Starting /dee2/code/volunteer_pipeline.sh SRR18694421 current disk space = 1515133489152 free memory = 1570659124 SRR18694421 SRAfilesize 68a1fb960f99b54590060c9589b46c6f SRR18694421.sra SRR18694421.sra file validated SRR18694421 is paired end SRR18694421 is conventional basespace SRR18694421 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694421_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9395 37.0 37.0 37.0 37.0 37.0 2 35.64525 37.0 37.0 37.0 37.0 37.0 3 36.2735 37.0 37.0 37.0 37.0 37.0 4 36.5195 37.0 37.0 37.0 37.0 37.0 5 36.426 37.0 37.0 37.0 37.0 37.0 6 36.4635 37.0 37.0 37.0 37.0 37.0 7 36.4225 37.0 37.0 37.0 37.0 37.0 8 36.605 37.0 37.0 37.0 37.0 37.0 9 36.613 37.0 37.0 37.0 37.0 37.0 10-14 36.598200000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.5779 37.0 37.0 37.0 37.0 37.0 20-24 36.598299999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.518 37.0 37.0 37.0 37.0 37.0 30-34 36.47710000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.6693 37.0 37.0 37.0 37.0 37.0 40-44 36.5689 37.0 37.0 37.0 37.0 37.0 45-49 36.3658 37.0 37.0 37.0 37.0 37.0 50-54 36.4932 37.0 37.0 37.0 37.0 37.0 55-59 36.4904 37.0 37.0 37.0 37.0 37.0 60-64 36.513 37.0 37.0 37.0 37.0 37.0 65-69 36.267 37.0 37.0 37.0 37.0 37.0 70-74 36.3712 37.0 37.0 37.0 37.0 37.0 75-79 36.4602 37.0 37.0 37.0 37.0 37.0 80-84 36.4159 37.0 37.0 37.0 37.0 37.0 85-89 36.213800000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.373999999999995 37.0 37.0 37.0 29.8 37.0 95-99 36.100199999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.1508 37.0 37.0 37.0 37.0 37.0 105-109 36.1437 37.0 37.0 37.0 37.0 37.0 110-114 36.2096 37.0 37.0 37.0 37.0 37.0 115-119 36.4655 37.0 37.0 37.0 37.0 37.0 120-124 36.570299999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.5233 37.0 37.0 37.0 37.0 37.0 130-134 36.49980000000001 37.0 37.0 37.0 37.0 37.0 135-139 36.404900000000005 37.0 37.0 37.0 37.0 37.0 140-144 36.1959 37.0 37.0 37.0 37.0 37.0 145-149 36.2041 37.0 37.0 37.0 37.0 37.0 150-151 33.655 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 1.0 25 0.0 26 4.0 27 0.0 28 3.0 29 5.0 30 3.0 31 15.0 32 27.0 33 56.0 34 134.0 35 391.0 36 3199.0 37 161.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.875 9.775 4.6 34.75 2 21.833291362377235 9.84638630067993 37.2953915890204 31.024930747922436 3 19.8 14.549999999999999 26.025 39.625 4 27.0 20.525 22.400000000000002 30.075000000000003 5 27.950000000000003 26.575 24.025 21.45 6 23.325000000000003 30.275000000000002 22.675 23.724999999999998 7 19.575 24.3 38.975 17.150000000000002 8 19.325 22.650000000000002 32.625 25.4 9 19.025 20.575 34.625 25.775 10-14 22.845 26.889999999999997 25.755 24.51 15-19 22.759999999999998 25.245 26.255 25.740000000000002 20-24 22.425 25.679999999999996 26.185000000000002 25.71 25-29 23.215 25.405 25.535000000000004 25.845000000000002 30-34 22.57 25.45 26.625 25.355 35-39 22.935 25.445 26.575 25.045 40-44 23.03 25.374999999999996 25.86 25.735000000000003 45-49 23.335 24.990000000000002 25.935000000000002 25.740000000000002 50-54 22.82 25.245 26.015 25.919999999999998 55-59 23.23 25.480000000000004 25.540000000000003 25.75 60-64 23.16 25.665 25.695 25.480000000000004 65-69 22.57 25.595000000000002 26.39 25.445 70-74 23.79 25.81 25.34 25.06 75-79 23.44 25.945 25.224999999999998 25.39 80-84 23.125 25.645 25.94 25.290000000000003 85-89 23.71 25.385 25.735000000000003 25.169999999999998 90-94 23.605 25.205 25.395 25.795 95-99 23.549999999999997 24.505 25.83 26.115 100-104 23.919999999999998 24.39 25.650000000000002 26.040000000000003 105-109 23.244999999999997 25.215 25.985000000000003 25.555 110-114 23.665 25.415 25.275 25.645 115-119 23.45 26.08 25.259999999999998 25.21 120-124 24.07 24.955 25.230000000000004 25.745 125-129 23.44 25.915 25.405 25.240000000000002 130-134 23.935000000000002 25.965 24.9 25.2 135-139 24.104999999999997 25.185000000000002 24.555 26.155 140-144 23.39 25.705 25.119999999999997 25.785000000000004 145-149 24.15 25.424999999999997 25.14 25.285000000000004 150-151 23.3125 25.3 25.4625 25.924999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.5 26 2.5 27 2.0 28 3.0 29 6.0 30 6.5 31 8.5 32 15.0 33 31.0 34 39.0 35 41.5 36 54.5 37 69.0 38 87.0 39 104.0 40 117.0 41 130.0 42 152.5 43 179.0 44 194.5 45 208.0 46 223.0 47 203.5 48 188.0 49 177.0 50 157.0 51 154.5 52 138.0 53 125.0 54 111.0 55 93.0 56 100.0 57 91.0 58 72.0 59 77.0 60 73.0 61 64.0 62 61.5 63 59.5 64 57.5 65 50.0 66 48.0 67 43.0 68 33.5 69 32.0 70 29.0 71 25.0 72 16.5 73 10.5 74 13.0 75 10.0 76 4.0 77 1.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.7250000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.725 #Duplication Level Percentage of deduplicated Percentage of total 1 88.98281205973514 78.95 2 9.608340377571146 17.05 3 1.2116089039165963 3.225 4 0.11270780501549732 0.4 5 0.08453085376162299 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCACCAAACAGAAGAACGGGTAACACTTTCAGAGTCATGGATGGATCGCC 5 0.125 No Hit GGCTTGATAGAAGATATTTCTTTTCCATACATGTTACCATTTTGCAAAAG 5 0.125 No Hit CTTGGAAATCAGAAAAACCGCCCCTGTCAAGTGACCATGTTCGCCAAGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.15000000000000002 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.1625 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.4125 0.0 0.0 0.0 0.0 104-105 1.625 0.0 0.0 0.0 0.0 106-107 1.775 0.0 0.0 0.0 0.0 108-109 2.0125 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.5999999999999996 0.0 0.0 0.0 0.0 114-115 2.8125 0.0 0.0 0.0 0.0 116-117 3.075 0.0 0.0 0.0 0.0 118-119 3.3375 0.0 0.0 0.0 0.0 120-121 3.625 0.0 0.0 0.0 0.0 122-123 3.825 0.0 0.0 0.0 0.0 124-125 4.15 0.0 0.0 0.0 0.0 126-127 4.6875 0.0 0.0 0.0 0.0 128-129 5.1125 0.0 0.0 0.0 0.0 130-131 5.75 0.0 0.0 0.0 0.0 132-133 6.425000000000001 0.0 0.0 0.0 0.0 134-135 6.925000000000001 0.0 0.0 0.0 0.0 136-137 7.362500000000001 0.0 0.0 0.0 0.0 138-139 7.800000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18694421 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694421_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6575 37.0 25.0 37.0 25.0 37.0 2 33.3245 37.0 37.0 37.0 25.0 37.0 3 33.533 37.0 37.0 37.0 25.0 37.0 4 33.798 37.0 37.0 37.0 25.0 37.0 5 34.0875 37.0 37.0 37.0 25.0 37.0 6 33.9405 37.0 37.0 37.0 25.0 37.0 7 34.044 37.0 37.0 37.0 25.0 37.0 8 34.3865 37.0 37.0 37.0 25.0 37.0 9 34.653 37.0 37.0 37.0 25.0 37.0 10-14 34.6334 37.0 37.0 37.0 25.0 37.0 15-19 34.6857 37.0 37.0 37.0 25.0 37.0 20-24 34.416199999999996 37.0 37.0 37.0 25.0 37.0 25-29 34.662400000000005 37.0 37.0 37.0 27.4 37.0 30-34 34.955200000000005 37.0 37.0 37.0 29.8 37.0 35-39 34.719500000000004 37.0 37.0 37.0 27.4 37.0 40-44 34.3714 37.0 37.0 37.0 25.0 37.0 45-49 34.600300000000004 37.0 37.0 37.0 25.0 37.0 50-54 34.1938 37.0 34.6 37.0 22.2 37.0 55-59 33.6015 37.0 37.0 37.0 22.2 37.0 60-64 34.319 37.0 37.0 37.0 25.0 37.0 65-69 33.5253 37.0 34.6 37.0 22.2 37.0 70-74 32.2507 37.0 29.8 37.0 19.4 37.0 75-79 32.837300000000006 37.0 32.2 37.0 19.4 37.0 80-84 33.7926 37.0 37.0 37.0 25.0 37.0 85-89 32.099399999999996 37.0 32.2 37.0 19.4 37.0 90-94 33.4658 37.0 37.0 37.0 25.0 37.0 95-99 33.4657 37.0 37.0 37.0 25.0 37.0 100-104 33.0855 37.0 34.6 37.0 25.0 37.0 105-109 33.7036 37.0 37.0 37.0 25.0 37.0 110-114 33.9642 37.0 37.0 37.0 25.0 37.0 115-119 33.9538 37.0 37.0 37.0 25.0 37.0 120-124 33.578799999999994 37.0 37.0 37.0 25.0 37.0 125-129 33.5149 37.0 37.0 37.0 25.0 37.0 130-134 33.153000000000006 37.0 34.6 37.0 22.2 37.0 135-139 31.635399999999997 37.0 25.0 37.0 13.8 37.0 140-144 31.212699999999995 37.0 25.0 37.0 11.0 37.0 145-149 30.7543 37.0 25.0 37.0 11.0 37.0 150-151 30.308 37.0 25.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 5.0 17 5.0 18 6.0 19 7.0 20 5.0 21 5.0 22 8.0 23 10.0 24 19.0 25 26.0 26 11.0 27 43.0 28 65.0 29 94.0 30 142.0 31 204.0 32 379.0 33 755.0 34 1132.0 35 973.0 36 106.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.324999999999996 21.25 6.950000000000001 26.474999999999998 2 30.5 23.825 27.250000000000004 18.425 3 23.0 25.15 29.849999999999998 22.0 4 28.575 29.675 19.55 22.2 5 29.075 31.075000000000003 19.650000000000002 20.200000000000003 6 23.799999999999997 37.525 18.3 20.375 7 24.325 19.75 32.9 23.025000000000002 8 25.25 22.2 24.9 27.650000000000002 9 24.975 20.875 27.05 27.1 10-14 26.655 26.119999999999997 23.56 23.665 15-19 26.064999999999998 25.055 24.349999999999998 24.529999999999998 20-24 26.26 24.884999999999998 24.62 24.235 25-29 27.169999999999998 24.755 24.205 23.87 30-34 25.86 25.790000000000003 24.305 24.044999999999998 35-39 26.61 25.324999999999996 24.21 23.855 40-44 26.584999999999997 24.585 24.075 24.755 45-49 26.179999999999996 25.290000000000003 24.935 23.595 50-54 24.88 25.75 25.64 23.73 55-59 25.729999999999997 26.369999999999997 23.945 23.955000000000002 60-64 26.91 24.895 24.505 23.69 65-69 27.305 25.019999999999996 24.055 23.62 70-74 27.425 23.849999999999998 24.44 24.285 75-79 27.855 23.11 25.014999999999997 24.02 80-84 26.179999999999996 26.245 24.04 23.535 85-89 23.74 28.12 24.57 23.57 90-94 26.93 25.235000000000003 24.46 23.375 95-99 26.35 26.345000000000002 24.515 22.79 100-104 26.265 25.91 24.47 23.355 105-109 26.505000000000003 25.95 24.39 23.155 110-114 26.905 26.07 24.224999999999998 22.8 115-119 27.084999999999997 26.13 23.695 23.09 120-124 26.179999999999996 25.585 25.509999999999998 22.725 125-129 26.265 25.729999999999997 25.195 22.81 130-134 27.015 25.900000000000002 25.040000000000003 22.045 135-139 26.655 26.21 24.6 22.535 140-144 27.41 25.740000000000002 24.68 22.17 145-149 27.57 25.474999999999998 24.5 22.455 150-151 25.8 25.387500000000003 27.55 21.2625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.5 26 3.0 27 2.5 28 1.5 29 3.5 30 8.5 31 12.0 32 15.0 33 19.5 34 26.5 35 34.5 36 47.5 37 57.5 38 69.5 39 85.0 40 107.5 41 132.0 42 150.5 43 171.5 44 193.0 45 195.0 46 184.5 47 184.5 48 189.5 49 170.5 50 136.0 51 139.0 52 136.5 53 119.5 54 110.0 55 86.0 56 90.0 57 109.5 58 113.0 59 99.5 60 92.0 61 91.0 62 65.0 63 62.5 64 67.5 65 58.0 66 51.5 67 48.0 68 46.0 69 41.0 70 36.0 71 27.0 72 21.5 73 19.5 74 13.0 75 9.5 76 5.5 77 5.5 78 7.0 79 4.5 80 2.5 81 1.0 82 1.0 83 1.5 84 1.0 85 1.0 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 1.0 93 2.0 94 1.0 95 0.5 96 0.5 97 0.5 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.325 #Duplication Level Percentage of deduplicated Percentage of total 1 91.19845004151674 82.375 2 7.63908109604207 13.8 3 0.941046221976197 2.55 4 0.08303349017437033 0.3 5 0.05535566011624688 0.25 6 0.0 0.0 7 0.0 0.0 8 0.02767783005812344 0.2 9 0.0 0.0 >10 0.05535566011624688 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit CACACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAG 10 0.25 No Hit CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 8 0.2 No Hit AAAACATGAACACATTCTCAACTGAAACACGTAATGGATTTGAACACACA 5 0.125 No Hit GGAGCGTGCAAGGAGTTTCCAGTTGACCGAGGAGGATGTACTCCAGGTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.15000000000000002 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.1625 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 1.95 0.0 0.0 0.0 0.0 110-111 2.2875 0.0 0.0 0.0 0.0 112-113 2.5250000000000004 0.0 0.0 0.0 0.0 114-115 2.7125 0.0 0.0 0.0 0.0 116-117 2.975 0.0 0.0 0.0 0.0 118-119 3.1875 0.0 0.0 0.0 0.0 120-121 3.475 0.0 0.0 0.0 0.0 122-123 3.675 0.0 0.0 0.0 0.0 124-125 4.0 0.0 0.0 0.0 0.0 126-127 4.4875 0.0 0.0 0.0 0.0 128-129 4.8875 0.0 0.0 0.0 0.0 130-131 5.525 0.0 0.0 0.0 0.0 132-133 6.199999999999999 0.0 0.0 0.0 0.0 134-135 6.699999999999999 0.0 0.0 0.0 0.0 136-137 7.137499999999999 0.0 0.0 0.0 0.0 138-139 7.574999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTCCGA 10 0.006830828 145.0 1 AAAAAAA 30 0.0014437955 24.166668 110-114 >>END_MODULE Read 988056 spots for SRR18694421.sra Written 988056 spots for SRR18694421.sra Read 988056 spots for SRR18694421.sra Written 988056 spots for SRR18694421.sra Read 988056 spots for SRR18694421.sra Written 988056 spots for SRR18694421.sra Read 988056 spots for SRR18694421.sra Written 988056 spots for SRR18694421.sra Read 988056 spots for SRR18694421.sra Written 988056 spots for SRR18694421.sra Read 988056 spots for SRR18694421.sra Written 988056 spots for SRR18694421.sra Read 988056 spots for SRR18694421.sra Written 988056 spots for SRR18694421.sra Read 988056 spots for SRR18694421.sra Written 988056 spots for SRR18694421.sra Read 988056 spots for SRR18694421.sra Written 988056 spots for SRR18694421.sra Read 988070 spots for SRR18694421.sra Written 988070 spots for SRR18694421.sra Read 988056 spots for SRR18694421.sra Written 988056 spots for SRR18694421.sra Read 988056 spots for SRR18694421.sra Written 988056 spots for SRR18694421.sra Read 988056 spots for SRR18694421.sra Written 988056 spots for SRR18694421.sra Read 988056 spots for SRR18694421.sra Written 988056 spots for SRR18694421.sra Read 988056 spots for SRR18694421.sra Written 988056 spots for SRR18694421.sra Read 988056 spots for SRR18694421.sra Written 988056 spots for SRR18694421.sra Read 988056 spots for SRR18694421.sra Written 988056 spots for SRR18694421.sra Read 988056 spots for SRR18694421.sra Written 988056 spots for SRR18694421.sra Read 988056 spots for SRR18694421.sra Written 988056 spots for SRR18694421.sra Read 988056 spots for SRR18694421.sra Written 988056 spots for SRR18694421.sra SRR ids: ['SRR18694421.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_85739kf5 SRR18694421.sra spots: 19761134 blocks: [[1, 988056], [988057, 1976112], [1976113, 2964168], [2964169, 3952224], [3952225, 4940280], [4940281, 5928336], [5928337, 6916392], [6916393, 7904448], [7904449, 8892504], [8892505, 9880560], [9880561, 10868616], [10868617, 11856672], [11856673, 12844728], [12844729, 13832784], [13832785, 14820840], [14820841, 15808896], [15808897, 16796952], [16796953, 17785008], [17785009, 18773064], [18773065, 19761134]] SRR18694421 file size 6693997 SRR18694421 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694421 SRR18694421_1.fastq SRR18694421_2.fastq Input file: SRR18694421_1.fastq Paired file: SRR18694421_2.fastq trimmed: SRR18694421-trimmed-pair1.fastq, SRR18694421-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:28:18 2024 >> started Thu Dec 12 03:28:44 2024 >> done (26.425s) 19761134 read pairs processed; of these: 165 ( 0.00%) short read pairs filtered out after trimming by size control 14868 ( 0.08%) empty read pairs filtered out after trimming by size control 19746101 (99.92%) read pairs available; of these: 2204177 (11.16%) trimmed read pairs available after processing 17541924 (88.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 19 0.00% 20 8 0.00% 21 25 0.00% 22 19 0.00% 23 32 0.00% 24 15 0.00% 25 37 0.00% 26 33 0.00% 27 29 0.00% 28 26 0.00% 29 24 0.00% 30 38 0.00% 31 46 0.00% 32 44 0.00% 33 43 0.00% 34 44 0.00% 35 38 0.00% 36 49 0.00% 37 62 0.00% 38 63 0.00% 39 52 0.00% 40 64 0.00% 41 62 0.00% 42 68 0.00% 43 60 0.00% 44 68 0.00% 45 84 0.00% 46 104 0.00% 47 93 0.00% 48 105 0.00% 49 106 0.00% 50 151 0.00% 51 163 0.00% 52 157 0.00% 53 218 0.00% 54 197 0.00% 55 205 0.00% 56 238 0.00% 57 292 0.00% 58 329 0.00% 59 389 0.00% 60 451 0.00% 61 563 0.00% 62 687 0.00% 63 630 0.00% 64 715 0.00% 65 773 0.00% 66 877 0.00% 67 903 0.00% 68 1086 0.01% 69 1275 0.01% 70 1377 0.01% 71 1623 0.01% 72 1869 0.01% 73 2065 0.01% 74 2209 0.01% 75 2570 0.01% 76 2801 0.01% 77 3086 0.02% 78 3545 0.02% 79 3782 0.02% 80 4080 0.02% 81 4615 0.02% 82 5053 0.03% 83 5550 0.03% 84 6086 0.03% 85 6389 0.03% 86 6841 0.03% 87 7258 0.04% 88 8167 0.04% 89 8129 0.04% 90 8764 0.04% 91 9389 0.05% 92 10058 0.05% 93 10966 0.06% 94 11384 0.06% 95 11913 0.06% 96 12554 0.06% 97 13224 0.07% 98 14102 0.07% 99 14557 0.07% 100 15272 0.08% 101 15990 0.08% 102 16637 0.08% 103 17369 0.09% 104 18136 0.09% 105 18916 0.10% 106 19990 0.10% 107 20717 0.10% 108 21101 0.11% 109 22205 0.11% 110 22635 0.11% 111 23425 0.12% 112 24805 0.13% 113 25788 0.13% 114 27211 0.14% 115 27877 0.14% 116 28855 0.15% 117 30062 0.15% 118 30438 0.15% 119 31988 0.16% 120 32911 0.17% 121 33264 0.17% 122 34824 0.18% 123 36112 0.18% 124 37276 0.19% 125 38073 0.19% 126 38947 0.20% 127 40552 0.21% 128 41528 0.21% 129 43397 0.22% 130 44159 0.22% 131 44872 0.23% 132 46412 0.24% 133 47501 0.24% 134 47605 0.24% 135 48780 0.25% 136 50192 0.25% 137 50658 0.26% 138 51840 0.26% 139 53515 0.27% 140 54808 0.28% 141 55114 0.28% 142 57197 0.29% 143 57711 0.29% 144 59332 0.30% 145 60596 0.31% 146 61298 0.31% 147 63644 0.32% 148 64778 0.33% 149 65257 0.33% 150 66734 0.34% 151 17541924 88.84% 19746101 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=32 prefix-density=0.94 prefix-fanout=2.4 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=34 fanout-score=93.41 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=14.5 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=36 prefix-density=0.52 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=156.36 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=10.5 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGC SRR18694421 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:29:52 Started mapping on | Dec 12 03:29:52 Finished on | Dec 12 03:31:46 Mapping speed, Million of reads per hour | 623.56 Number of input reads | 19746101 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 16813890 Uniquely mapped reads % | 85.15% Average mapped length | 288.56 Number of splices: Total | 18482668 Number of splices: Annotated (sjdb) | 17345399 Number of splices: GT/AG | 18229917 Number of splices: GC/AG | 214269 Number of splices: AT/AC | 8243 Number of splices: Non-canonical | 30239 Mismatch rate per base, % | 0.57% Deletion rate per base | 0.01% Deletion average length | 2.41 Insertion rate per base | 0.01% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 248773 % of reads mapped to multiple loci | 1.26% Number of reads mapped to too many loci | 34807 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.19% % of reads unmapped: other | 1.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2683438 2683438 2683438 N_multimapping 248773 248773 248773 N_noFeature 783049 16358823 904329 N_ambiguous 422443 2599 89792 UnstrandedReadsAssigned:15608398 PositiveStrandReadsAssigned:452468 NegativeStrandReadsAssigned:15819769 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694421 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694421-trimmed-pair1.fastq SRR18694421-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,746,101 reads, 17,760,145 reads pseudoaligned [quant] estimated average fragment length: 243.705 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52973 SRR18694421.ke.tsv 35125 SRR18694421.se.tsv 88098 total ==> SRR18694421.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 693.785 0 0 PNS24247 1044 801.295 57.7114 5.88441 PNS24249 1928 1685.29 69.3045 3.35984 PNS24246 1044 801.295 57.7114 5.88441 PNS24248 1044 801.295 57.7114 5.88441 PNS24244 1471 1228.29 141.561 9.41619 PNS24243 293 101.177 0 0 KQK14069 1603 1360.29 3915.34 235.164 KQK14071 474 246.052 52.7056 17.501 ==> SRR18694421.se.tsv <== BRADI_1g14170v3 3467 BRADI_1g53295v3 99 BRADI_1g59795v3 703 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 485 BRADI_1g74790v3 160 BRADI_1g09890v3 0 BRADI_1g77505v3 242 BRADI_1g48960v3 0 SRR18694421 completed mapping pipeline successfully