Starting /dee2/code/volunteer_pipeline.sh SRR18694420 current disk space = 1515139772416 free memory = 1594186128 SRR18694420 SRAfilesize 3922521758fcce9acf917679c23556ba SRR18694420.sra SRR18694420.sra file validated SRR18694420 is paired end SRR18694420 is conventional basespace SRR18694420 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694420_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.115 37.0 37.0 37.0 37.0 37.0 2 35.9475 37.0 37.0 37.0 37.0 37.0 3 36.376 37.0 37.0 37.0 37.0 37.0 4 36.5055 37.0 37.0 37.0 37.0 37.0 5 36.446 37.0 37.0 37.0 37.0 37.0 6 36.4525 37.0 37.0 37.0 37.0 37.0 7 36.4945 37.0 37.0 37.0 37.0 37.0 8 36.5045 37.0 37.0 37.0 37.0 37.0 9 36.636 37.0 37.0 37.0 37.0 37.0 10-14 36.5723 37.0 37.0 37.0 37.0 37.0 15-19 36.575399999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.6148 37.0 37.0 37.0 37.0 37.0 25-29 36.554700000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.5052 37.0 37.0 37.0 37.0 37.0 35-39 36.672999999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.5829 37.0 37.0 37.0 37.0 37.0 45-49 36.3988 37.0 37.0 37.0 37.0 37.0 50-54 36.4727 37.0 37.0 37.0 37.0 37.0 55-59 36.4708 37.0 37.0 37.0 37.0 37.0 60-64 36.4856 37.0 37.0 37.0 37.0 37.0 65-69 36.3009 37.0 37.0 37.0 37.0 37.0 70-74 36.407700000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.5106 37.0 37.0 37.0 37.0 37.0 80-84 36.380399999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.2161 37.0 37.0 37.0 37.0 37.0 90-94 35.3887 37.0 37.0 37.0 29.8 37.0 95-99 36.151300000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.1344 37.0 37.0 37.0 37.0 37.0 105-109 36.1846 37.0 37.0 37.0 37.0 37.0 110-114 36.2448 37.0 37.0 37.0 37.0 37.0 115-119 36.479200000000006 37.0 37.0 37.0 37.0 37.0 120-124 36.571400000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.554899999999996 37.0 37.0 37.0 37.0 37.0 130-134 36.5127 37.0 37.0 37.0 37.0 37.0 135-139 36.3646 37.0 37.0 37.0 37.0 37.0 140-144 36.1991 37.0 37.0 37.0 37.0 37.0 145-149 36.1248 37.0 37.0 37.0 37.0 37.0 150-151 33.7485 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 2.0 25 3.0 26 3.0 27 2.0 28 3.0 29 1.0 30 11.0 31 13.0 32 22.0 33 60.0 34 125.0 35 346.0 36 3213.0 37 194.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.6 10.424999999999999 4.75 36.225 2 21.285140562248998 9.989959839357429 35.81827309236948 32.9066265060241 3 21.224999999999998 13.875000000000002 25.45 39.45 4 26.5 19.0 21.75 32.75 5 26.25 28.449999999999996 23.45 21.85 6 26.0 28.725 22.375 22.900000000000002 7 19.35 25.074999999999996 37.05 18.525 8 20.025000000000002 23.150000000000002 30.3 26.525 9 20.4 20.65 33.900000000000006 25.05 10-14 23.03 26.72 25.6 24.65 15-19 23.215 25.035 25.729999999999997 26.02 20-24 23.695 24.935 25.55 25.82 25-29 23.275000000000002 25.264999999999997 25.874999999999996 25.585 30-34 23.73 24.735 25.405 26.13 35-39 23.57 24.465 25.94 26.025 40-44 23.645 24.349999999999998 26.105 25.900000000000002 45-49 23.630000000000003 24.88 25.405 26.085 50-54 22.759999999999998 24.735 25.765 26.740000000000002 55-59 23.79 24.865000000000002 24.955 26.39 60-64 23.74 25.2 25.324999999999996 25.735000000000003 65-69 23.445 25.174999999999997 25.290000000000003 26.090000000000003 70-74 24.025 24.959999999999997 25.590000000000003 25.424999999999997 75-79 24.14 24.72 24.995 26.145000000000003 80-84 23.990000000000002 24.765 25.355 25.89 85-89 24.145 25.074999999999996 24.83 25.95 90-94 24.945 24.505 24.54 26.009999999999998 95-99 24.095 24.72 24.745 26.44 100-104 23.46 24.735 25.855 25.95 105-109 24.295 24.645 24.93 26.13 110-114 24.315 24.325 25.22 26.14 115-119 23.735 25.15 25.28 25.835 120-124 24.404999999999998 25.655 24.36 25.580000000000002 125-129 23.97 24.46 24.8 26.77 130-134 24.215 25.66 24.060000000000002 26.064999999999998 135-139 24.21 25.305 24.7 25.785000000000004 140-144 23.915 25.385 24.474999999999998 26.224999999999998 145-149 24.68 24.990000000000002 23.96 26.369999999999997 150-151 23.9125 24.925 24.837500000000002 26.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.5 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 2.0 27 2.0 28 2.0 29 4.0 30 7.5 31 9.0 32 10.0 33 16.5 34 23.0 35 31.0 36 45.5 37 56.5 38 66.5 39 88.0 40 117.0 41 144.5 42 151.5 43 171.5 44 183.0 45 182.0 46 189.0 47 185.0 48 183.5 49 190.5 50 178.0 51 150.0 52 139.0 53 126.5 54 114.5 55 112.5 56 107.0 57 79.5 58 84.0 59 95.0 60 86.0 61 84.0 62 69.0 63 59.0 64 58.0 65 56.0 66 54.5 67 51.5 68 46.5 69 38.5 70 36.5 71 31.5 72 20.5 73 18.5 74 14.0 75 8.5 76 7.0 77 4.0 78 2.0 79 1.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.25 #Duplication Level Percentage of deduplicated Percentage of total 1 87.33333333333333 75.325 2 10.46376811594203 18.05 3 1.5942028985507246 4.125 4 0.463768115942029 1.6 5 0.057971014492753624 0.25 6 0.028985507246376812 0.15 7 0.0 0.0 8 0.028985507246376812 0.2 9 0.0 0.0 >10 0.028985507246376812 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTAAACACGAATACACGATACACCCTATGCAACACACTTTGTCCCGTGTC 12 0.3 No Hit GTCAAGCGTCGAAGATGTACAGCACTGCACAAAACATCTGTCTTGGGAAG 8 0.2 No Hit GTCCTTACAAGTCCGCTCCTCGGGGAGCTTGATTGATAATTCTGTATAAG 6 0.15 No Hit CCCCATGTGGCAGTGTGGCGAGTCTCGGAGCCGAGCCCGAAGTACTGGCC 5 0.125 No Hit GCTGTGACTCGAGGTAGGCGCGGAGATCATCGTAGCTCAAGAGGGAGAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.5375000000000001 0.0 0.0 0.0 0.0 88-89 0.5874999999999999 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.6499999999999999 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.3875 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 1.8375 0.0 0.0 0.0 0.0 104-105 2.05 0.0 0.0 0.0 0.0 106-107 2.325 0.0 0.0 0.0 0.0 108-109 2.5875000000000004 0.0 0.0 0.0 0.0 110-111 2.825 0.0 0.0 0.0 0.0 112-113 3.075 0.0 0.0 0.0 0.0 114-115 3.4 0.0 0.0 0.0 0.0 116-117 3.7625 0.0 0.0 0.0 0.0 118-119 4.375 0.0 0.0 0.0 0.0 120-121 4.887499999999999 0.0 0.0 0.0 0.0 122-123 5.324999999999999 0.0 0.0 0.0 0.0 124-125 5.7875 0.0 0.0 0.0 0.0 126-127 6.2875 0.0 0.0 0.0 0.0 128-129 6.8125 0.0 0.0 0.0 0.0 130-131 7.525 0.0 0.0 0.0 0.0 132-133 8.275 0.0 0.0 0.0 0.0 134-135 8.9375 0.0 0.0 0.0 0.0 136-137 9.575 0.0 0.0 0.0 0.0 138-139 10.225000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCGCTG 10 0.006830828 145.0 2 >>END_MODULE SRR18694420 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694420_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.2745 37.0 37.0 37.0 25.0 37.0 2 35.0345 37.0 37.0 37.0 25.0 37.0 3 35.297 37.0 37.0 37.0 25.0 37.0 4 35.3195 37.0 37.0 37.0 25.0 37.0 5 35.055 37.0 37.0 37.0 25.0 37.0 6 35.224 37.0 37.0 37.0 25.0 37.0 7 35.3855 37.0 37.0 37.0 37.0 37.0 8 35.4725 37.0 37.0 37.0 37.0 37.0 9 35.4545 37.0 37.0 37.0 37.0 37.0 10-14 35.4422 37.0 37.0 37.0 37.0 37.0 15-19 35.4887 37.0 37.0 37.0 37.0 37.0 20-24 35.3528 37.0 37.0 37.0 34.6 37.0 25-29 35.4638 37.0 37.0 37.0 32.2 37.0 30-34 35.6616 37.0 37.0 37.0 37.0 37.0 35-39 35.567600000000006 37.0 37.0 37.0 37.0 37.0 40-44 35.266099999999994 37.0 37.0 37.0 29.8 37.0 45-49 35.4358 37.0 37.0 37.0 34.6 37.0 50-54 34.807900000000004 37.0 37.0 37.0 27.0 37.0 55-59 34.3303 37.0 37.0 37.0 25.0 37.0 60-64 34.9599 37.0 37.0 37.0 27.4 37.0 65-69 34.1057 37.0 34.6 37.0 27.4 37.0 70-74 32.836 37.0 29.8 37.0 19.4 37.0 75-79 33.5057 37.0 34.6 37.0 22.2 37.0 80-84 34.447 37.0 37.0 37.0 25.0 37.0 85-89 32.5427 37.0 32.2 37.0 19.4 37.0 90-94 34.049699999999994 37.0 37.0 37.0 25.0 37.0 95-99 33.938100000000006 37.0 37.0 37.0 25.0 37.0 100-104 33.3562 37.0 37.0 37.0 25.0 37.0 105-109 34.1734 37.0 37.0 37.0 25.0 37.0 110-114 34.436 37.0 37.0 37.0 25.0 37.0 115-119 34.418899999999994 37.0 37.0 37.0 25.0 37.0 120-124 34.1315 37.0 37.0 37.0 25.0 37.0 125-129 33.9644 37.0 37.0 37.0 25.0 37.0 130-134 33.77839999999999 37.0 37.0 37.0 25.0 37.0 135-139 32.152699999999996 37.0 27.4 37.0 13.8 37.0 140-144 31.630499999999994 37.0 25.0 37.0 11.0 37.0 145-149 31.3572 37.0 25.0 37.0 11.0 37.0 150-151 30.779249999999998 37.0 25.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 3.0 16 6.0 17 10.0 18 10.0 19 5.0 20 1.0 21 5.0 22 5.0 23 12.0 24 9.0 25 7.0 26 11.0 27 11.0 28 24.0 29 43.0 30 77.0 31 133.0 32 228.0 33 495.0 34 1189.0 35 1474.0 36 241.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.125 21.425 7.775 26.674999999999997 2 30.0 22.225 26.525 21.25 3 24.125 24.675 28.599999999999998 22.6 4 27.975 29.675 19.85 22.5 5 28.249999999999996 30.9 20.349999999999998 20.5 6 24.275 35.05 19.400000000000002 21.275 7 24.4 19.925 33.300000000000004 22.375 8 23.400000000000002 24.025 24.55 28.025 9 24.825 21.775 26.400000000000002 27.0 10-14 26.515 26.179999999999996 22.3 25.005 15-19 27.034999999999997 25.28 22.96 24.725 20-24 26.045 24.785 24.18 24.990000000000002 25-29 26.545 25.259999999999998 23.095 25.1 30-34 25.990000000000002 25.069999999999997 23.974999999999998 24.965 35-39 26.400000000000002 25.46 23.59 24.55 40-44 26.75 25.115 23.555 24.58 45-49 25.72 24.645 24.605 25.03 50-54 25.21 24.915000000000003 25.05 24.825 55-59 25.135 25.665 24.08 25.119999999999997 60-64 26.575 24.834999999999997 23.895 24.695 65-69 26.634999999999998 25.119999999999997 23.62 24.625 70-74 26.96 24.2 24.154999999999998 24.685000000000002 75-79 27.675 23.485 24.07 24.77 80-84 25.924999999999997 25.8 23.76 24.515 85-89 23.599999999999998 28.060000000000002 23.51 24.83 90-94 26.179999999999996 25.074999999999996 24.465 24.279999999999998 95-99 26.26 26.06 23.07 24.610000000000003 100-104 26.19 25.545 23.385 24.88 105-109 26.205000000000002 26.245 24.21 23.34 110-114 26.015 26.665 23.535 23.785 115-119 27.48 25.929999999999996 23.380000000000003 23.21 120-124 26.085 25.679999999999996 24.29 23.945 125-129 27.01 25.674999999999997 24.26 23.055 130-134 26.855 26.05 23.599999999999998 23.494999999999997 135-139 27.16 25.509999999999998 23.96 23.369999999999997 140-144 27.16 25.874999999999996 23.71 23.255 145-149 27.375 26.205000000000002 23.875 22.545 150-151 25.7875 24.85 26.987499999999997 22.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 2.5 22 2.0 23 2.0 24 1.5 25 0.5 26 0.5 27 2.0 28 3.0 29 4.5 30 8.5 31 11.5 32 15.0 33 20.0 34 22.0 35 33.5 36 47.0 37 56.5 38 68.0 39 81.0 40 105.0 41 124.0 42 130.5 43 134.5 44 169.0 45 196.5 46 178.0 47 167.5 48 172.5 49 173.5 50 157.0 51 135.5 52 134.0 53 132.5 54 125.5 55 103.5 56 84.0 57 97.0 58 94.0 59 94.5 60 96.0 61 85.0 62 70.5 63 64.5 64 75.5 65 73.0 66 58.5 67 48.5 68 55.0 69 52.0 70 47.0 71 45.5 72 37.0 73 27.5 74 18.0 75 11.0 76 9.5 77 9.5 78 6.5 79 4.0 80 1.5 81 1.5 82 1.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 1.0 95 1.0 96 0.5 97 1.0 98 1.0 99 1.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.1 #Duplication Level Percentage of deduplicated Percentage of total 1 88.71986222732492 77.275 2 9.041331802525834 15.75 3 1.6360505166475316 4.275 4 0.3731343283582089 1.3 5 0.08610792192881744 0.375 6 0.02870264064293915 0.15 7 0.02870264064293915 0.17500000000000002 8 0.0 0.0 9 0.0574052812858783 0.44999999999999996 >10 0.02870264064293915 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCGGTGGATCCGGTGATCTGGGGCGACGAGGAGCGGATGAAGAGGGAGC 10 0.25 No Hit CACACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAG 9 0.22499999999999998 No Hit CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 9 0.22499999999999998 No Hit AGAAGGCTGAATACGCAGAGAAGATGAAGAACAAGGCTGCAATGATCCAC 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 5 0.125 No Hit GCGCAATTATCCCCGTCCTGATTTACTGGACTCGCAACGTGGGTCCATCA 5 0.125 No Hit CAAAAGAAAAGAAAAGAAGAGTAGACAGACACTTGTTCCATCCATCCATG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.2375 0.0 0.0 0.0 0.0 100-101 1.5750000000000002 0.0 0.0 0.0 0.0 102-103 1.7000000000000002 0.0 0.0 0.0 0.0 104-105 1.925 0.0 0.0 0.0 0.0 106-107 2.2249999999999996 0.0 0.0 0.0 0.0 108-109 2.4875 0.0 0.0 0.0 0.0 110-111 2.7249999999999996 0.0 0.0 0.0 0.0 112-113 2.9749999999999996 0.0 0.0 0.0 0.0 114-115 3.3 0.0 0.0 0.0 0.0 116-117 3.6624999999999996 0.0 0.0 0.0 0.0 118-119 4.275 0.0 0.0 0.0 0.0 120-121 4.7875 0.0 0.0 0.0 0.0 122-123 5.225 0.0 0.0 0.0 0.0 124-125 5.6875 0.0 0.0 0.0 0.0 126-127 6.1875 0.0 0.0 0.0 0.0 128-129 6.7125 0.0 0.0 0.0 0.0 130-131 7.425 0.0 0.0 0.0 0.0 132-133 8.1375 0.0 0.0 0.0 0.0 134-135 8.7375 0.0 0.0 0.0 0.0 136-137 9.375 0.0 0.0 0.0 0.0 138-139 10.024999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 548999 spots for SRR18694420.sra Written 548999 spots for SRR18694420.sra Read 548999 spots for SRR18694420.sra Written 548999 spots for SRR18694420.sra Read 548999 spots for SRR18694420.sra Written 548999 spots for SRR18694420.sra Read 548999 spots for SRR18694420.sra Written 548999 spots for SRR18694420.sra Read 549012 spots for SRR18694420.sra Written 549012 spots for SRR18694420.sra Read 548999 spots for SRR18694420.sra Written 548999 spots for SRR18694420.sra Read 548999 spots for SRR18694420.sra Written 548999 spots for SRR18694420.sra Read 548999 spots for SRR18694420.sra Written 548999 spots for SRR18694420.sra Read 548999 spots for SRR18694420.sra Written 548999 spots for SRR18694420.sra Read 548999 spots for SRR18694420.sra Written 548999 spots for SRR18694420.sra Read 548999 spots for SRR18694420.sra Written 548999 spots for SRR18694420.sra Read 548999 spots for SRR18694420.sra Written 548999 spots for SRR18694420.sra Read 548999 spots for SRR18694420.sra Written 548999 spots for SRR18694420.sra Read 548999 spots for SRR18694420.sra Written 548999 spots for SRR18694420.sra Read 548999 spots for SRR18694420.sra Written 548999 spots for SRR18694420.sra Read 548999 spots for SRR18694420.sra Written 548999 spots for SRR18694420.sra Read 548999 spots for SRR18694420.sra Written 548999 spots for SRR18694420.sra Read 548999 spots for SRR18694420.sra Written 548999 spots for SRR18694420.sra Read 548999 spots for SRR18694420.sra Written 548999 spots for SRR18694420.sra Read 548999 spots for SRR18694420.sra Written 548999 spots for SRR18694420.sra SRR ids: ['SRR18694420.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h93xmldc SRR18694420.sra spots: 10979993 blocks: [[1, 548999], [549000, 1097998], [1097999, 1646997], [1646998, 2195996], [2195997, 2744995], [2744996, 3293994], [3293995, 3842993], [3842994, 4391992], [4391993, 4940991], [4940992, 5489990], [5489991, 6038989], [6038990, 6587988], [6587989, 7136987], [7136988, 7685986], [7685987, 8234985], [8234986, 8783984], [8783985, 9332983], [9332984, 9881982], [9881983, 10430981], [10430982, 10979993]] SRR18694420 file size 3709781 SRR18694420 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694420 SRR18694420_1.fastq SRR18694420_2.fastq Input file: SRR18694420_1.fastq Paired file: SRR18694420_2.fastq trimmed: SRR18694420-trimmed-pair1.fastq, SRR18694420-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:23:33 2024 >> started Thu Dec 12 03:23:46 2024 >> done (12.561s) 10979993 read pairs processed; of these: 78 ( 0.00%) short read pairs filtered out after trimming by size control 11070 ( 0.10%) empty read pairs filtered out after trimming by size control 10968845 (99.90%) read pairs available; of these: 1601408 (14.60%) trimmed read pairs available after processing 9367437 (85.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 8 0.00% 20 6 0.00% 21 13 0.00% 22 8 0.00% 23 13 0.00% 24 12 0.00% 25 15 0.00% 26 20 0.00% 27 16 0.00% 28 14 0.00% 29 12 0.00% 30 38 0.00% 31 27 0.00% 32 29 0.00% 33 37 0.00% 34 27 0.00% 35 24 0.00% 36 25 0.00% 37 24 0.00% 38 30 0.00% 39 50 0.00% 40 45 0.00% 41 34 0.00% 42 44 0.00% 43 42 0.00% 44 40 0.00% 45 45 0.00% 46 68 0.00% 47 55 0.00% 48 57 0.00% 49 74 0.00% 50 101 0.00% 51 112 0.00% 52 99 0.00% 53 105 0.00% 54 120 0.00% 55 121 0.00% 56 163 0.00% 57 144 0.00% 58 226 0.00% 59 240 0.00% 60 288 0.00% 61 306 0.00% 62 376 0.00% 63 427 0.00% 64 473 0.00% 65 519 0.00% 66 575 0.01% 67 625 0.01% 68 766 0.01% 69 874 0.01% 70 921 0.01% 71 1099 0.01% 72 1284 0.01% 73 1432 0.01% 74 1653 0.02% 75 1757 0.02% 76 1929 0.02% 77 2082 0.02% 78 2436 0.02% 79 2737 0.02% 80 3112 0.03% 81 3399 0.03% 82 3773 0.03% 83 3985 0.04% 84 4488 0.04% 85 4873 0.04% 86 5270 0.05% 87 5518 0.05% 88 6084 0.06% 89 6404 0.06% 90 6864 0.06% 91 7214 0.07% 92 7947 0.07% 93 8412 0.08% 94 8930 0.08% 95 9430 0.09% 96 9948 0.09% 97 10798 0.10% 98 10989 0.10% 99 11365 0.10% 100 12025 0.11% 101 12520 0.11% 102 13425 0.12% 103 13657 0.12% 104 14719 0.13% 105 15074 0.14% 106 15849 0.14% 107 16269 0.15% 108 16843 0.15% 109 17475 0.16% 110 18040 0.16% 111 18523 0.17% 112 19323 0.18% 113 19984 0.18% 114 21013 0.19% 115 22074 0.20% 116 22690 0.21% 117 23272 0.21% 118 23974 0.22% 119 24245 0.22% 120 25390 0.23% 121 25211 0.23% 122 26112 0.24% 123 26817 0.24% 124 28030 0.26% 125 28601 0.26% 126 29373 0.27% 127 30106 0.27% 128 30558 0.28% 129 32202 0.29% 130 31755 0.29% 131 32411 0.30% 132 33025 0.30% 133 34247 0.31% 134 33999 0.31% 135 34907 0.32% 136 35244 0.32% 137 36164 0.33% 138 36114 0.33% 139 37626 0.34% 140 37419 0.34% 141 38127 0.35% 142 38969 0.36% 143 39721 0.36% 144 39728 0.36% 145 40765 0.37% 146 41530 0.38% 147 42292 0.39% 148 43112 0.39% 149 43005 0.39% 150 44100 0.40% 151 9367437 85.40% 10968845 reads passed initial QC criterion=sequence-density sequence-density=1.22 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=33 prefix-density=1.32 prefix-fanout=2.3 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=219.63 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=26.6 sequence=CTTCTTCTTGTCCACGTTCTCCACGCTCTTCTCCTGGAACGCAGACATGGCGGACTCCGCCACCAACTTGCCGCTCGACA criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=35 prefix-density=0.69 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=127.30 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=24.0 sequence=GAGGAGGAGCTT SRR18694420 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:24:33 Started mapping on | Dec 12 03:24:33 Finished on | Dec 12 03:26:44 Mapping speed, Million of reads per hour | 301.43 Number of input reads | 10968845 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 10074903 Uniquely mapped reads % | 91.85% Average mapped length | 293.25 Number of splices: Total | 10541702 Number of splices: Annotated (sjdb) | 9834163 Number of splices: GT/AG | 10402084 Number of splices: GC/AG | 118518 Number of splices: AT/AC | 4563 Number of splices: Non-canonical | 16537 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.01% Deletion average length | 2.46 Insertion rate per base | 0.01% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 172677 % of reads mapped to multiple loci | 1.57% Number of reads mapped to too many loci | 18077 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.15% % of reads unmapped: other | 1.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 721265 721265 721265 N_multimapping 172677 172677 172677 N_noFeature 464945 9778220 552696 N_ambiguous 248161 1490 39187 UnstrandedReadsAssigned:9361797 PositiveStrandReadsAssigned:295193 NegativeStrandReadsAssigned:9483020 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694420 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694420-trimmed-pair1.fastq SRR18694420-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,968,845 reads, 9,636,055 reads pseudoaligned [quant] estimated average fragment length: 247.881 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52973 SRR18694420.ke.tsv 35125 SRR18694420.se.tsv 88098 total ==> SRR18694420.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 689.394 0 0 PNS24247 1044 797.119 44.0862 7.8285 PNS24249 1928 1681.12 47.9007 4.03313 PNS24246 1044 797.119 44.0862 7.8285 PNS24248 1044 797.119 44.0862 7.8285 PNS24244 1471 1224.12 46.8406 5.41624 PNS24243 293 101.634 0 0 KQK14069 1603 1356.12 5448.37 568.679 KQK14071 474 246.852 114.024 65.3822 ==> SRR18694420.se.tsv <== BRADI_1g14170v3 5986 BRADI_1g53295v3 51 BRADI_1g59795v3 551 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 360 BRADI_1g74790v3 156 BRADI_1g09890v3 0 BRADI_1g77505v3 148 BRADI_1g48960v3 0 SRR18694420 completed mapping pipeline successfully