Starting /dee2/code/volunteer_pipeline.sh SRR18694425 current disk space = 1526055305216 free memory = 1556170764 SRR18694425 SRAfilesize 740e6802def9103c8800d52e005ad888 SRR18694425.sra SRR18694425.sra file validated SRR18694425 is paired end SRR18694425 is conventional basespace SRR18694425 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694425_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0115 37.0 37.0 37.0 37.0 37.0 2 35.89 37.0 37.0 37.0 37.0 37.0 3 36.342 37.0 37.0 37.0 37.0 37.0 4 36.417 37.0 37.0 37.0 37.0 37.0 5 36.556 37.0 37.0 37.0 37.0 37.0 6 36.3945 37.0 37.0 37.0 37.0 37.0 7 36.581 37.0 37.0 37.0 37.0 37.0 8 36.659 37.0 37.0 37.0 37.0 37.0 9 36.6015 37.0 37.0 37.0 37.0 37.0 10-14 36.6181 37.0 37.0 37.0 37.0 37.0 15-19 36.5755 37.0 37.0 37.0 37.0 37.0 20-24 36.6356 37.0 37.0 37.0 37.0 37.0 25-29 36.548199999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.4961 37.0 37.0 37.0 37.0 37.0 35-39 36.6524 37.0 37.0 37.0 37.0 37.0 40-44 36.56 37.0 37.0 37.0 37.0 37.0 45-49 36.3429 37.0 37.0 37.0 37.0 37.0 50-54 36.4597 37.0 37.0 37.0 37.0 37.0 55-59 36.52139999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.5258 37.0 37.0 37.0 37.0 37.0 65-69 36.29 37.0 37.0 37.0 37.0 37.0 70-74 36.43470000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.4809 37.0 37.0 37.0 37.0 37.0 80-84 36.3911 37.0 37.0 37.0 37.0 37.0 85-89 36.16009999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.3605 37.0 37.0 37.0 29.8 37.0 95-99 36.124199999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.173 37.0 37.0 37.0 37.0 37.0 105-109 36.142100000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.208 37.0 37.0 37.0 37.0 37.0 115-119 36.461 37.0 37.0 37.0 37.0 37.0 120-124 36.60119999999999 37.0 37.0 37.0 37.0 37.0 125-129 36.518600000000006 37.0 37.0 37.0 37.0 37.0 130-134 36.448100000000004 37.0 37.0 37.0 37.0 37.0 135-139 36.3497 37.0 37.0 37.0 37.0 37.0 140-144 36.17569999999999 37.0 37.0 37.0 37.0 37.0 145-149 36.134699999999995 37.0 37.0 37.0 37.0 37.0 150-151 33.6695 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 0.0 25 4.0 26 5.0 27 2.0 28 5.0 29 6.0 30 6.0 31 10.0 32 28.0 33 45.0 34 113.0 35 384.0 36 3224.0 37 167.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.775000000000006 10.549999999999999 5.4 34.275 2 21.134538152610443 10.491967871485944 37.148594377510044 31.224899598393574 3 19.925 15.225 25.85 39.0 4 25.0 22.225 22.25 30.525000000000002 5 25.724999999999998 28.4 24.375 21.5 6 23.225 29.9 22.45 24.425 7 15.7 25.874999999999996 40.6 17.825 8 18.8 24.2 31.874999999999996 25.124999999999996 9 19.075 20.775 36.275 23.875 10-14 22.235 26.784999999999997 26.72 24.26 15-19 22.189999999999998 26.06 26.905 24.845 20-24 22.43 26.205000000000002 26.195 25.169999999999998 25-29 21.735 26.38 26.32 25.564999999999998 30-34 21.98 26.465 26.325 25.230000000000004 35-39 22.225 26.035000000000004 26.08 25.66 40-44 21.805 26.515 26.43 25.25 45-49 22.36 25.895000000000003 25.745 26.0 50-54 22.15 26.055 26.650000000000002 25.145 55-59 21.84 26.58 26.41 25.169999999999998 60-64 22.64 25.755 25.915 25.69 65-69 21.7 26.245 26.31 25.745 70-74 21.925 26.6 26.340000000000003 25.135 75-79 22.31 25.97 26.174999999999997 25.545 80-84 22.28 25.885 25.97 25.865 85-89 22.545 25.96 26.025 25.47 90-94 22.869999999999997 26.13 25.900000000000002 25.1 95-99 22.435 25.275 26.77 25.52 100-104 22.48 25.900000000000002 26.150000000000002 25.47 105-109 23.150000000000002 25.825 26.14 24.884999999999998 110-114 23.294999999999998 25.95 25.41 25.345000000000002 115-119 22.585 26.495 25.745 25.174999999999997 120-124 23.015 25.740000000000002 25.319999999999997 25.924999999999997 125-129 22.54 25.28 26.27 25.91 130-134 22.689999999999998 26.479999999999997 25.590000000000003 25.240000000000002 135-139 22.175 26.369999999999997 25.735000000000003 25.72 140-144 23.02 26.590000000000003 25.035 25.355 145-149 23.015 26.590000000000003 25.465 24.93 150-151 23.3875 26.737499999999997 24.349999999999998 25.525 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.5 28 4.0 29 9.0 30 10.0 31 13.5 32 20.5 33 29.0 34 36.0 35 36.0 36 49.5 37 62.5 38 69.0 39 86.0 40 120.0 41 171.5 42 191.0 43 204.0 44 223.0 45 219.5 46 221.0 47 230.0 48 212.0 49 183.5 50 173.5 51 163.0 52 141.5 53 125.5 54 123.0 55 115.5 56 113.5 57 88.0 58 58.0 59 62.0 60 67.5 61 60.5 62 46.0 63 38.5 64 36.5 65 39.5 66 37.5 67 24.5 68 18.0 69 19.0 70 13.5 71 7.5 72 6.5 73 3.5 74 2.5 75 3.5 76 2.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.2 #Duplication Level Percentage of deduplicated Percentage of total 1 87.90137614678899 76.64999999999999 2 10.378440366972477 18.099999999999998 3 1.3474770642201837 3.5249999999999995 4 0.31536697247706424 1.0999999999999999 5 0.028669724770642203 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.028669724770642203 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GACAGCAAGGTTTCGTTTTTGTAGATAAGCTTTATACATCTCCAACTGCA 20 0.5 No Hit GCACAGAATAAACACACCAAAGTAAAAATCAAGATAAATCGGTGGGCCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0125 0.0 0.0 16-17 0.0 0.0 0.025 0.0 0.0 18-19 0.0 0.0 0.025 0.0 0.0 20-21 0.0 0.0 0.025 0.0 0.0 22-23 0.0 0.0 0.025 0.0 0.0 24-25 0.0 0.0 0.025 0.0 0.0 26-27 0.0 0.0 0.025 0.0 0.0 28-29 0.0 0.0 0.025 0.0 0.0 30-31 0.0 0.0 0.025 0.0 0.0 32-33 0.0 0.0 0.025 0.0 0.0 34-35 0.0 0.0 0.025 0.0 0.0 36-37 0.0 0.0 0.025 0.0 0.0 38-39 0.0 0.0 0.025 0.0 0.0 40-41 0.025 0.0 0.025 0.0 0.0 42-43 0.025 0.0 0.025 0.0 0.0 44-45 0.025 0.0 0.025 0.0 0.0 46-47 0.025 0.0 0.025 0.0 0.0 48-49 0.025 0.0 0.025 0.0 0.0 50-51 0.025 0.0 0.025 0.0 0.0 52-53 0.025 0.0 0.025 0.0 0.0 54-55 0.025 0.0 0.025 0.0 0.0 56-57 0.025 0.0 0.025 0.0 0.0 58-59 0.025 0.0 0.025 0.0 0.0 60-61 0.025 0.0 0.025 0.0 0.0 62-63 0.025 0.0 0.025 0.0 0.0 64-65 0.025 0.0 0.025 0.0 0.0 66-67 0.025 0.0 0.025 0.0 0.0 68-69 0.025 0.0 0.025 0.0 0.0 70-71 0.025 0.0 0.025 0.0 0.0 72-73 0.025 0.0 0.025 0.0 0.0 74-75 0.025 0.0 0.025 0.0 0.0 76-77 0.037500000000000006 0.0 0.025 0.0 0.0 78-79 0.05 0.0 0.025 0.0 0.0 80-81 0.07500000000000001 0.0 0.025 0.0 0.0 82-83 0.125 0.0 0.025 0.0 0.0 84-85 0.15 0.0 0.025 0.0 0.0 86-87 0.15 0.0 0.025 0.0 0.0 88-89 0.21250000000000002 0.0 0.025 0.0 0.0 90-91 0.2625 0.0 0.025 0.0 0.0 92-93 0.275 0.0 0.025 0.0 0.0 94-95 0.30000000000000004 0.0 0.025 0.0 0.0 96-97 0.4 0.0 0.025 0.0 0.0 98-99 0.4375 0.0 0.025 0.0 0.0 100-101 0.45 0.0 0.025 0.0 0.0 102-103 0.55 0.0 0.025 0.0 0.0 104-105 0.7250000000000001 0.0 0.025 0.0 0.0 106-107 0.825 0.0 0.025 0.0 0.0 108-109 1.1 0.0 0.025 0.0 0.0 110-111 1.2999999999999998 0.0 0.025 0.0 0.0 112-113 1.5 0.0 0.025 0.0 0.0 114-115 1.825 0.0 0.025 0.0 0.0 116-117 2.0 0.0 0.025 0.0 0.0 118-119 2.2875 0.0 0.025 0.0 0.0 120-121 2.6625 0.0 0.025 0.0 0.0 122-123 2.9375 0.0 0.025 0.0 0.0 124-125 3.2875 0.0 0.025 0.0 0.0 126-127 3.4875 0.0 0.025 0.0 0.0 128-129 3.8375 0.0 0.025 0.0 0.0 130-131 4.35 0.0 0.025 0.0 0.0 132-133 4.8875 0.0 0.025 0.0 0.0 134-135 5.2875 0.0 0.025 0.0 0.0 136-137 5.7125 0.0 0.025 0.0 0.0 138-139 6.1 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGCCT 10 0.006830828 145.0 9 GACGAGT 10 0.006830828 145.0 4 ATCACAG 10 0.006830828 145.0 6 >>END_MODULE SRR18694425 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694425_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.673 37.0 37.0 37.0 25.0 37.0 2 34.3775 37.0 37.0 37.0 25.0 37.0 3 34.2475 37.0 37.0 37.0 25.0 37.0 4 34.512 37.0 37.0 37.0 25.0 37.0 5 34.3725 37.0 37.0 37.0 25.0 37.0 6 34.731 37.0 37.0 37.0 25.0 37.0 7 34.7055 37.0 37.0 37.0 25.0 37.0 8 35.0285 37.0 37.0 37.0 25.0 37.0 9 34.963 37.0 37.0 37.0 25.0 37.0 10-14 35.1151 37.0 37.0 37.0 25.0 37.0 15-19 35.22070000000001 37.0 37.0 37.0 27.4 37.0 20-24 35.0244 37.0 37.0 37.0 25.0 37.0 25-29 35.183 37.0 37.0 37.0 29.8 37.0 30-34 35.477 37.0 37.0 37.0 32.2 37.0 35-39 35.2913 37.0 37.0 37.0 29.8 37.0 40-44 35.0265 37.0 37.0 37.0 27.4 37.0 45-49 35.2252 37.0 37.0 37.0 27.4 37.0 50-54 34.6318 37.0 37.0 37.0 27.0 37.0 55-59 34.0111 37.0 37.0 37.0 25.0 37.0 60-64 34.887 37.0 37.0 37.0 27.4 37.0 65-69 34.0382 37.0 34.6 37.0 27.4 37.0 70-74 32.875400000000006 37.0 29.8 37.0 22.2 37.0 75-79 33.3466 37.0 34.6 37.0 22.2 37.0 80-84 34.4055 37.0 37.0 37.0 25.0 37.0 85-89 32.3658 37.0 32.2 37.0 19.4 37.0 90-94 33.875600000000006 37.0 37.0 37.0 25.0 37.0 95-99 33.714 37.0 37.0 37.0 25.0 37.0 100-104 33.236900000000006 37.0 37.0 37.0 25.0 37.0 105-109 34.044500000000006 37.0 37.0 37.0 25.0 37.0 110-114 34.3883 37.0 37.0 37.0 25.0 37.0 115-119 34.236900000000006 37.0 37.0 37.0 25.0 37.0 120-124 33.8627 37.0 37.0 37.0 25.0 37.0 125-129 33.650499999999994 37.0 37.0 37.0 25.0 37.0 130-134 33.4939 37.0 34.6 37.0 25.0 37.0 135-139 31.9029 37.0 25.0 37.0 13.8 37.0 140-144 31.479200000000002 37.0 25.0 37.0 11.0 37.0 145-149 31.0209 37.0 25.0 37.0 11.0 37.0 150-151 30.56675 37.0 25.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 3.0 17 4.0 18 5.0 19 5.0 20 4.0 21 5.0 22 8.0 23 8.0 24 8.0 25 15.0 26 10.0 27 19.0 28 26.0 29 57.0 30 97.0 31 193.0 32 327.0 33 633.0 34 1196.0 35 1226.0 36 151.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.574999999999996 22.05 7.225 25.15 2 31.900000000000002 22.025 27.750000000000004 18.325 3 24.25 25.074999999999996 30.675 20.0 4 25.924999999999997 31.05 22.825 20.200000000000003 5 28.65 32.45 19.825 19.075 6 24.3 34.050000000000004 20.4 21.25 7 23.575 20.349999999999998 35.199999999999996 20.875 8 23.525 23.575 25.474999999999998 27.425 9 23.825 22.375 28.025 25.775 10-14 26.040000000000003 26.36 23.98 23.62 15-19 26.029999999999998 25.324999999999996 25.665 22.98 20-24 26.235000000000003 25.869999999999997 24.635 23.26 25-29 25.94 25.935000000000002 24.665 23.46 30-34 25.89 26.06 25.040000000000003 23.01 35-39 25.85 25.685000000000002 24.565 23.9 40-44 26.085 25.255 25.174999999999997 23.485 45-49 25.5 26.290000000000003 25.174999999999997 23.035 50-54 24.895 25.775 26.740000000000002 22.59 55-59 25.174999999999997 27.105 24.990000000000002 22.73 60-64 26.590000000000003 25.525 25.419999999999998 22.465 65-69 25.685000000000002 26.479999999999997 24.92 22.915 70-74 26.545 25.28 25.86 22.314999999999998 75-79 27.185 24.545 25.47 22.8 80-84 25.195 26.314999999999998 25.885 22.605 85-89 22.939999999999998 29.25 25.55 22.259999999999998 90-94 25.695 26.16 25.385 22.759999999999998 95-99 25.91 26.474999999999998 25.295 22.32 100-104 25.53 27.255000000000003 25.019999999999996 22.195 105-109 25.06 26.619999999999997 25.46 22.86 110-114 25.805 26.55 25.405 22.24 115-119 25.779999999999998 26.32 25.259999999999998 22.64 120-124 25.765 25.77 26.005 22.46 125-129 26.950000000000003 25.685000000000002 25.53 21.834999999999997 130-134 26.029999999999998 26.150000000000002 25.840000000000003 21.98 135-139 26.38 27.005000000000003 25.335 21.279999999999998 140-144 26.365 26.44 25.259999999999998 21.935 145-149 26.665 26.229999999999997 25.385 21.72 150-151 25.124999999999996 26.4625 28.1375 20.275000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 1.5 27 1.0 28 2.5 29 5.0 30 10.5 31 10.0 32 9.5 33 18.5 34 22.5 35 30.5 36 48.0 37 58.5 38 80.5 39 107.5 40 133.5 41 152.5 42 157.5 43 196.0 44 208.0 45 212.5 46 227.5 47 214.0 48 198.0 49 177.5 50 175.5 51 150.5 52 128.5 53 137.5 54 128.0 55 112.0 56 89.5 57 86.0 58 87.5 59 75.0 60 75.0 61 68.5 62 63.5 63 56.0 64 48.0 65 42.5 66 36.5 67 35.0 68 28.5 69 19.5 70 14.5 71 11.5 72 10.5 73 8.0 74 4.0 75 2.5 76 2.0 77 2.5 78 1.5 79 0.5 80 1.5 81 1.5 82 0.0 83 0.0 84 0.5 85 2.0 86 1.5 87 0.0 88 0.0 89 0.0 90 1.0 91 1.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.94999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 89.7133220910624 79.80000000000001 2 8.881394041596401 15.8 3 1.0118043844856661 2.7 4 0.33726812816188867 1.2 5 0.028105677346824058 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.028105677346824058 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGATCAGTTGTGATGATTCCTGGGCAGGGAACGCCACTCACTGCTGAGC 15 0.375 No Hit GTTGCTCATTGCATCTCCGAGATGACGATCTTTAGCTATGTTTGTAATAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.7250000000000001 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.7 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.1375 0.0 0.0 0.0 0.0 120-121 2.4875 0.0 0.0 0.0 0.0 122-123 2.75 0.0 0.0 0.0 0.0 124-125 3.0875 0.0 0.0 0.0 0.0 126-127 3.2875 0.0 0.0 0.0 0.0 128-129 3.625 0.0 0.0 0.0 0.0 130-131 4.125 0.0 0.0 0.0 0.0 132-133 4.6625 0.0 0.0 0.0 0.0 134-135 5.0625 0.0 0.0 0.0 0.0 136-137 5.4625 0.0 0.0 0.0 0.0 138-139 5.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTGGA 10 0.006830828 145.0 7 TGCCCTG 10 0.006830828 145.0 9 >>END_MODULE Read 666013 spots for SRR18694425.sra Written 666013 spots for SRR18694425.sra Read 666013 spots for SRR18694425.sra Written 666013 spots for SRR18694425.sra Read 666013 spots for SRR18694425.sra Written 666013 spots for SRR18694425.sra Read 666013 spots for SRR18694425.sra Written 666013 spots for SRR18694425.sra Read 666013 spots for SRR18694425.sra Written 666013 spots for SRR18694425.sra Read 666013 spots for SRR18694425.sra Written 666013 spots for SRR18694425.sra Read 666013 spots for SRR18694425.sra Written 666013 spots for SRR18694425.sra Read 666013 spots for SRR18694425.sra Written 666013 spots for SRR18694425.sra Read 666013 spots for SRR18694425.sra Written 666013 spots for SRR18694425.sra Read 666013 spots for SRR18694425.sra Written 666013 spots for SRR18694425.sra Read 666013 spots for SRR18694425.sra Written 666013 spots for SRR18694425.sra Read 666013 spots for SRR18694425.sra Written 666013 spots for SRR18694425.sra Read 666013 spots for SRR18694425.sra Written 666013 spots for SRR18694425.sra Read 666013 spots for SRR18694425.sra Written 666013 spots for SRR18694425.sra Read 666032 spots for SRR18694425.sra Written 666032 spots for SRR18694425.sra Read 666013 spots for SRR18694425.sra Written 666013 spots for SRR18694425.sra Read 666013 spots for SRR18694425.sra Written 666013 spots for SRR18694425.sra Read 666013 spots for SRR18694425.sra Written 666013 spots for SRR18694425.sra Read 666013 spots for SRR18694425.sra Written 666013 spots for SRR18694425.sra Read 666013 spots for SRR18694425.sra Written 666013 spots for SRR18694425.sra SRR ids: ['SRR18694425.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8nem6g12 SRR18694425.sra spots: 13320279 blocks: [[1, 666013], [666014, 1332026], [1332027, 1998039], [1998040, 2664052], [2664053, 3330065], [3330066, 3996078], [3996079, 4662091], [4662092, 5328104], [5328105, 5994117], [5994118, 6660130], [6660131, 7326143], [7326144, 7992156], [7992157, 8658169], [8658170, 9324182], [9324183, 9990195], [9990196, 10656208], [10656209, 11322221], [11322222, 11988234], [11988235, 12654247], [12654248, 13320279]] SRR18694425 file size 4505113 SRR18694425 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694425 SRR18694425_1.fastq SRR18694425_2.fastq Input file: SRR18694425_1.fastq Paired file: SRR18694425_2.fastq trimmed: SRR18694425-trimmed-pair1.fastq, SRR18694425-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:31:50 2024 >> started Tue Dec 10 06:32:05 2024 >> done (15.357s) 13320279 read pairs processed; of these: 170 ( 0.00%) short read pairs filtered out after trimming by size control 4146 ( 0.03%) empty read pairs filtered out after trimming by size control 13315963 (99.97%) read pairs available; of these: 1179883 ( 8.86%) trimmed read pairs available after processing 12136080 (91.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 17 0.00% 20 20 0.00% 21 13 0.00% 22 20 0.00% 23 32 0.00% 24 21 0.00% 25 31 0.00% 26 30 0.00% 27 35 0.00% 28 38 0.00% 29 25 0.00% 30 37 0.00% 31 34 0.00% 32 31 0.00% 33 41 0.00% 34 34 0.00% 35 47 0.00% 36 37 0.00% 37 41 0.00% 38 39 0.00% 39 32 0.00% 40 42 0.00% 41 48 0.00% 42 49 0.00% 43 49 0.00% 44 47 0.00% 45 60 0.00% 46 67 0.00% 47 60 0.00% 48 48 0.00% 49 75 0.00% 50 97 0.00% 51 61 0.00% 52 69 0.00% 53 71 0.00% 54 74 0.00% 55 113 0.00% 56 117 0.00% 57 127 0.00% 58 148 0.00% 59 174 0.00% 60 184 0.00% 61 242 0.00% 62 218 0.00% 63 217 0.00% 64 260 0.00% 65 251 0.00% 66 285 0.00% 67 343 0.00% 68 427 0.00% 69 470 0.00% 70 541 0.00% 71 552 0.00% 72 673 0.01% 73 771 0.01% 74 802 0.01% 75 907 0.01% 76 1081 0.01% 77 1078 0.01% 78 1223 0.01% 79 1445 0.01% 80 1546 0.01% 81 1778 0.01% 82 1952 0.01% 83 2133 0.02% 84 2420 0.02% 85 2557 0.02% 86 2653 0.02% 87 2869 0.02% 88 3294 0.02% 89 3494 0.03% 90 3869 0.03% 91 4119 0.03% 92 4469 0.03% 93 4749 0.04% 94 5265 0.04% 95 5425 0.04% 96 5726 0.04% 97 5993 0.05% 98 6339 0.05% 99 6712 0.05% 100 7249 0.05% 101 7596 0.06% 102 7977 0.06% 103 8453 0.06% 104 9073 0.07% 105 9350 0.07% 106 9549 0.07% 107 10155 0.08% 108 10454 0.08% 109 10867 0.08% 110 11198 0.08% 111 11982 0.09% 112 12577 0.09% 113 13157 0.10% 114 14008 0.11% 115 14371 0.11% 116 14921 0.11% 117 15358 0.12% 118 16008 0.12% 119 15919 0.12% 120 16851 0.13% 121 17730 0.13% 122 18292 0.14% 123 19081 0.14% 124 20238 0.15% 125 20701 0.16% 126 21187 0.16% 127 21788 0.16% 128 22385 0.17% 129 22896 0.17% 130 23277 0.17% 131 24160 0.18% 132 24818 0.19% 133 26170 0.20% 134 26723 0.20% 135 27459 0.21% 136 28369 0.21% 137 28928 0.22% 138 29067 0.22% 139 30504 0.23% 140 31127 0.23% 141 31511 0.24% 142 32545 0.24% 143 33017 0.25% 144 34059 0.26% 145 35676 0.27% 146 36182 0.27% 147 37854 0.28% 148 37960 0.29% 149 38599 0.29% 150 38913 0.29% 151 12136080 91.14% 13315963 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=34 prefix-density=0.35 prefix-fanout=2.3 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=297.61 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=32.4 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=30 prefix-density=0.37 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=208.16 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=13.9 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGA SRR18694425 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:33:02 Started mapping on | Dec 10 06:33:02 Finished on | Dec 10 06:34:45 Mapping speed, Million of reads per hour | 465.41 Number of input reads | 13315963 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12348375 Uniquely mapped reads % | 92.73% Average mapped length | 296.27 Number of splices: Total | 13353553 Number of splices: Annotated (sjdb) | 12508511 Number of splices: GT/AG | 13183110 Number of splices: GC/AG | 142111 Number of splices: AT/AC | 7944 Number of splices: Non-canonical | 20388 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.01% Deletion average length | 2.51 Insertion rate per base | 0.01% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 181013 % of reads mapped to multiple loci | 1.36% Number of reads mapped to too many loci | 22653 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.01% % of reads unmapped: other | 1.73% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 786575 786575 786575 N_multimapping 181013 181013 181013 N_noFeature 562577 12028315 669144 N_ambiguous 254206 1800 41023 UnstrandedReadsAssigned:11531592 PositiveStrandReadsAssigned:318260 NegativeStrandReadsAssigned:11638208 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694425 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694425-trimmed-pair1.fastq SRR18694425-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,315,963 reads, 11,832,414 reads pseudoaligned [quant] estimated average fragment length: 269.652 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,121 rounds 52973 SRR18694425.ke.tsv 35125 SRR18694425.se.tsv 88098 total ==> SRR18694425.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 667.829 0 0 PNS24247 1044 775.348 51.0651 8.76343 PNS24249 1928 1659.35 21.8564 1.75262 PNS24246 1044 775.348 51.0651 8.76343 PNS24248 1044 775.348 51.0651 8.76343 PNS24244 1471 1202.35 111.948 12.3889 PNS24243 293 91.432 0 0 KQK14069 1603 1334.35 2245.05 223.874 KQK14071 474 231.174 29.9806 17.2563 ==> SRR18694425.se.tsv <== BRADI_1g14170v3 2404 BRADI_1g53295v3 98 BRADI_1g59795v3 472 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 1170 BRADI_1g74790v3 149 BRADI_1g09890v3 6 BRADI_1g77505v3 145 BRADI_1g48960v3 0 SRR18694425 completed mapping pipeline successfully