Starting /dee2/code/volunteer_pipeline.sh SRR18694426 current disk space = 1526044446720 free memory = 1556865804 SRR18694426 SRAfilesize 6370148fbcf8d43a02fe3d75f6d45d46 SRR18694426.sra SRR18694426.sra file validated SRR18694426 is paired end SRR18694426 is conventional basespace SRR18694426 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694426_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1635 37.0 37.0 37.0 37.0 37.0 2 36.03625 37.0 37.0 37.0 37.0 37.0 3 36.399 37.0 37.0 37.0 37.0 37.0 4 36.565 37.0 37.0 37.0 37.0 37.0 5 36.5645 37.0 37.0 37.0 37.0 37.0 6 36.4005 37.0 37.0 37.0 37.0 37.0 7 36.519 37.0 37.0 37.0 37.0 37.0 8 36.594 37.0 37.0 37.0 37.0 37.0 9 36.651 37.0 37.0 37.0 37.0 37.0 10-14 36.5782 37.0 37.0 37.0 37.0 37.0 15-19 36.595200000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.607000000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.574099999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.5227 37.0 37.0 37.0 37.0 37.0 35-39 36.6492 37.0 37.0 37.0 37.0 37.0 40-44 36.598699999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.4103 37.0 37.0 37.0 37.0 37.0 50-54 36.4852 37.0 37.0 37.0 37.0 37.0 55-59 36.4984 37.0 37.0 37.0 37.0 37.0 60-64 36.457800000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.2799 37.0 37.0 37.0 37.0 37.0 70-74 36.364799999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.5222 37.0 37.0 37.0 37.0 37.0 80-84 36.4001 37.0 37.0 37.0 37.0 37.0 85-89 36.178700000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.34179999999999 37.0 37.0 37.0 29.8 37.0 95-99 36.1353 37.0 37.0 37.0 37.0 37.0 100-104 36.1226 37.0 37.0 37.0 37.0 37.0 105-109 36.2044 37.0 37.0 37.0 37.0 37.0 110-114 36.146100000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.5058 37.0 37.0 37.0 37.0 37.0 120-124 36.552699999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.527100000000004 37.0 37.0 37.0 37.0 37.0 130-134 36.463300000000004 37.0 37.0 37.0 37.0 37.0 135-139 36.3887 37.0 37.0 37.0 37.0 37.0 140-144 36.237899999999996 37.0 37.0 37.0 37.0 37.0 145-149 36.1827 37.0 37.0 37.0 37.0 37.0 150-151 33.59425 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 0.0 24 2.0 25 1.0 26 7.0 27 2.0 28 0.0 29 10.0 30 10.0 31 14.0 32 21.0 33 59.0 34 110.0 35 340.0 36 3248.0 37 174.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.775000000000006 9.775 5.125 33.324999999999996 2 23.18876911506643 10.278265229380796 33.7678616194535 32.765104036099274 3 19.75 15.675 26.1 38.475 4 26.3 21.75 22.175 29.775000000000002 5 26.700000000000003 26.575 23.599999999999998 23.125 6 23.75 30.675 22.775000000000002 22.8 7 17.974999999999998 24.825 38.95 18.25 8 20.225 23.25 31.0 25.525 9 20.175 20.95 33.925 24.95 10-14 22.88 26.979999999999997 25.855 24.285 15-19 23.115 24.795 26.055 26.035000000000004 20-24 22.830000000000002 25.669999999999998 25.615 25.885 25-29 23.29 25.419999999999998 25.775 25.515 30-34 23.225 26.035000000000004 24.89 25.85 35-39 23.044999999999998 25.490000000000002 25.900000000000002 25.564999999999998 40-44 23.64 25.28 25.874999999999996 25.205 45-49 23.32 24.855 25.88 25.945 50-54 23.49 25.775 25.455 25.28 55-59 23.825 25.679999999999996 25.335 25.16 60-64 23.16 25.290000000000003 24.98 26.57 65-69 23.345 26.145000000000003 25.36 25.15 70-74 23.985 25.490000000000002 24.955 25.569999999999997 75-79 22.939999999999998 25.55 24.959999999999997 26.55 80-84 23.425 26.215 24.555 25.805 85-89 22.919999999999998 25.430000000000003 25.474999999999998 26.174999999999997 90-94 23.14 25.46 25.39 26.009999999999998 95-99 22.95 25.655 25.319999999999997 26.075 100-104 23.505000000000003 25.650000000000002 25.014999999999997 25.83 105-109 23.14 25.34 25.285000000000004 26.235000000000003 110-114 24.005000000000003 25.240000000000002 24.955 25.8 115-119 23.505000000000003 25.7 24.84 25.955000000000002 120-124 24.57 25.89 24.224999999999998 25.314999999999998 125-129 24.279999999999998 25.5 24.355 25.865 130-134 24.154999999999998 25.72 24.779999999999998 25.345000000000002 135-139 24.224999999999998 25.995 24.169999999999998 25.61 140-144 23.325000000000003 25.115 25.240000000000002 26.32 145-149 23.435 25.21 24.93 26.424999999999997 150-151 23.5 25.15 24.2875 27.0625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 1.5 26 1.0 27 3.0 28 3.5 29 5.0 30 6.0 31 9.5 32 14.5 33 17.0 34 27.5 35 37.5 36 49.0 37 65.0 38 77.5 39 88.5 40 114.5 41 145.0 42 143.5 43 170.0 44 207.0 45 202.0 46 200.0 47 196.0 48 196.0 49 190.0 50 173.0 51 168.5 52 154.5 53 129.0 54 117.0 55 118.0 56 104.0 57 84.0 58 76.0 59 74.0 60 71.0 61 58.5 62 48.5 63 49.5 64 58.0 65 62.0 66 51.0 67 41.0 68 36.5 69 31.5 70 27.5 71 19.5 72 20.0 73 19.5 74 10.5 75 6.5 76 5.0 77 4.0 78 2.5 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.5 #Duplication Level Percentage of deduplicated Percentage of total 1 86.82080924855491 75.1 2 11.184971098265896 19.35 3 1.5895953757225432 4.125 4 0.37572254335260113 1.3 5 0.028901734104046246 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTGTTGTGCGCAGGAGCAAAGCAGCAGCTAGCCAGGACGCAGTTCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.6000000000000001 0.0 0.0 0.0 0.0 92-93 0.6625000000000001 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.2 0.0 0.0 0.0 0.0 102-103 1.5 0.0 0.0 0.0 0.0 104-105 1.8 0.0 0.0 0.0 0.0 106-107 2.0375 0.0 0.0 0.0 0.0 108-109 2.4000000000000004 0.0 0.0 0.0 0.0 110-111 2.6875 0.0 0.0 0.0 0.0 112-113 2.9625 0.0 0.0 0.0 0.0 114-115 3.2 0.0 0.0 0.0 0.0 116-117 3.6625 0.0 0.0 0.0 0.0 118-119 4.0875 0.0 0.0 0.0 0.0 120-121 4.5625 0.0 0.0 0.0 0.0 122-123 5.25 0.0 0.0 0.0 0.0 124-125 5.8125 0.0 0.0 0.0 0.0 126-127 6.2125 0.0 0.0 0.0 0.0 128-129 6.699999999999999 0.0 0.0 0.0 0.0 130-131 7.2625 0.0 0.0 0.0 0.0 132-133 7.6125 0.0 0.0 0.0 0.0 134-135 8.2 0.0 0.0 0.0 0.0 136-137 8.662500000000001 0.0 0.0 0.0 0.0 138-139 9.337499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCGCAT 10 0.006830828 145.0 1 GTTCAGA 10 0.006830828 145.0 1 GTGATGG 10 0.006830828 145.0 7 >>END_MODULE SRR18694426 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694426_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.427 37.0 37.0 37.0 25.0 37.0 2 35.073 37.0 37.0 37.0 25.0 37.0 3 35.2965 37.0 37.0 37.0 25.0 37.0 4 35.4345 37.0 37.0 37.0 37.0 37.0 5 35.1925 37.0 37.0 37.0 25.0 37.0 6 35.3155 37.0 37.0 37.0 25.0 37.0 7 35.261 37.0 37.0 37.0 25.0 37.0 8 35.486 37.0 37.0 37.0 37.0 37.0 9 35.557 37.0 37.0 37.0 37.0 37.0 10-14 35.574799999999996 37.0 37.0 37.0 37.0 37.0 15-19 35.6201 37.0 37.0 37.0 37.0 37.0 20-24 35.3948 37.0 37.0 37.0 34.6 37.0 25-29 35.5368 37.0 37.0 37.0 34.6 37.0 30-34 35.7624 37.0 37.0 37.0 37.0 37.0 35-39 35.5539 37.0 37.0 37.0 37.0 37.0 40-44 35.3226 37.0 37.0 37.0 29.8 37.0 45-49 35.4428 37.0 37.0 37.0 34.6 37.0 50-54 34.9722 37.0 37.0 37.0 29.8 37.0 55-59 34.3626 37.0 37.0 37.0 25.0 37.0 60-64 35.047799999999995 37.0 37.0 37.0 27.4 37.0 65-69 34.1375 37.0 34.6 37.0 27.4 37.0 70-74 32.926 37.0 29.8 37.0 22.2 37.0 75-79 33.5647 37.0 34.6 37.0 22.2 37.0 80-84 34.54280000000001 37.0 37.0 37.0 25.0 37.0 85-89 32.5668 37.0 32.2 37.0 19.4 37.0 90-94 34.1091 37.0 37.0 37.0 25.0 37.0 95-99 33.896300000000004 37.0 37.0 37.0 25.0 37.0 100-104 33.346500000000006 37.0 37.0 37.0 25.0 37.0 105-109 34.241200000000006 37.0 37.0 37.0 25.0 37.0 110-114 34.5192 37.0 37.0 37.0 25.0 37.0 115-119 34.4396 37.0 37.0 37.0 25.0 37.0 120-124 34.178 37.0 37.0 37.0 25.0 37.0 125-129 34.0402 37.0 37.0 37.0 25.0 37.0 130-134 33.8925 37.0 37.0 37.0 25.0 37.0 135-139 32.2969 37.0 27.4 37.0 13.8 37.0 140-144 31.6291 37.0 25.0 37.0 11.0 37.0 145-149 31.307399999999994 37.0 25.0 37.0 11.0 37.0 150-151 31.015749999999997 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 2.0 17 7.0 18 3.0 19 7.0 20 9.0 21 7.0 22 8.0 23 5.0 24 5.0 25 10.0 26 11.0 27 13.0 28 34.0 29 47.0 30 69.0 31 126.0 32 223.0 33 491.0 34 1101.0 35 1572.0 36 248.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.475 19.7 8.125 22.7 2 30.725 22.6 26.200000000000003 20.474999999999998 3 24.2 24.675 28.875 22.25 4 28.025 29.425 19.2 23.35 5 27.05 34.300000000000004 18.8 19.85 6 24.075 34.050000000000004 20.724999999999998 21.15 7 23.7 19.35 34.125 22.825 8 23.125 22.325 26.125 28.425 9 23.674999999999997 21.099999999999998 28.9 26.325 10-14 26.575 26.05 22.919999999999998 24.455 15-19 25.945 24.555 24.58 24.92 20-24 26.39 25.575 24.21 23.825 25-29 25.490000000000002 24.884999999999998 24.66 24.965 30-34 25.685000000000002 24.91 24.85 24.555 35-39 26.279999999999998 25.235000000000003 24.445 24.04 40-44 26.064999999999998 24.884999999999998 24.95 24.099999999999998 45-49 25.91 25.005 24.36 24.725 50-54 24.685000000000002 24.759999999999998 26.16 24.395 55-59 25.83 26.13 23.555 24.485 60-64 25.825 24.645 24.925 24.605 65-69 26.365 25.035 24.610000000000003 23.990000000000002 70-74 26.88 24.235 24.54 24.345 75-79 27.644999999999996 23.785 24.82 23.75 80-84 25.77 25.5 24.95 23.78 85-89 24.4 27.79 24.560000000000002 23.25 90-94 26.505000000000003 25.590000000000003 24.275 23.630000000000003 95-99 25.82 26.064999999999998 24.715 23.400000000000002 100-104 25.805 26.515 24.33 23.35 105-109 25.790000000000003 25.695 24.685000000000002 23.830000000000002 110-114 26.415 26.255 24.185000000000002 23.145 115-119 26.705000000000002 25.705 24.5 23.09 120-124 26.195 25.990000000000002 24.884999999999998 22.93 125-129 25.895000000000003 25.915 24.845 23.345 130-134 26.235000000000003 26.384999999999998 24.529999999999998 22.85 135-139 26.200000000000003 26.21 24.675 22.915 140-144 27.650000000000002 25.445 24.58 22.325 145-149 27.045 25.669999999999998 24.529999999999998 22.755 150-151 24.9375 25.7875 26.8375 22.4375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 0.5 24 0.5 25 1.5 26 2.0 27 2.5 28 2.0 29 5.5 30 10.5 31 11.5 32 14.5 33 16.5 34 21.0 35 29.5 36 41.0 37 48.5 38 59.5 39 81.0 40 106.0 41 128.0 42 156.0 43 177.0 44 179.0 45 192.5 46 196.5 47 193.0 48 181.5 49 178.0 50 195.0 51 168.5 52 130.5 53 118.5 54 108.0 55 97.5 56 103.0 57 104.0 58 88.5 59 78.5 60 72.5 61 77.5 62 69.0 63 51.5 64 52.5 65 57.0 66 55.0 67 56.0 68 58.0 69 50.5 70 39.0 71 27.0 72 24.0 73 23.5 74 15.5 75 9.5 76 7.0 77 5.0 78 5.5 79 4.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 1.0 90 1.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.375 #Duplication Level Percentage of deduplicated Percentage of total 1 87.92560801144492 76.825 2 10.243204577968527 17.9 3 1.402002861230329 3.675 4 0.3147353361945637 1.0999999999999999 5 0.11444921316165953 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCTGCTTGCAACCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTC 5 0.125 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit TGGCGGAACAAAAGCTACAAAAGGACTTCTACAGTGCTGCATCCAAAGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0125 72-73 0.125 0.0 0.0 0.0 0.025 74-75 0.125 0.0 0.0 0.0 0.025 76-77 0.125 0.0 0.0 0.0 0.025 78-79 0.1375 0.0 0.0 0.0 0.025 80-81 0.15 0.0 0.0 0.0 0.025 82-83 0.175 0.0 0.0 0.0 0.025 84-85 0.2375 0.0 0.0 0.0 0.025 86-87 0.325 0.0 0.0 0.0 0.025 88-89 0.4375 0.0 0.0 0.0 0.025 90-91 0.575 0.0 0.0 0.0 0.025 92-93 0.6375 0.0 0.0 0.0 0.025 94-95 0.7375 0.0 0.0 0.0 0.025 96-97 0.8500000000000001 0.0 0.0 0.0 0.025 98-99 0.95 0.0 0.0 0.0 0.025 100-101 1.175 0.0 0.0 0.0 0.025 102-103 1.475 0.0 0.0 0.0 0.025 104-105 1.775 0.0 0.0 0.0 0.025 106-107 2.0125 0.0 0.0 0.0 0.025 108-109 2.375 0.0 0.0 0.0 0.025 110-111 2.6500000000000004 0.0 0.0 0.0 0.025 112-113 2.9 0.0 0.0 0.0 0.025 114-115 3.175 0.0 0.0 0.0 0.025 116-117 3.6375 0.0 0.0 0.0 0.025 118-119 4.0875 0.0 0.0 0.0 0.025 120-121 4.5375 0.0 0.0 0.0 0.025 122-123 5.225 0.0 0.0 0.0 0.025 124-125 5.8 0.0 0.0 0.0 0.025 126-127 6.2125 0.0 0.0 0.0 0.025 128-129 6.725 0.0 0.0 0.0 0.025 130-131 7.2875 0.0 0.0 0.0 0.025 132-133 7.625 0.0 0.0 0.0 0.025 134-135 8.2125 0.0 0.0 0.0 0.025 136-137 8.662500000000001 0.0 0.0 0.0 0.025 138-139 9.3125 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 490172 spots for SRR18694426.sra Written 490172 spots for SRR18694426.sra Read 490172 spots for SRR18694426.sra Written 490172 spots for SRR18694426.sra Read 490172 spots for SRR18694426.sra Written 490172 spots for SRR18694426.sra Read 490172 spots for SRR18694426.sra Written 490172 spots for SRR18694426.sra Read 490172 spots for SRR18694426.sra Written 490172 spots for SRR18694426.sra Read 490172 spots for SRR18694426.sra Written 490172 spots for SRR18694426.sra Read 490172 spots for SRR18694426.sra Written 490172 spots for SRR18694426.sra Read 490172 spots for SRR18694426.sra Written 490172 spots for SRR18694426.sra Read 490184 spots for SRR18694426.sra Written 490184 spots for SRR18694426.sra Read 490172 spots for SRR18694426.sra Written 490172 spots for SRR18694426.sra Read 490172 spots for SRR18694426.sra Written 490172 spots for SRR18694426.sra Read 490172 spots for SRR18694426.sra Written 490172 spots for SRR18694426.sra Read 490172 spots for SRR18694426.sra Written 490172 spots for SRR18694426.sra Read 490172 spots for SRR18694426.sra Written 490172 spots for SRR18694426.sra Read 490172 spots for SRR18694426.sra Written 490172 spots for SRR18694426.sra Read 490172 spots for SRR18694426.sra Written 490172 spots for SRR18694426.sra Read 490172 spots for SRR18694426.sra Written 490172 spots for SRR18694426.sra Read 490172 spots for SRR18694426.sra Written 490172 spots for SRR18694426.sra Read 490172 spots for SRR18694426.sra Written 490172 spots for SRR18694426.sra Read 490172 spots for SRR18694426.sra Written 490172 spots for SRR18694426.sra SRR ids: ['SRR18694426.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ygrrdpzr SRR18694426.sra spots: 9803452 blocks: [[1, 490172], [490173, 980344], [980345, 1470516], [1470517, 1960688], [1960689, 2450860], [2450861, 2941032], [2941033, 3431204], [3431205, 3921376], [3921377, 4411548], [4411549, 4901720], [4901721, 5391892], [5391893, 5882064], [5882065, 6372236], [6372237, 6862408], [6862409, 7352580], [7352581, 7842752], [7842753, 8332924], [8332925, 8823096], [8823097, 9313268], [9313269, 9803452]] SRR18694426 file size 3310325 SRR18694426 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694426 SRR18694426_1.fastq SRR18694426_2.fastq Input file: SRR18694426_1.fastq Paired file: SRR18694426_2.fastq trimmed: SRR18694426-trimmed-pair1.fastq, SRR18694426-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:31:40 2024 >> started Tue Dec 10 06:31:50 2024 >> done (10.385s) 9803452 read pairs processed; of these: 124 ( 0.00%) short read pairs filtered out after trimming by size control 3077 ( 0.03%) empty read pairs filtered out after trimming by size control 9800251 (99.97%) read pairs available; of these: 1321983 (13.49%) trimmed read pairs available after processing 8478268 (86.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 10 0.00% 20 12 0.00% 21 20 0.00% 22 12 0.00% 23 21 0.00% 24 20 0.00% 25 10 0.00% 26 18 0.00% 27 20 0.00% 28 15 0.00% 29 21 0.00% 30 16 0.00% 31 22 0.00% 32 32 0.00% 33 20 0.00% 34 26 0.00% 35 21 0.00% 36 25 0.00% 37 32 0.00% 38 32 0.00% 39 45 0.00% 40 47 0.00% 41 33 0.00% 42 30 0.00% 43 30 0.00% 44 37 0.00% 45 39 0.00% 46 52 0.00% 47 46 0.00% 48 54 0.00% 49 80 0.00% 50 81 0.00% 51 84 0.00% 52 84 0.00% 53 80 0.00% 54 99 0.00% 55 95 0.00% 56 111 0.00% 57 154 0.00% 58 165 0.00% 59 178 0.00% 60 211 0.00% 61 219 0.00% 62 251 0.00% 63 255 0.00% 64 289 0.00% 65 336 0.00% 66 366 0.00% 67 419 0.00% 68 452 0.00% 69 550 0.01% 70 625 0.01% 71 641 0.01% 72 795 0.01% 73 876 0.01% 74 1021 0.01% 75 1225 0.01% 76 1270 0.01% 77 1453 0.01% 78 1558 0.02% 79 1752 0.02% 80 1869 0.02% 81 2092 0.02% 82 2482 0.03% 83 2824 0.03% 84 3196 0.03% 85 3309 0.03% 86 3619 0.04% 87 3733 0.04% 88 4286 0.04% 89 4467 0.05% 90 4934 0.05% 91 5333 0.05% 92 5734 0.06% 93 6274 0.06% 94 6381 0.07% 95 7389 0.08% 96 7727 0.08% 97 8090 0.08% 98 8345 0.09% 99 9137 0.09% 100 9589 0.10% 101 9953 0.10% 102 10719 0.11% 103 11149 0.11% 104 11742 0.12% 105 12224 0.12% 106 12823 0.13% 107 12908 0.13% 108 13574 0.14% 109 14335 0.15% 110 14688 0.15% 111 15508 0.16% 112 15979 0.16% 113 16546 0.17% 114 17468 0.18% 115 18057 0.18% 116 18316 0.19% 117 19328 0.20% 118 19578 0.20% 119 19993 0.20% 120 21121 0.22% 121 21182 0.22% 122 21967 0.22% 123 22563 0.23% 124 23460 0.24% 125 23891 0.24% 126 24713 0.25% 127 25182 0.26% 128 25414 0.26% 129 26385 0.27% 130 26783 0.27% 131 26837 0.27% 132 28067 0.29% 133 28398 0.29% 134 28653 0.29% 135 30029 0.31% 136 29917 0.31% 137 30445 0.31% 138 30539 0.31% 139 31725 0.32% 140 31602 0.32% 141 32663 0.33% 142 33321 0.34% 143 33400 0.34% 144 34579 0.35% 145 34714 0.35% 146 35244 0.36% 147 36453 0.37% 148 36389 0.37% 149 36887 0.38% 150 37163 0.38% 151 8478268 86.51% 9800251 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=36 prefix-density=0.47 prefix-fanout=2.8 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=350.99 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=33.2 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=31 prefix-density=0.47 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=188.33 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=22.6 sequence=CGCCGCCGCCGTC SRR18694426 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:32:58 Started mapping on | Dec 10 06:32:58 Finished on | Dec 10 06:34:19 Mapping speed, Million of reads per hour | 435.57 Number of input reads | 9800251 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 8952894 Uniquely mapped reads % | 91.35% Average mapped length | 293.69 Number of splices: Total | 9095723 Number of splices: Annotated (sjdb) | 8515103 Number of splices: GT/AG | 8976119 Number of splices: GC/AG | 98197 Number of splices: AT/AC | 5278 Number of splices: Non-canonical | 16129 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.01% Deletion average length | 2.58 Insertion rate per base | 0.01% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 126287 % of reads mapped to multiple loci | 1.29% Number of reads mapped to too many loci | 20110 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.43% % of reads unmapped: other | 1.73% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 721070 721070 721070 N_multimapping 126287 126287 126287 N_noFeature 396431 8715210 478312 N_ambiguous 184325 1310 28727 UnstrandedReadsAssigned:8372138 PositiveStrandReadsAssigned:236374 NegativeStrandReadsAssigned:8445855 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694426 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694426-trimmed-pair1.fastq SRR18694426-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,800,251 reads, 8,602,352 reads pseudoaligned [quant] estimated average fragment length: 246.205 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52973 SRR18694426.ke.tsv 35125 SRR18694426.se.tsv 88098 total ==> SRR18694426.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 691.27 0 0 PNS24247 1044 798.795 27.8265 6.00125 PNS24249 1928 1682.79 47.8826 4.90191 PNS24246 1044 798.795 27.8265 6.00125 PNS24248 1044 798.795 27.8265 6.00125 PNS24244 1471 1225.79 43.6379 6.13288 PNS24243 293 99.9378 0 0 KQK14069 1603 1357.79 2321.56 294.554 KQK14071 474 246.751 20.3847 14.2319 ==> SRR18694426.se.tsv <== BRADI_1g14170v3 2503 BRADI_1g53295v3 52 BRADI_1g59795v3 299 BRADI_1g07683v3 0 BRADI_1g00485v3 25 BRADI_1g20270v3 976 BRADI_1g74790v3 145 BRADI_1g09890v3 3 BRADI_1g77505v3 118 BRADI_1g48960v3 0 SRR18694426 completed mapping pipeline successfully