Starting /dee2/code/volunteer_pipeline.sh SRR18694419 current disk space = 1515126644736 free memory = 1595464736 SRR18694419 SRAfilesize c0acafc93c388678e728e060fec1b5a7 SRR18694419.sra SRR18694419.sra file validated SRR18694419 is paired end SRR18694419 is conventional basespace SRR18694419 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694419_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2195 37.0 37.0 37.0 37.0 37.0 2 35.95075 37.0 37.0 37.0 37.0 37.0 3 36.3185 37.0 37.0 37.0 37.0 37.0 4 36.6045 37.0 37.0 37.0 37.0 37.0 5 36.562 37.0 37.0 37.0 37.0 37.0 6 36.5245 37.0 37.0 37.0 37.0 37.0 7 36.532 37.0 37.0 37.0 37.0 37.0 8 36.5355 37.0 37.0 37.0 37.0 37.0 9 36.6425 37.0 37.0 37.0 37.0 37.0 10-14 36.6255 37.0 37.0 37.0 37.0 37.0 15-19 36.638400000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.6373 37.0 37.0 37.0 37.0 37.0 25-29 36.5841 37.0 37.0 37.0 37.0 37.0 30-34 36.54559999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.6825 37.0 37.0 37.0 37.0 37.0 40-44 36.5804 37.0 37.0 37.0 37.0 37.0 45-49 36.4013 37.0 37.0 37.0 37.0 37.0 50-54 36.519800000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.5227 37.0 37.0 37.0 37.0 37.0 60-64 36.5096 37.0 37.0 37.0 37.0 37.0 65-69 36.279199999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.43560000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.5178 37.0 37.0 37.0 37.0 37.0 80-84 36.414 37.0 37.0 37.0 37.0 37.0 85-89 36.235200000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.4892 37.0 37.0 37.0 29.8 37.0 95-99 36.153800000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.219300000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.1397 37.0 37.0 37.0 37.0 37.0 110-114 36.2512 37.0 37.0 37.0 37.0 37.0 115-119 36.498000000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.5948 37.0 37.0 37.0 37.0 37.0 125-129 36.5344 37.0 37.0 37.0 37.0 37.0 130-134 36.540499999999994 37.0 37.0 37.0 37.0 37.0 135-139 36.4258 37.0 37.0 37.0 37.0 37.0 140-144 36.287 37.0 37.0 37.0 37.0 37.0 145-149 36.2817 37.0 37.0 37.0 37.0 37.0 150-151 33.66075 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 1.0 25 1.0 26 1.0 27 2.0 28 3.0 29 4.0 30 15.0 31 11.0 32 22.0 33 50.0 34 118.0 35 326.0 36 3247.0 37 198.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.849999999999994 9.675 5.025 33.45 2 21.674629117425194 8.850892632637667 36.20819713351773 33.266281116419414 3 19.325 15.2 23.75 41.725 4 26.075 19.75 21.9 32.275 5 29.15 25.575 21.8 23.474999999999998 6 23.825 29.75 21.325 25.1 7 20.424999999999997 23.75 38.125 17.7 8 20.7 23.150000000000002 30.725 25.424999999999997 9 20.575 21.05 33.375 25.0 10-14 23.080000000000002 25.465 26.05 25.405 15-19 23.575 24.38 25.385 26.66 20-24 23.785 25.245 25.155 25.814999999999998 25-29 23.255 24.945 25.974999999999998 25.825 30-34 23.62 24.3 25.46 26.619999999999997 35-39 23.44 24.709999999999997 25.485000000000003 26.365 40-44 23.325000000000003 24.7 25.695 26.279999999999998 45-49 24.03 24.785 24.775 26.41 50-54 23.97 24.515 25.19 26.325 55-59 24.055 23.96 25.845000000000002 26.14 60-64 24.33 24.515 25.009999999999998 26.145000000000003 65-69 23.59 24.310000000000002 25.295 26.805 70-74 24.165 24.55 24.995 26.290000000000003 75-79 24.095 24.8 24.834999999999997 26.27 80-84 24.245 24.425 25.314999999999998 26.015 85-89 23.995 24.545 25.040000000000003 26.419999999999998 90-94 24.12 24.22 25.224999999999998 26.435 95-99 23.97 24.115000000000002 25.16 26.755000000000003 100-104 24.65 24.035 24.95 26.365 105-109 24.654999999999998 24.875 24.01 26.46 110-114 24.085 24.125 24.88 26.91 115-119 24.305 24.7 24.425 26.57 120-124 24.37 23.625 25.22 26.784999999999997 125-129 24.575 24.275 25.009999999999998 26.14 130-134 24.495 24.795 24.025 26.685 135-139 25.61 23.9 24.685000000000002 25.805 140-144 24.875 24.495 24.27 26.36 145-149 25.025 24.215 24.740000000000002 26.02 150-151 26.2625 24.8625 23.400000000000002 25.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 2.0 26 2.0 27 2.0 28 3.5 29 5.0 30 7.0 31 10.5 32 15.0 33 20.0 34 19.5 35 28.5 36 45.5 37 60.0 38 65.0 39 82.0 40 108.5 41 143.0 42 170.5 43 166.0 44 171.0 45 178.0 46 177.0 47 179.0 48 193.0 49 191.0 50 155.5 51 131.0 52 127.0 53 124.5 54 113.5 55 101.5 56 100.0 57 92.5 58 82.0 59 85.5 60 78.0 61 70.0 62 71.0 63 71.0 64 70.5 65 64.5 66 59.0 67 58.5 68 55.0 69 47.5 70 42.5 71 37.0 72 36.5 73 29.0 74 16.5 75 11.0 76 8.5 77 5.0 78 3.0 79 1.5 80 1.5 81 1.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.0 #Duplication Level Percentage of deduplicated Percentage of total 1 87.816091954023 76.4 2 10.316091954022987 17.95 3 1.4080459770114941 3.675 4 0.28735632183908044 1.0 5 0.11494252873563218 0.5 6 0.028735632183908046 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.028735632183908046 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGCGAGTTGCCCCACGCCAGCACGGTCAGCCCCAGCGTCGCTGGGTCCA 13 0.325 No Hit TCTCGATTTGTTCCACATGGTTGATTGACCGACCAATGCCACCATGCATA 6 0.15 No Hit CCACCATTGTTTCCATATCCTCCACCGTTGTTACCATATCCTCCACCATT 5 0.125 No Hit CTATTGAATGGTACCTGGAGCTTTCAATTCCTAGCACAAGGGAATCCCGG 5 0.125 No Hit GTCCGCGTAGTCCACGGCGGGCGGCGCGTCCGCCACCGCGCAGATGGACA 5 0.125 No Hit GGCCTAGTGGTAGGGATTGTTCCGCACAGATCATTACCAGAAACATCAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.3624999999999998 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.8375 0.0 0.0 0.0 0.0 120-121 2.1125 0.0 0.0 0.0 0.0 122-123 2.15 0.0 0.0 0.0 0.0 124-125 2.3875 0.0 0.0 0.0 0.0 126-127 2.6625 0.0 0.0 0.0 0.0 128-129 3.05 0.0 0.0 0.0 0.0 130-131 3.325 0.0 0.0 0.0 0.0 132-133 3.625 0.0 0.0 0.0 0.0 134-135 4.0875 0.0 0.0 0.0 0.0 136-137 4.4625 0.0 0.0 0.0 0.0 138-139 5.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCGCCT 10 0.006830828 145.0 7 TGCAGCG 10 0.006830828 145.0 4 >>END_MODULE SRR18694419 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694419_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.2295 37.0 37.0 37.0 25.0 37.0 2 34.9645 37.0 37.0 37.0 25.0 37.0 3 35.1255 37.0 37.0 37.0 25.0 37.0 4 35.2195 37.0 37.0 37.0 25.0 37.0 5 35.0885 37.0 37.0 37.0 25.0 37.0 6 35.3925 37.0 37.0 37.0 37.0 37.0 7 35.113 37.0 37.0 37.0 25.0 37.0 8 35.4475 37.0 37.0 37.0 37.0 37.0 9 35.526 37.0 37.0 37.0 37.0 37.0 10-14 35.541399999999996 37.0 37.0 37.0 37.0 37.0 15-19 35.6111 37.0 37.0 37.0 37.0 37.0 20-24 35.3898 37.0 37.0 37.0 34.6 37.0 25-29 35.5634 37.0 37.0 37.0 32.2 37.0 30-34 35.78189999999999 37.0 37.0 37.0 37.0 37.0 35-39 35.5641 37.0 37.0 37.0 34.6 37.0 40-44 35.3007 37.0 37.0 37.0 29.8 37.0 45-49 35.5116 37.0 37.0 37.0 37.0 37.0 50-54 34.8451 37.0 37.0 37.0 27.0 37.0 55-59 34.3855 37.0 37.0 37.0 25.0 37.0 60-64 34.9988 37.0 37.0 37.0 27.4 37.0 65-69 34.165600000000005 37.0 34.6 37.0 29.8 37.0 70-74 32.9851 37.0 29.8 37.0 22.2 37.0 75-79 33.5903 37.0 34.6 37.0 22.2 37.0 80-84 34.5917 37.0 37.0 37.0 25.0 37.0 85-89 32.732 37.0 32.2 37.0 19.4 37.0 90-94 34.095800000000004 37.0 37.0 37.0 25.0 37.0 95-99 33.942899999999995 37.0 37.0 37.0 25.0 37.0 100-104 33.588300000000004 37.0 37.0 37.0 25.0 37.0 105-109 34.299400000000006 37.0 37.0 37.0 25.0 37.0 110-114 34.593999999999994 37.0 37.0 37.0 25.0 37.0 115-119 34.5459 37.0 37.0 37.0 25.0 37.0 120-124 34.152 37.0 37.0 37.0 25.0 37.0 125-129 34.1488 37.0 37.0 37.0 25.0 37.0 130-134 33.876000000000005 37.0 37.0 37.0 25.0 37.0 135-139 32.3498 37.0 27.4 37.0 13.8 37.0 140-144 31.6385 37.0 25.0 37.0 11.0 37.0 145-149 31.2596 37.0 25.0 37.0 11.0 37.0 150-151 30.91675 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 2.0 17 2.0 18 4.0 19 4.0 20 5.0 21 1.0 22 8.0 23 1.0 24 12.0 25 6.0 26 9.0 27 12.0 28 21.0 29 52.0 30 66.0 31 136.0 32 259.0 33 554.0 34 1136.0 35 1476.0 36 232.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.875 21.3 7.75 29.075 2 30.375000000000004 23.974999999999998 25.1 20.549999999999997 3 23.1 24.3 28.075 24.525 4 26.424999999999997 28.525 20.875 24.175 5 30.625000000000004 31.65 17.549999999999997 20.175 6 23.875 35.449999999999996 19.175 21.5 7 22.25 19.775000000000002 33.975 24.0 8 24.025 21.625 23.65 30.7 9 24.725 23.125 25.2 26.950000000000003 10-14 26.22 25.44 22.7 25.64 15-19 26.61 24.605 23.175 25.61 20-24 25.91 25.635 23.315 25.14 25-29 26.484999999999996 24.89 23.225 25.4 30-34 26.75 24.6 24.01 24.64 35-39 26.715 24.404999999999998 23.84 25.040000000000003 40-44 25.985000000000003 24.925 23.605 25.485000000000003 45-49 27.060000000000002 24.57 23.915 24.455 50-54 25.35 24.635 25.56 24.455 55-59 26.834999999999997 25.435000000000002 22.675 25.055 60-64 26.484999999999996 24.29 24.325 24.9 65-69 27.0 24.215 23.765 25.019999999999996 70-74 27.060000000000002 24.02 24.065 24.855 75-79 27.175 23.369999999999997 24.46 24.995 80-84 26.555 25.080000000000002 23.51 24.855 85-89 23.635 27.67 23.48 25.215 90-94 26.56 24.825 24.115000000000002 24.5 95-99 26.240000000000002 25.56 23.549999999999997 24.65 100-104 26.765 24.795 23.285 25.155 105-109 26.540000000000003 24.91 23.84 24.709999999999997 110-114 26.61 25.0 23.57 24.82 115-119 27.32 25.040000000000003 23.189999999999998 24.45 120-124 27.029999999999998 24.45 24.3 24.22 125-129 27.195000000000004 24.735 23.72 24.349999999999998 130-134 27.139999999999997 24.665 24.13 24.065 135-139 27.41 25.94 23.135 23.515 140-144 27.029999999999998 25.365 23.355 24.25 145-149 27.584999999999997 25.569999999999997 23.405 23.44 150-151 25.75 25.0 26.4625 22.787499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.5 22 1.0 23 0.0 24 0.5 25 2.5 26 4.0 27 2.0 28 2.0 29 5.5 30 7.5 31 8.0 32 7.0 33 11.5 34 18.0 35 28.5 36 39.5 37 63.5 38 78.0 39 81.5 40 104.0 41 124.0 42 135.5 43 139.0 44 147.5 45 169.5 46 184.0 47 178.0 48 169.0 49 167.5 50 151.0 51 126.5 52 115.0 53 106.0 54 99.0 55 102.0 56 107.5 57 107.5 58 111.5 59 100.5 60 88.5 61 86.5 62 88.5 63 93.5 64 89.5 65 82.0 66 72.0 67 61.0 68 58.0 69 67.0 70 57.5 71 36.5 72 29.5 73 25.5 74 16.5 75 7.5 76 5.5 77 5.0 78 4.5 79 3.5 80 1.0 81 1.5 82 1.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.5 88 2.0 89 1.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.875 #Duplication Level Percentage of deduplicated Percentage of total 1 89.07539118065434 78.27499999999999 2 9.132290184921764 16.05 3 1.3086770981507825 3.45 4 0.2844950213371266 1.0 5 0.08534850640113799 0.375 6 0.028449502133712664 0.15 7 0.028449502133712664 0.17500000000000002 8 0.028449502133712664 0.2 9 0.0 0.0 >10 0.028449502133712664 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGGCTCGCCGGCGGCTTCGTCATGAGCGTAGCCTGGGCGTACGTCATC 13 0.325 No Hit CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 8 0.2 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GCTCCTTCGACGGCAGGAGACATTGCGTACATTGATTATCTCTTCTTGGG 6 0.15 No Hit CATCACTCCAAGGGAGTGCCTTCAACATTCCAGGCGATAAGTGACTGGAG 5 0.125 No Hit CAACTTCGATTCCACAGGTTAATTGTAGTTCCTCCGCTGCTTCTGTCGAT 5 0.125 No Hit ATCACACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.3875000000000002 0.0 0.0 0.0 0.0 114-115 1.4875 0.0 0.0 0.0 0.0 116-117 1.625 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 2.1125 0.0 0.0 0.0 0.0 122-123 2.15 0.0 0.0 0.0 0.0 124-125 2.3875 0.0 0.0 0.0 0.0 126-127 2.6625 0.0 0.0 0.0 0.0 128-129 3.0375 0.0 0.0 0.0 0.0 130-131 3.3 0.0 0.0 0.0 0.0 132-133 3.575 0.0 0.0 0.0 0.0 134-135 4.0375 0.0 0.0 0.0 0.0 136-137 4.4125 0.0 0.0 0.0 0.0 138-139 5.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTGGA 10 0.006830828 145.0 4 TTGGACG 10 0.006830828 145.0 6 >>END_MODULE Read 664384 spots for SRR18694419.sra Written 664384 spots for SRR18694419.sra Read 664384 spots for SRR18694419.sra Written 664384 spots for SRR18694419.sra Read 664384 spots for SRR18694419.sra Written 664384 spots for SRR18694419.sra Read 664384 spots for SRR18694419.sra Written 664384 spots for SRR18694419.sra Read 664384 spots for SRR18694419.sra Written 664384 spots for SRR18694419.sra Read 664384 spots for SRR18694419.sra Written 664384 spots for SRR18694419.sra Read 664384 spots for SRR18694419.sra Written 664384 spots for SRR18694419.sra Read 664384 spots for SRR18694419.sra Written 664384 spots for SRR18694419.sra Read 664384 spots for SRR18694419.sra Written 664384 spots for SRR18694419.sra Read 664384 spots for SRR18694419.sra Written 664384 spots for SRR18694419.sra Read 664384 spots for SRR18694419.sra Written 664384 spots for SRR18694419.sra Read 664384 spots for SRR18694419.sra Written 664384 spots for SRR18694419.sra Read 664384 spots for SRR18694419.sra Written 664384 spots for SRR18694419.sra Read 664384 spots for SRR18694419.sra Written 664384 spots for SRR18694419.sra Read 664384 spots for SRR18694419.sra Written 664384 spots for SRR18694419.sra Read 664384 spots for SRR18694419.sra Written 664384 spots for SRR18694419.sra Read 664384 spots for SRR18694419.sra Written 664384 spots for SRR18694419.sra Read 664384 spots for SRR18694419.sra Written 664384 spots for SRR18694419.sra Read 664384 spots for SRR18694419.sra Written 664384 spots for SRR18694419.sra Read 664398 spots for SRR18694419.sra Written 664398 spots for SRR18694419.sra SRR ids: ['SRR18694419.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sjhs0l2a SRR18694419.sra spots: 13287694 blocks: [[1, 664384], [664385, 1328768], [1328769, 1993152], [1993153, 2657536], [2657537, 3321920], [3321921, 3986304], [3986305, 4650688], [4650689, 5315072], [5315073, 5979456], [5979457, 6643840], [6643841, 7308224], [7308225, 7972608], [7972609, 8636992], [8636993, 9301376], [9301377, 9965760], [9965761, 10630144], [10630145, 11294528], [11294529, 11958912], [11958913, 12623296], [12623297, 13287694]] SRR18694419 file size 4494039 SRR18694419 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694419 SRR18694419_1.fastq SRR18694419_2.fastq Input file: SRR18694419_1.fastq Paired file: SRR18694419_2.fastq trimmed: SRR18694419-trimmed-pair1.fastq, SRR18694419-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:23:32 2024 >> started Thu Dec 12 03:24:17 2024 >> done (45.523s) 13287694 read pairs processed; of these: 109 ( 0.00%) short read pairs filtered out after trimming by size control 5203 ( 0.04%) empty read pairs filtered out after trimming by size control 13282382 (99.96%) read pairs available; of these: 1242828 ( 9.36%) trimmed read pairs available after processing 12039554 (90.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 9 0.00% 20 13 0.00% 21 15 0.00% 22 22 0.00% 23 11 0.00% 24 17 0.00% 25 25 0.00% 26 21 0.00% 27 18 0.00% 28 19 0.00% 29 25 0.00% 30 33 0.00% 31 34 0.00% 32 32 0.00% 33 26 0.00% 34 32 0.00% 35 44 0.00% 36 28 0.00% 37 50 0.00% 38 39 0.00% 39 45 0.00% 40 38 0.00% 41 43 0.00% 42 44 0.00% 43 33 0.00% 44 48 0.00% 45 57 0.00% 46 53 0.00% 47 33 0.00% 48 44 0.00% 49 83 0.00% 50 68 0.00% 51 91 0.00% 52 65 0.00% 53 110 0.00% 54 95 0.00% 55 89 0.00% 56 111 0.00% 57 106 0.00% 58 123 0.00% 59 176 0.00% 60 181 0.00% 61 207 0.00% 62 255 0.00% 63 248 0.00% 64 260 0.00% 65 281 0.00% 66 305 0.00% 67 365 0.00% 68 419 0.00% 69 431 0.00% 70 539 0.00% 71 610 0.00% 72 685 0.01% 73 804 0.01% 74 816 0.01% 75 915 0.01% 76 1073 0.01% 77 1106 0.01% 78 1350 0.01% 79 1382 0.01% 80 1571 0.01% 81 1812 0.01% 82 2000 0.02% 83 2169 0.02% 84 2418 0.02% 85 2572 0.02% 86 2902 0.02% 87 2920 0.02% 88 3303 0.02% 89 3671 0.03% 90 3875 0.03% 91 4221 0.03% 92 4407 0.03% 93 4923 0.04% 94 5170 0.04% 95 5569 0.04% 96 5970 0.04% 97 6372 0.05% 98 6491 0.05% 99 7137 0.05% 100 7544 0.06% 101 7854 0.06% 102 8605 0.06% 103 8798 0.07% 104 9172 0.07% 105 9377 0.07% 106 9927 0.07% 107 10598 0.08% 108 10885 0.08% 109 11462 0.09% 110 11986 0.09% 111 12517 0.09% 112 13301 0.10% 113 13697 0.10% 114 14568 0.11% 115 15131 0.11% 116 15974 0.12% 117 16177 0.12% 118 17174 0.13% 119 17145 0.13% 120 18137 0.14% 121 18364 0.14% 122 19263 0.15% 123 20031 0.15% 124 21224 0.16% 125 21892 0.16% 126 21977 0.17% 127 23212 0.17% 128 23911 0.18% 129 24745 0.19% 130 25585 0.19% 131 26358 0.20% 132 27151 0.20% 133 27986 0.21% 134 27725 0.21% 135 29419 0.22% 136 30258 0.23% 137 30385 0.23% 138 30916 0.23% 139 31870 0.24% 140 32884 0.25% 141 33136 0.25% 142 34460 0.26% 143 35468 0.27% 144 35825 0.27% 145 37108 0.28% 146 37809 0.28% 147 39015 0.29% 148 39756 0.30% 149 40730 0.31% 150 40552 0.31% 151 12039554 90.64% 13282382 reads passed initial QC criterion=sequence-density sequence-density=1.26 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=34 prefix-density=1.37 prefix-fanout=2.3 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=34 fanout-score=77.83 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=10.7 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=25 prefix-density=0.76 prefix-fanout=2.8 sequence=TGCAAGTGCGGCA criterion=fanout-score sequence-density=0.17 sequence-density-rank=11 fanout-score=63.06 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=15.8 sequence=CAAGAAGAAGGT SRR18694419 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:25:31 Started mapping on | Dec 12 03:25:31 Finished on | Dec 12 03:27:05 Mapping speed, Million of reads per hour | 508.69 Number of input reads | 13282382 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12555694 Uniquely mapped reads % | 94.53% Average mapped length | 296.38 Number of splices: Total | 13338027 Number of splices: Annotated (sjdb) | 12476509 Number of splices: GT/AG | 13160988 Number of splices: GC/AG | 150365 Number of splices: AT/AC | 6172 Number of splices: Non-canonical | 20502 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.01% Deletion average length | 2.49 Insertion rate per base | 0.01% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 195932 % of reads mapped to multiple loci | 1.48% Number of reads mapped to too many loci | 17756 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.65% % of reads unmapped: other | 1.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 530756 530756 530756 N_multimapping 195932 195932 195932 N_noFeature 535817 12194162 637234 N_ambiguous 308282 1959 48019 UnstrandedReadsAssigned:11711595 PositiveStrandReadsAssigned:359573 NegativeStrandReadsAssigned:11870441 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694419 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694419-trimmed-pair1.fastq SRR18694419-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,282,382 reads, 12,018,778 reads pseudoaligned [quant] estimated average fragment length: 261.945 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52973 SRR18694419.ke.tsv 35125 SRR18694419.se.tsv 88098 total ==> SRR18694419.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 675.346 0 0 PNS24247 1044 783.055 46.8152 6.61021 PNS24249 1928 1667.06 56.7541 3.76416 PNS24246 1044 783.055 46.8152 6.61021 PNS24248 1044 783.055 46.8152 6.61021 PNS24244 1471 1210.06 48.8005 4.45902 PNS24243 293 92.7201 0 0 KQK14069 1603 1342.06 4364.78 359.595 KQK14071 474 234.443 72.3114 34.1028 ==> SRR18694419.se.tsv <== BRADI_1g14170v3 4763 BRADI_1g53295v3 59 BRADI_1g59795v3 607 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 584 BRADI_1g74790v3 184 BRADI_1g09890v3 3 BRADI_1g77505v3 214 BRADI_1g48960v3 0 SRR18694419 completed mapping pipeline successfully