Starting /dee2/code/volunteer_pipeline.sh SRR18694422 current disk space = 1526045790208 free memory = 1602364192 SRR18694422 SRAfilesize f21bce33d2c18645bda72ba60e907dda SRR18694422.sra SRR18694422.sra file validated SRR18694422 is paired end SRR18694422 is conventional basespace SRR18694422 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694422_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.982 37.0 37.0 37.0 37.0 37.0 2 35.95075 37.0 37.0 37.0 37.0 37.0 3 36.335 37.0 37.0 37.0 37.0 37.0 4 36.416 37.0 37.0 37.0 37.0 37.0 5 36.497 37.0 37.0 37.0 37.0 37.0 6 36.5155 37.0 37.0 37.0 37.0 37.0 7 36.5315 37.0 37.0 37.0 37.0 37.0 8 36.5155 37.0 37.0 37.0 37.0 37.0 9 36.5805 37.0 37.0 37.0 37.0 37.0 10-14 36.5715 37.0 37.0 37.0 37.0 37.0 15-19 36.591499999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.5869 37.0 37.0 37.0 37.0 37.0 25-29 36.5168 37.0 37.0 37.0 37.0 37.0 30-34 36.4824 37.0 37.0 37.0 37.0 37.0 35-39 36.68769999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.5933 37.0 37.0 37.0 37.0 37.0 45-49 36.384 37.0 37.0 37.0 37.0 37.0 50-54 36.5037 37.0 37.0 37.0 37.0 37.0 55-59 36.4849 37.0 37.0 37.0 37.0 37.0 60-64 36.5005 37.0 37.0 37.0 37.0 37.0 65-69 36.3 37.0 37.0 37.0 37.0 37.0 70-74 36.372 37.0 37.0 37.0 37.0 37.0 75-79 36.4617 37.0 37.0 37.0 37.0 37.0 80-84 36.410799999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.1668 37.0 37.0 37.0 37.0 37.0 90-94 35.4058 37.0 37.0 37.0 29.8 37.0 95-99 36.131800000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.1395 37.0 37.0 37.0 37.0 37.0 105-109 36.1379 37.0 37.0 37.0 37.0 37.0 110-114 36.2002 37.0 37.0 37.0 37.0 37.0 115-119 36.477199999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.4984 37.0 37.0 37.0 37.0 37.0 125-129 36.514300000000006 37.0 37.0 37.0 37.0 37.0 130-134 36.4875 37.0 37.0 37.0 37.0 37.0 135-139 36.3835 37.0 37.0 37.0 37.0 37.0 140-144 36.1527 37.0 37.0 37.0 37.0 37.0 145-149 36.1948 37.0 37.0 37.0 37.0 37.0 150-151 33.793 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 2.0 25 2.0 26 2.0 27 1.0 28 4.0 29 4.0 30 12.0 31 15.0 32 29.0 33 55.0 34 146.0 35 318.0 36 3233.0 37 176.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.15 10.5 6.550000000000001 34.8 2 23.186951066499372 9.962358845671266 32.54705144291092 34.30363864491844 3 19.6 15.625 23.325000000000003 41.449999999999996 4 25.174999999999997 20.075000000000003 24.075 30.675 5 27.625 25.424999999999997 23.849999999999998 23.1 6 22.3 31.075000000000003 22.825 23.799999999999997 7 17.599999999999998 25.424999999999997 38.5 18.475 8 19.925 24.775 28.799999999999997 26.5 9 18.025 23.625 32.875 25.474999999999998 10-14 23.015 26.765 25.645 24.575 15-19 22.994999999999997 25.655 25.169999999999998 26.179999999999996 20-24 23.405 25.95 25.445 25.2 25-29 22.845 26.200000000000003 25.535000000000004 25.419999999999998 30-34 23.11 25.074999999999996 25.419999999999998 26.395000000000003 35-39 23.35 25.06 25.455 26.135 40-44 23.055 24.95 25.95 26.045 45-49 23.200000000000003 25.8 25.069999999999997 25.929999999999996 50-54 23.06 25.56 25.36 26.02 55-59 23.02 25.874999999999996 25.46 25.645 60-64 23.29 25.069999999999997 25.2 26.44 65-69 23.28 25.330000000000002 25.95 25.44 70-74 23.43 25.22 25.405 25.945 75-79 23.56 25.605 25.014999999999997 25.82 80-84 22.88 25.495 25.4 26.224999999999998 85-89 23.674999999999997 24.915000000000003 25.495 25.915 90-94 24.48 24.959999999999997 25.019999999999996 25.540000000000003 95-99 23.665 25.014999999999997 25.224999999999998 26.095000000000002 100-104 23.87 25.505 24.555 26.07 105-109 23.695 25.545 25.055 25.705 110-114 24.315 24.46 25.245 25.979999999999997 115-119 23.87 24.535 25.564999999999998 26.029999999999998 120-124 24.41 25.03 24.465 26.095000000000002 125-129 24.099999999999998 25.95 24.245 25.705 130-134 23.43 25.585 24.735 26.25 135-139 24.125 25.119999999999997 24.51 26.245 140-144 24.335 25.080000000000002 24.645 25.94 145-149 24.455 25.480000000000004 24.154999999999998 25.91 150-151 23.7875 25.7375 23.6125 26.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 0.5 28 2.5 29 2.5 30 5.5 31 11.5 32 16.0 33 17.0 34 17.0 35 29.5 36 50.5 37 66.0 38 78.5 39 88.5 40 112.5 41 141.5 42 169.0 43 190.0 44 196.5 45 199.0 46 199.5 47 197.0 48 188.0 49 171.0 50 159.0 51 153.0 52 144.0 53 138.5 54 126.0 55 115.0 56 102.0 57 89.0 58 76.5 59 67.0 60 72.0 61 69.5 62 67.0 63 62.5 64 52.5 65 52.0 66 51.5 67 52.0 68 45.5 69 39.0 70 33.0 71 24.0 72 19.0 73 12.0 74 6.0 75 4.5 76 5.5 77 3.0 78 1.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.95 #Duplication Level Percentage of deduplicated Percentage of total 1 87.57906843013225 76.14999999999999 2 10.322024151811386 17.95 3 1.696377228292122 4.425 4 0.3162737205290397 1.0999999999999999 5 0.08625646923519263 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCTGTTCACCAAGCTTGGCAAAGTTTGCAGAAAGAATGGAAGGGGACAC 5 0.125 No Hit GCTGCTCATGGTAAGCCTTCTCCGCAGAGATAACAGGGGCATATGATGAA 5 0.125 No Hit GTTGGGTTTGAGGAGGTGTGAACAATGGAACTGTATTCTCCTCGCGAGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.325 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.1375 0.0 0.0 0.0 0.0 112-113 2.5125 0.0 0.0 0.0 0.0 114-115 2.7625 0.0 0.0 0.0 0.0 116-117 3.2875 0.0 0.0 0.0 0.0 118-119 3.6125 0.0 0.0 0.0 0.0 120-121 3.8875 0.0 0.0 0.0 0.0 122-123 4.1 0.0 0.0 0.0 0.0 124-125 4.55 0.0 0.0 0.0 0.0 126-127 4.800000000000001 0.0 0.0 0.0 0.0 128-129 5.0125 0.0 0.0 0.0 0.0 130-131 5.425 0.0 0.0 0.0 0.0 132-133 5.9125 0.0 0.0 0.0 0.0 134-135 6.2625 0.0 0.0 0.0 0.0 136-137 6.6625 0.0 0.0 0.0 0.0 138-139 7.012499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18694422 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694422_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.039 37.0 37.0 37.0 25.0 37.0 2 35.02 37.0 37.0 37.0 25.0 37.0 3 35.1845 37.0 37.0 37.0 25.0 37.0 4 35.157 37.0 37.0 37.0 25.0 37.0 5 35.0725 37.0 37.0 37.0 25.0 37.0 6 35.161 37.0 37.0 37.0 25.0 37.0 7 35.221 37.0 37.0 37.0 25.0 37.0 8 35.3605 37.0 37.0 37.0 37.0 37.0 9 35.477 37.0 37.0 37.0 37.0 37.0 10-14 35.4527 37.0 37.0 37.0 34.6 37.0 15-19 35.544799999999995 37.0 37.0 37.0 37.0 37.0 20-24 35.292899999999996 37.0 37.0 37.0 32.2 37.0 25-29 35.466899999999995 37.0 37.0 37.0 32.2 37.0 30-34 35.6569 37.0 37.0 37.0 37.0 37.0 35-39 35.4772 37.0 37.0 37.0 34.6 37.0 40-44 35.2669 37.0 37.0 37.0 29.8 37.0 45-49 35.410399999999996 37.0 37.0 37.0 32.2 37.0 50-54 34.85959999999999 37.0 37.0 37.0 27.0 37.0 55-59 34.3403 37.0 37.0 37.0 25.0 37.0 60-64 34.9591 37.0 37.0 37.0 27.4 37.0 65-69 34.1799 37.0 34.6 37.0 27.4 37.0 70-74 32.8698 37.0 29.8 37.0 22.2 37.0 75-79 33.4993 37.0 34.6 37.0 22.2 37.0 80-84 34.4379 37.0 37.0 37.0 25.0 37.0 85-89 32.57889999999999 37.0 32.2 37.0 19.4 37.0 90-94 33.9876 37.0 37.0 37.0 25.0 37.0 95-99 33.8587 37.0 37.0 37.0 25.0 37.0 100-104 33.446299999999994 37.0 37.0 37.0 25.0 37.0 105-109 34.2289 37.0 37.0 37.0 25.0 37.0 110-114 34.4543 37.0 37.0 37.0 25.0 37.0 115-119 34.3011 37.0 37.0 37.0 25.0 37.0 120-124 33.9952 37.0 37.0 37.0 25.0 37.0 125-129 33.9144 37.0 37.0 37.0 25.0 37.0 130-134 33.6743 37.0 34.6 37.0 25.0 37.0 135-139 32.0183 37.0 27.4 37.0 13.8 37.0 140-144 31.591500000000003 37.0 25.0 37.0 11.0 37.0 145-149 31.076900000000002 37.0 25.0 37.0 11.0 37.0 150-151 30.7405 37.0 25.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 3.0 16 3.0 17 2.0 18 2.0 19 6.0 20 5.0 21 3.0 22 5.0 23 7.0 24 4.0 25 7.0 26 16.0 27 16.0 28 29.0 29 46.0 30 101.0 31 164.0 32 280.0 33 512.0 34 1189.0 35 1368.0 36 232.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.6 20.1 8.275 27.025 2 30.175 21.3 26.724999999999998 21.8 3 23.425 24.275 28.775000000000002 23.525 4 26.55 30.225 20.674999999999997 22.55 5 28.675 32.475 18.075 20.775 6 24.325 32.875 20.974999999999998 21.825 7 24.275 19.075 33.75 22.900000000000002 8 23.425 23.0 24.175 29.4 9 23.7 22.25 27.325 26.724999999999998 10-14 26.515 26.06 22.485 24.94 15-19 26.740000000000002 24.705 23.825 24.73 20-24 25.915 25.275 23.41 25.4 25-29 26.25 25.305 23.474999999999998 24.97 30-34 26.85 25.005 23.36 24.785 35-39 26.35 25.564999999999998 23.355 24.73 40-44 26.985 24.795 24.05 24.169999999999998 45-49 26.384999999999998 24.52 24.19 24.905 50-54 25.259999999999998 24.82 25.3 24.62 55-59 25.580000000000002 25.385 24.315 24.72 60-64 25.775 24.68 24.79 24.755 65-69 26.974999999999998 24.195 23.815 25.014999999999997 70-74 26.615 24.490000000000002 24.485 24.41 75-79 27.505000000000003 23.665 24.75 24.08 80-84 25.885 25.295 24.29 24.529999999999998 85-89 24.15 27.975 23.549999999999997 24.325 90-94 26.334999999999997 25.374999999999996 24.08 24.21 95-99 26.095000000000002 25.705 23.885 24.315 100-104 26.784999999999997 25.355 23.74 24.12 105-109 26.215 25.835 24.355 23.595 110-114 26.665 25.474999999999998 24.055 23.805 115-119 27.134999999999998 25.82 23.72 23.325000000000003 120-124 27.365000000000002 25.44 24.3 22.895 125-129 27.29 24.75 24.505 23.455000000000002 130-134 26.86 25.6 25.275 22.264999999999997 135-139 27.24 25.825 24.415 22.52 140-144 27.544999999999998 26.025 24.16 22.27 145-149 27.775 25.130000000000003 24.54 22.555 150-151 25.6 25.337500000000002 26.875 22.1875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.5 27 2.0 28 3.0 29 5.0 30 7.5 31 8.5 32 13.5 33 17.5 34 25.0 35 31.5 36 33.5 37 46.5 38 64.5 39 87.0 40 109.0 41 129.0 42 130.0 43 144.5 44 163.5 45 183.0 46 195.5 47 184.0 48 174.5 49 158.0 50 166.5 51 158.5 52 128.5 53 121.0 54 116.0 55 111.5 56 112.5 57 97.0 58 79.0 59 81.0 60 87.0 61 90.5 62 88.0 63 84.0 64 76.5 65 69.5 66 63.0 67 60.0 68 64.5 69 55.0 70 35.5 71 25.0 72 21.5 73 20.0 74 16.5 75 13.0 76 9.0 77 3.5 78 2.5 79 3.5 80 2.0 81 0.5 82 1.0 83 0.5 84 0.5 85 1.5 86 1.0 87 0.5 88 0.5 89 1.0 90 1.5 91 0.5 92 0.0 93 0.0 94 1.0 95 1.5 96 0.5 97 0.0 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.175 #Duplication Level Percentage of deduplicated Percentage of total 1 89.05585483413667 78.525 2 8.959455628012474 15.8 3 1.6444570456478593 4.35 4 0.25517436915225405 0.8999999999999999 5 0.05670541536716756 0.25 6 0.0 0.0 7 0.02835270768358378 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GTCGTCGTCGCTCTGCTCCAGCCTCGGTTACCCGCGCGCCGCCTCCTTCG 5 0.125 No Hit CCTACACCAACTTGAACAGGCTGATATCACAGATCATATCTTCACTTACC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.2625 0.0 0.0 0.0 0.0 104-105 1.3624999999999998 0.0 0.0 0.0 0.0 106-107 1.5750000000000002 0.0 0.0 0.0 0.0 108-109 1.8625 0.0 0.0 0.0 0.0 110-111 2.0625 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.6875 0.0 0.0 0.0 0.0 116-117 3.2125 0.0 0.0 0.0 0.0 118-119 3.5375 0.0 0.0 0.0 0.0 120-121 3.8125 0.0 0.0 0.0 0.0 122-123 4.025 0.0 0.0 0.0 0.0 124-125 4.475 0.0 0.0 0.0 0.0 126-127 4.725 0.0 0.0 0.0 0.0 128-129 4.9375 0.0 0.0 0.0 0.0 130-131 5.35 0.0 0.0 0.0 0.0 132-133 5.825 0.0 0.0 0.0 0.0 134-135 6.1625 0.0 0.0 0.0 0.0 136-137 6.5625 0.0 0.0 0.0 0.0 138-139 6.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATGCT 10 0.006830828 145.0 4 CCTGTTC 10 0.006830828 145.0 145 ATGATGC 10 0.006830828 145.0 3 AGATACA 10 0.006830828 145.0 145 CTCCTCC 20 0.00593511 29.0 70-74 >>END_MODULE Read 661420 spots for SRR18694422.sra Written 661420 spots for SRR18694422.sra Read 661420 spots for SRR18694422.sra Written 661420 spots for SRR18694422.sra Read 661420 spots for SRR18694422.sra Written 661420 spots for SRR18694422.sra Read 661420 spots for SRR18694422.sra Written 661420 spots for SRR18694422.sra Read 661420 spots for SRR18694422.sra Written 661420 spots for SRR18694422.sra Read 661420 spots for SRR18694422.sra Written 661420 spots for SRR18694422.sra Read 661420 spots for SRR18694422.sra Written 661420 spots for SRR18694422.sra Read 661420 spots for SRR18694422.sra Written 661420 spots for SRR18694422.sra Read 661420 spots for SRR18694422.sra Written 661420 spots for SRR18694422.sra Read 661420 spots for SRR18694422.sra Written 661420 spots for SRR18694422.sra Read 661422 spots for SRR18694422.sra Written 661422 spots for SRR18694422.sra Read 661420 spots for SRR18694422.sra Written 661420 spots for SRR18694422.sra Read 661420 spots for SRR18694422.sra Written 661420 spots for SRR18694422.sra Read 661420 spots for SRR18694422.sra Written 661420 spots for SRR18694422.sra Read 661420 spots for SRR18694422.sra Written 661420 spots for SRR18694422.sra Read 661420 spots for SRR18694422.sra Written 661420 spots for SRR18694422.sra Read 661420 spots for SRR18694422.sra Written 661420 spots for SRR18694422.sra Read 661420 spots for SRR18694422.sra Written 661420 spots for SRR18694422.sra Read 661420 spots for SRR18694422.sra Written 661420 spots for SRR18694422.sra Read 661420 spots for SRR18694422.sra Written 661420 spots for SRR18694422.sra SRR ids: ['SRR18694422.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u0refy32 SRR18694422.sra spots: 13228402 blocks: [[1, 661420], [661421, 1322840], [1322841, 1984260], [1984261, 2645680], [2645681, 3307100], [3307101, 3968520], [3968521, 4629940], [4629941, 5291360], [5291361, 5952780], [5952781, 6614200], [6614201, 7275620], [7275621, 7937040], [7937041, 8598460], [8598461, 9259880], [9259881, 9921300], [9921301, 10582720], [10582721, 11244140], [11244141, 11905560], [11905561, 12566980], [12566981, 13228402]] SRR18694422 file size 4473889 SRR18694422 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694422 SRR18694422_1.fastq SRR18694422_2.fastq Input file: SRR18694422_1.fastq Paired file: SRR18694422_2.fastq trimmed: SRR18694422-trimmed-pair1.fastq, SRR18694422-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:31:47 2024 >> started Tue Dec 10 06:32:02 2024 >> done (14.522s) 13228402 read pairs processed; of these: 119 ( 0.00%) short read pairs filtered out after trimming by size control 9580 ( 0.07%) empty read pairs filtered out after trimming by size control 13218703 (99.93%) read pairs available; of these: 1251186 ( 9.47%) trimmed read pairs available after processing 11967517 (90.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 5 0.00% 20 17 0.00% 21 23 0.00% 22 13 0.00% 23 25 0.00% 24 20 0.00% 25 21 0.00% 26 22 0.00% 27 35 0.00% 28 16 0.00% 29 26 0.00% 30 34 0.00% 31 28 0.00% 32 34 0.00% 33 30 0.00% 34 31 0.00% 35 36 0.00% 36 28 0.00% 37 35 0.00% 38 41 0.00% 39 43 0.00% 40 51 0.00% 41 42 0.00% 42 42 0.00% 43 40 0.00% 44 29 0.00% 45 57 0.00% 46 47 0.00% 47 64 0.00% 48 60 0.00% 49 72 0.00% 50 60 0.00% 51 87 0.00% 52 100 0.00% 53 99 0.00% 54 63 0.00% 55 103 0.00% 56 90 0.00% 57 114 0.00% 58 124 0.00% 59 144 0.00% 60 186 0.00% 61 196 0.00% 62 226 0.00% 63 232 0.00% 64 292 0.00% 65 268 0.00% 66 322 0.00% 67 363 0.00% 68 400 0.00% 69 485 0.00% 70 512 0.00% 71 598 0.00% 72 649 0.00% 73 721 0.01% 74 819 0.01% 75 931 0.01% 76 1029 0.01% 77 1127 0.01% 78 1286 0.01% 79 1487 0.01% 80 1503 0.01% 81 1704 0.01% 82 2055 0.02% 83 2205 0.02% 84 2323 0.02% 85 2622 0.02% 86 2793 0.02% 87 2907 0.02% 88 3275 0.02% 89 3521 0.03% 90 3653 0.03% 91 4087 0.03% 92 4462 0.03% 93 4895 0.04% 94 5462 0.04% 95 5586 0.04% 96 5885 0.04% 97 6285 0.05% 98 6544 0.05% 99 6924 0.05% 100 7428 0.06% 101 7825 0.06% 102 8296 0.06% 103 8988 0.07% 104 9466 0.07% 105 9600 0.07% 106 10256 0.08% 107 10692 0.08% 108 10727 0.08% 109 11668 0.09% 110 11918 0.09% 111 12615 0.10% 112 13240 0.10% 113 13778 0.10% 114 14524 0.11% 115 15367 0.12% 116 15845 0.12% 117 16515 0.12% 118 16771 0.13% 119 17340 0.13% 120 18266 0.14% 121 18657 0.14% 122 19942 0.15% 123 20148 0.15% 124 20992 0.16% 125 21864 0.17% 126 22679 0.17% 127 23002 0.17% 128 23816 0.18% 129 24730 0.19% 130 24861 0.19% 131 25623 0.19% 132 26957 0.20% 133 28397 0.21% 134 28769 0.22% 135 29646 0.22% 136 30650 0.23% 137 30782 0.23% 138 31560 0.24% 139 32695 0.25% 140 32862 0.25% 141 33641 0.25% 142 34728 0.26% 143 35955 0.27% 144 36435 0.28% 145 37512 0.28% 146 38563 0.29% 147 39782 0.30% 148 40484 0.31% 149 40357 0.31% 150 41093 0.31% 151 11967517 90.53% 13218703 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=18 prefix-density=0.48 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=66.14 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=8.7 sequence=GCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=7.49 fanout-score-rank=10 prefix-density=0.56 prefix-fanout=4.9 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.12 sequence-density-rank=16 fanout-score=152.05 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=20.9 sequence=CGCCGCCGCCGC SRR18694422 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:32:55 Started mapping on | Dec 10 06:32:55 Finished on | Dec 10 06:35:06 Mapping speed, Million of reads per hour | 363.26 Number of input reads | 13218703 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12124265 Uniquely mapped reads % | 91.72% Average mapped length | 296.39 Number of splices: Total | 12899098 Number of splices: Annotated (sjdb) | 12130224 Number of splices: GT/AG | 12727967 Number of splices: GC/AG | 144931 Number of splices: AT/AC | 7210 Number of splices: Non-canonical | 18990 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.53 Insertion rate per base | 0.01% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 232176 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 23684 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.60% % of reads unmapped: other | 1.74% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 862262 862262 862262 N_multimapping 232176 232176 232176 N_noFeature 478801 11779843 571045 N_ambiguous 297094 1960 45629 UnstrandedReadsAssigned:11348370 PositiveStrandReadsAssigned:342462 NegativeStrandReadsAssigned:11507591 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694422 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694422-trimmed-pair1.fastq SRR18694422-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,218,703 reads, 11,708,613 reads pseudoaligned [quant] estimated average fragment length: 260.606 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52973 SRR18694422.ke.tsv 35125 SRR18694422.se.tsv 88098 total ==> SRR18694422.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 676.979 0 0 PNS24247 1044 784.394 40.3458 6.14652 PNS24249 1928 1668.39 55.9033 4.00409 PNS24246 1044 784.394 40.3458 6.14652 PNS24248 1044 784.394 40.3458 6.14652 PNS24244 1471 1211.39 77.0594 7.60161 PNS24243 293 92.5253 0 0 KQK14069 1603 1343.39 2050.2 182.372 KQK14071 474 235.519 28.9784 14.7032 ==> SRR18694422.se.tsv <== BRADI_1g14170v3 2223 BRADI_1g53295v3 41 BRADI_1g59795v3 348 BRADI_1g07683v3 1 BRADI_1g00485v3 10 BRADI_1g20270v3 1498 BRADI_1g74790v3 73 BRADI_1g09890v3 18 BRADI_1g77505v3 194 BRADI_1g48960v3 2 SRR18694422 completed mapping pipeline successfully