 ( 9.45%) trimmed read pairs available after processing 10397429 (90.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 4 0.00% 20 16 0.00% 21 11 0.00% 22 15 0.00% 23 15 0.00% 24 12 0.00% 25 22 0.00% 26 23 0.00% 27 15 0.00% 28 23 0.00% 29 20 0.00% 30 23 0.00% 31 25 0.00% 32 31 0.00% 33 31 0.00% 34 32 0.00% 35 26 0.00% 36 23 0.00% 37 30 0.00% 38 22 0.00% 39 28 0.00% 40 33 0.00% 41 34 0.00% 42 30 0.00% 43 31 0.00% 44 38 0.00% 45 33 0.00% 46 53 0.00% 47 53 0.00% 48 50 0.00% 49 52 0.00% 50 62 0.00% 51 65 0.00% 52 59 0.00% 53 62 0.00% 54 79 0.00% 55 71 0.00% 56 87 0.00% 57 117 0.00% 58 128 0.00% 59 115 0.00% 60 148 0.00% 61 193 0.00% 62 174 0.00% 63 232 0.00% 64 216 0.00% 65 222 0.00% 66 275 0.00% 67 270 0.00% 68 342 0.00% 69 426 0.00% 70 416 0.00% 71 487 0.00% 72 544 0.00% 73 633 0.01% 74 660 0.01% 75 806 0.01% 76 898 0.01% 77 920 0.01% 78 1044 0.01% 79 1230 0.01% 80 1328 0.01% 81 1494 0.01% 82 1753 0.02% 83 1890 0.02% 84 2058 0.02% 85 2255 0.02% 86 2494 0.02% 87 2794 0.02% 88 2795 0.02% 89 3210 0.03% 90 3379 0.03% 91 3573 0.03% 92 4067 0.04% 93 4476 0.04% 94 4553 0.04% 95 4967 0.04% 96 5312 0.05% 97 5655 0.05% 98 5906 0.05% 99 6349 0.06% 100 6411 0.06% 101 6913 0.06% 102 7250 0.06% 103 7627 0.07% 104 8254 0.07% 105 8525 0.07% 106 8734 0.08% 107 9230 0.08% 108 9514 0.08% 109 10006 0.09% 110 10567 0.09% 111 10984 0.10% 112 11590 0.10% 113 12014 0.10% 114 12661 0.11% 115 13459 0.12% 116 14027 0.12% 117 14521 0.13% 118 14371 0.13% 119 14904 0.13% 120 16361 0.14% 121 15895 0.14% 122 17024 0.15% 123 18233 0.16% 124 19125 0.17% 125 19191 0.17% 126 19985 0.17% 127 20551 0.18% 128 20758 0.18% 129 21455 0.19% 130 21738 0.19% 131 22860 0.20% 132 23348 0.20% 133 23704 0.21% 134 24833 0.22% 135 25523 0.22% 136 26572 0.23% 137 26693 0.23% 138 27172 0.24% 139 27843 0.24% 140 27975 0.24% 141 28602 0.25% 142 30463 0.27% 143 30646 0.27% 144 32489 0.28% 145 32124 0.28% 146 32711 0.28% 147 34909 0.30% 148 34041 0.30% 149 34054 0.30% 150 34762 0.30% 151 10397429 90.55% 11482783 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=5.08 fanout-score-rank=7 prefix-density=1.30 prefix-fanout=2.5 sequence=ATCTTTCCCTCATCAACTTCAGCAGGTAATCGGATGGATCTGCGATAACG criterion=fanout-score sequence-density=0.14 sequence-density-rank=26 fanout-score=13.82 fanout-score-rank=1 prefix-density=1.08 prefix-fanout=1.8 sequence=GGTACTTGTTCACTATCGGTCGATTACGAGTATTTAGCCT criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=4.21 fanout-score-rank=13 prefix-density=0.88 prefix-fanout=3.3 sequence=CCTTATCCAAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=32.72 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.9 sequence=GAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCATGCCTTACACATGCAAGTCGAACGGTAACAGGTTAAGCTGACGAGTGGCGAACGGGTGAGTAATGTATCGGAACGTGCCCAGTAGTGGGGGATAGCCCGGCGAAAGCCGGATTAATACCGCATACGACCTACGGGTGAAAGGGGGGGATCGCAAGACCTCTCGCTATTGGAGCGGCCGATATCAGATTAGGTAGTTGGTGGGGTAAAGGCCCACCAAGCCGACGATCTGTAGCTGGTCT SRR18694379 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:25:14 Started mapping on | Dec 12 03:25:14 Finished on | Dec 12 03:32:57 Mapping speed, Million of reads per hour | 89.28 Number of input reads | 11482783 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 7077391 Uniquely mapped reads % | 61.63% Average mapped length | 295.73 Number of splices: Total | 6007473 Number of splices: Annotated (sjdb) | 5492165 Number of splices: GT/AG | 5926144 Number of splices: GC/AG | 64265 Number of splices: AT/AC | 643 Number of splices: Non-canonical | 16421 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.02% Deletion average length | 2.27 Insertion rate per base | 0.01% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 173996 % of reads mapped to multiple loci | 1.52% Number of reads mapped to too many loci | 152606 % of reads mapped to too many loci | 1.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 19.60% % of reads unmapped: other | 15.92% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4231396 4231396 4231396 N_multimapping 173996 173996 173996 N_noFeature 784026 6825594 933689 N_ambiguous 126385 1224 24165 UnstrandedReadsAssigned:6166980 PositiveStrandReadsAssigned:250573 NegativeStrandReadsAssigned:6119537 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694379 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694379-trimmed-pair1.fastq SRR18694379-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,482,783 reads, 6,315,444 reads pseudoaligned [quant] estimated average fragment length: 262.998 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52973 SRR18694379.ke.tsv 35125 SRR18694379.se.tsv 88098 total ==> SRR18694379.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 674.665 48.4201 18.3443 PNS24247 1044 782.002 15.6801 5.12513 PNS24249 1928 1666 63.7605 9.78228 PNS24246 1044 782.002 15.6801 5.12513 PNS24248 1044 782.002 15.6801 5.12513 PNS24244 1471 1209 30.7792 6.5072 PNS24243 293 92.3323 0 0 KQK14069 1603 1341 31.1265 5.93288 KQK14071 474 234.82 2.56811 2.79539 ==> SRR18694379.se.tsv <== BRADI_1g14170v3 40 BRADI_1g53295v3 428 BRADI_1g59795v3 139 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 34 BRADI_1g74790v3 940 BRADI_1g09890v3 0 BRADI_1g77505v3 19 BRADI_1g48960v3 0 SRR18694379 completed mapping pipeline successfully