Starting /dee2/code/volunteer_pipeline.sh SRR18694427 current disk space = 1526068158464 free memory = 1602339228 SRR18694427 SRAfilesize d813f61fe090a66e794ce9fda200b019 SRR18694427.sra SRR18694427.sra file validated SRR18694427 is paired end SRR18694427 is conventional basespace SRR18694427 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694427_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.073 37.0 37.0 37.0 37.0 37.0 2 36.0 37.0 37.0 37.0 37.0 37.0 3 36.257 37.0 37.0 37.0 37.0 37.0 4 36.543 37.0 37.0 37.0 37.0 37.0 5 36.5295 37.0 37.0 37.0 37.0 37.0 6 36.423 37.0 37.0 37.0 37.0 37.0 7 36.5495 37.0 37.0 37.0 37.0 37.0 8 36.595 37.0 37.0 37.0 37.0 37.0 9 36.5755 37.0 37.0 37.0 37.0 37.0 10-14 36.604299999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.5981 37.0 37.0 37.0 37.0 37.0 20-24 36.6077 37.0 37.0 37.0 37.0 37.0 25-29 36.5267 37.0 37.0 37.0 37.0 37.0 30-34 36.48440000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.6399 37.0 37.0 37.0 37.0 37.0 40-44 36.59310000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.3618 37.0 37.0 37.0 37.0 37.0 50-54 36.5125 37.0 37.0 37.0 37.0 37.0 55-59 36.5126 37.0 37.0 37.0 37.0 37.0 60-64 36.504200000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.2996 37.0 37.0 37.0 37.0 37.0 70-74 36.3857 37.0 37.0 37.0 37.0 37.0 75-79 36.4693 37.0 37.0 37.0 37.0 37.0 80-84 36.3688 37.0 37.0 37.0 37.0 37.0 85-89 36.1826 37.0 37.0 37.0 37.0 37.0 90-94 35.392399999999995 37.0 37.0 37.0 29.8 37.0 95-99 36.0753 37.0 37.0 37.0 37.0 37.0 100-104 36.1224 37.0 37.0 37.0 37.0 37.0 105-109 36.1191 37.0 37.0 37.0 37.0 37.0 110-114 36.157000000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.4297 37.0 37.0 37.0 37.0 37.0 120-124 36.5195 37.0 37.0 37.0 37.0 37.0 125-129 36.472899999999996 37.0 37.0 37.0 37.0 37.0 130-134 36.5244 37.0 37.0 37.0 37.0 37.0 135-139 36.339099999999995 37.0 37.0 37.0 37.0 37.0 140-144 36.211400000000005 37.0 37.0 37.0 37.0 37.0 145-149 36.1185 37.0 37.0 37.0 37.0 37.0 150-151 33.63375 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 0.0 25 0.0 26 2.0 27 0.0 28 5.0 29 5.0 30 12.0 31 14.0 32 21.0 33 68.0 34 149.0 35 355.0 36 3218.0 37 149.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.35 9.925 4.375 36.35 2 21.29258517034068 9.719438877755511 37.4248496993988 31.563126252505008 3 19.625 14.7 25.25 40.425 4 25.25 21.725 23.225 29.799999999999997 5 25.525 27.400000000000002 25.074999999999996 22.0 6 22.475 30.65 24.875 22.0 7 19.1 24.75 38.425 17.724999999999998 8 18.125 23.575 32.95 25.35 9 19.25 21.65 35.35 23.75 10-14 22.005 27.58 26.295 24.12 15-19 22.245 25.905 26.75 25.1 20-24 22.645 25.745 26.545 25.064999999999998 25-29 22.1 26.240000000000002 26.735 24.925 30-34 22.36 26.229999999999997 26.590000000000003 24.82 35-39 22.575 25.945 26.265 25.215 40-44 22.689999999999998 26.075 26.5 24.735 45-49 22.305 25.55 26.784999999999997 25.36 50-54 22.895 25.805 25.7 25.6 55-59 22.105 25.88 26.665 25.35 60-64 22.455 25.805 26.605 25.135 65-69 22.395 25.814999999999998 26.724999999999998 25.064999999999998 70-74 22.095000000000002 26.755000000000003 25.945 25.205 75-79 22.48 25.759999999999998 26.57 25.19 80-84 22.2 26.584999999999997 26.395000000000003 24.82 85-89 22.939999999999998 25.72 26.57 24.77 90-94 22.665 26.08 26.56 24.695 95-99 22.16 26.040000000000003 26.44 25.36 100-104 22.814999999999998 25.645 25.905 25.635 105-109 22.2 26.775 26.05 24.975 110-114 22.225 26.105 26.279999999999998 25.39 115-119 23.125 26.055 25.485000000000003 25.335 120-124 22.465 26.235000000000003 25.885 25.415 125-129 22.439999999999998 26.400000000000002 26.150000000000002 25.009999999999998 130-134 22.61 26.169999999999998 25.564999999999998 25.655 135-139 22.48 26.22 25.795 25.505 140-144 23.16 25.585 26.275 24.98 145-149 22.755 26.695 25.874999999999996 24.675 150-151 22.925 27.0125 25.224999999999998 24.837500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.5 24 1.5 25 1.0 26 1.0 27 1.0 28 3.5 29 7.5 30 7.0 31 6.5 32 14.5 33 21.5 34 28.0 35 38.5 36 52.5 37 80.0 38 99.5 39 100.0 40 111.5 41 141.0 42 175.0 43 205.5 44 208.0 45 224.5 46 238.5 47 223.0 48 216.5 49 205.0 50 186.0 51 175.5 52 154.5 53 127.5 54 111.5 55 97.0 56 95.5 57 100.0 58 84.0 59 60.0 60 50.0 61 48.5 62 47.5 63 50.5 64 53.5 65 40.0 66 24.0 67 18.0 68 18.5 69 17.0 70 9.5 71 4.5 72 4.5 73 2.5 74 0.5 75 1.5 76 1.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 86.36363636363636 74.575 2 11.78343949044586 20.349999999999998 3 1.5344528083381586 3.975 4 0.3184713375796179 1.0999999999999999 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.775 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 2.025 0.0 0.0 0.0 0.0 118-119 2.3 0.0 0.0 0.0 0.0 120-121 2.6125 0.0 0.0 0.0 0.0 122-123 2.9125 0.0 0.0 0.0 0.0 124-125 3.3375000000000004 0.0 0.0 0.0 0.0 126-127 3.6625 0.0 0.0 0.0 0.0 128-129 4.050000000000001 0.0 0.0 0.0 0.0 130-131 4.3 0.0 0.0 0.0 0.0 132-133 4.75 0.0 0.0 0.0 0.0 134-135 5.2125 0.0 0.0 0.0 0.0 136-137 5.550000000000001 0.0 0.0 0.0 0.0 138-139 5.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGTGCT 10 0.006830828 145.0 9 CCCTGAC 10 0.006830828 145.0 1 GCCGCCA 10 0.006830828 145.0 2 >>END_MODULE SRR18694427 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694427_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.46 37.0 37.0 37.0 25.0 37.0 2 34.136 37.0 37.0 37.0 25.0 37.0 3 34.565 37.0 37.0 37.0 25.0 37.0 4 34.648 37.0 37.0 37.0 25.0 37.0 5 34.5735 37.0 37.0 37.0 25.0 37.0 6 34.6865 37.0 37.0 37.0 25.0 37.0 7 34.5525 37.0 37.0 37.0 25.0 37.0 8 34.894 37.0 37.0 37.0 25.0 37.0 9 34.9485 37.0 37.0 37.0 25.0 37.0 10-14 35.03600000000001 37.0 37.0 37.0 25.0 37.0 15-19 35.0306 37.0 37.0 37.0 25.0 37.0 20-24 34.93730000000001 37.0 37.0 37.0 25.0 37.0 25-29 35.0544 37.0 37.0 37.0 29.8 37.0 30-34 35.35539999999999 37.0 37.0 37.0 32.2 37.0 35-39 35.1835 37.0 37.0 37.0 27.4 37.0 40-44 34.8791 37.0 37.0 37.0 25.0 37.0 45-49 35.11030000000001 37.0 37.0 37.0 27.4 37.0 50-54 34.525 37.0 37.0 37.0 24.6 37.0 55-59 33.985699999999994 37.0 37.0 37.0 25.0 37.0 60-64 34.8005 37.0 37.0 37.0 27.4 37.0 65-69 33.8821 37.0 34.6 37.0 24.6 37.0 70-74 32.7955 37.0 29.8 37.0 19.4 37.0 75-79 33.1948 37.0 34.6 37.0 22.2 37.0 80-84 34.2159 37.0 37.0 37.0 25.0 37.0 85-89 32.3065 37.0 32.2 37.0 19.4 37.0 90-94 33.7248 37.0 37.0 37.0 25.0 37.0 95-99 33.7639 37.0 37.0 37.0 25.0 37.0 100-104 33.061699999999995 37.0 32.2 37.0 25.0 37.0 105-109 33.7519 37.0 37.0 37.0 25.0 37.0 110-114 34.184099999999994 37.0 37.0 37.0 25.0 37.0 115-119 34.233799999999995 37.0 37.0 37.0 25.0 37.0 120-124 33.722699999999996 37.0 37.0 37.0 25.0 37.0 125-129 33.6437 37.0 37.0 37.0 25.0 37.0 130-134 33.4226 37.0 34.6 37.0 25.0 37.0 135-139 31.7289 37.0 25.0 37.0 13.8 37.0 140-144 31.486699999999995 37.0 25.0 37.0 11.0 37.0 145-149 30.9409 37.0 25.0 37.0 11.0 37.0 150-151 30.387 37.0 25.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 1.0 16 2.0 17 3.0 18 2.0 19 1.0 20 6.0 21 5.0 22 4.0 23 4.0 24 5.0 25 12.0 26 20.0 27 30.0 28 50.0 29 69.0 30 110.0 31 212.0 32 357.0 33 653.0 34 1164.0 35 1148.0 36 140.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.025 21.675 7.35 26.950000000000003 2 29.525000000000002 23.599999999999998 29.325000000000003 17.549999999999997 3 22.675 25.0 30.3 22.025 4 27.175 29.925 21.349999999999998 21.55 5 27.200000000000003 33.900000000000006 20.3 18.6 6 23.825 36.575 19.5 20.1 7 23.425 20.9 34.025 21.65 8 23.125 22.975 26.200000000000003 27.700000000000003 9 23.724999999999998 21.775 27.950000000000003 26.55 10-14 25.650000000000002 27.165 24.26 22.925 15-19 25.555 26.290000000000003 24.93 23.225 20-24 25.979999999999997 25.345000000000002 25.424999999999997 23.25 25-29 26.290000000000003 25.6 25.035 23.075000000000003 30-34 25.255 26.395000000000003 25.590000000000003 22.759999999999998 35-39 25.569999999999997 26.44 24.985 23.005 40-44 25.290000000000003 26.650000000000002 24.98 23.080000000000002 45-49 25.275 26.825 25.259999999999998 22.64 50-54 24.240000000000002 26.27 26.795 22.695 55-59 25.074999999999996 26.245 25.44 23.24 60-64 25.8 26.51 25.045 22.645 65-69 25.72 25.95 25.905 22.425 70-74 26.290000000000003 25.56 25.485000000000003 22.665 75-79 27.495000000000005 24.13 26.0 22.375 80-84 25.235000000000003 26.105 25.990000000000002 22.67 85-89 22.905 29.675 25.215 22.205 90-94 25.590000000000003 25.91 25.465 23.035 95-99 24.795 26.32 26.32 22.564999999999998 100-104 25.2 26.83 25.174999999999997 22.795 105-109 24.88 27.839999999999996 24.69 22.59 110-114 25.435000000000002 26.775 25.555 22.235 115-119 25.61 27.04 24.884999999999998 22.465 120-124 25.590000000000003 26.450000000000003 25.480000000000004 22.48 125-129 26.045 26.305 25.555 22.095000000000002 130-134 25.874999999999996 26.71 25.305 22.11 135-139 26.029999999999998 25.85 26.465 21.654999999999998 140-144 25.745 26.93 25.495 21.83 145-149 25.919999999999998 26.115 25.485000000000003 22.48 150-151 23.8125 26.174999999999997 29.125 20.8875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 0.5 25 0.0 26 1.0 27 6.5 28 10.0 29 6.5 30 4.5 31 4.5 32 7.0 33 16.0 34 33.0 35 44.5 36 48.5 37 73.0 38 98.5 39 105.0 40 123.0 41 163.5 42 194.0 43 197.0 44 201.5 45 209.0 46 201.0 47 195.5 48 188.0 49 174.0 50 177.5 51 172.5 52 141.0 53 119.0 54 102.5 55 95.0 56 89.0 57 88.5 58 95.0 59 84.0 60 75.5 61 73.5 62 70.5 63 60.5 64 47.0 65 44.5 66 40.0 67 25.0 68 20.5 69 16.0 70 11.0 71 9.5 72 6.0 73 5.0 74 4.0 75 2.0 76 2.0 77 2.0 78 0.5 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.5 99 1.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.325 #Duplication Level Percentage of deduplicated Percentage of total 1 88.59326351542597 78.25 2 10.04811774695726 17.75 3 1.0472686102462496 2.775 4 0.2830455703368242 1.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02830455703368242 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.9625 0.0 0.0 0.0 0.0 108-109 1.1124999999999998 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.6625 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.175 0.0 0.0 0.0 0.0 120-121 2.4875 0.0 0.0 0.0 0.0 122-123 2.7875 0.0 0.0 0.0 0.0 124-125 3.225 0.0 0.0 0.0 0.0 126-127 3.5625 0.0 0.0 0.0 0.0 128-129 3.95 0.0 0.0 0.0 0.0 130-131 4.2 0.0 0.0 0.0 0.0 132-133 4.65 0.0 0.0 0.0 0.0 134-135 5.1125 0.0 0.0 0.0 0.0 136-137 5.475 0.0 0.0 0.0 0.0 138-139 5.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 721288 spots for SRR18694427.sra Written 721288 spots for SRR18694427.sra Read 721288 spots for SRR18694427.sra Written 721288 spots for SRR18694427.sra Read 721288 spots for SRR18694427.sra Written 721288 spots for SRR18694427.sra Read 721288 spots for SRR18694427.sra Written 721288 spots for SRR18694427.sra Read 721288 spots for SRR18694427.sra Written 721288 spots for SRR18694427.sra Read 721288 spots for SRR18694427.sra Written 721288 spots for SRR18694427.sra Read 721292 spots for SRR18694427.sra Written 721292 spots for SRR18694427.sra Read 721288 spots for SRR18694427.sra Written 721288 spots for SRR18694427.sra Read 721288 spots for SRR18694427.sra Written 721288 spots for SRR18694427.sra Read 721288 spots for SRR18694427.sra Written 721288 spots for SRR18694427.sra Read 721288 spots for SRR18694427.sra Written 721288 spots for SRR18694427.sra Read 721288 spots for SRR18694427.sra Written 721288 spots for SRR18694427.sra Read 721288 spots for SRR18694427.sra Written 721288 spots for SRR18694427.sra Read 721288 spots for SRR18694427.sra Written 721288 spots for SRR18694427.sra Read 721288 spots for SRR18694427.sra Written 721288 spots for SRR18694427.sra Read 721288 spots for SRR18694427.sra Written 721288 spots for SRR18694427.sra Read 721288 spots for SRR18694427.sra Written 721288 spots for SRR18694427.sra Read 721288 spots for SRR18694427.sra Written 721288 spots for SRR18694427.sra Read 721288 spots for SRR18694427.sra Written 721288 spots for SRR18694427.sra Read 721288 spots for SRR18694427.sra Written 721288 spots for SRR18694427.sra SRR ids: ['SRR18694427.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2ygdxcz8 SRR18694427.sra spots: 14425764 blocks: [[1, 721288], [721289, 1442576], [1442577, 2163864], [2163865, 2885152], [2885153, 3606440], [3606441, 4327728], [4327729, 5049016], [5049017, 5770304], [5770305, 6491592], [6491593, 7212880], [7212881, 7934168], [7934169, 8655456], [8655457, 9376744], [9376745, 10098032], [10098033, 10819320], [10819321, 11540608], [11540609, 12261896], [12261897, 12983184], [12983185, 13704472], [13704473, 14425764]] SRR18694427 file size 4880805 SRR18694427 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694427 SRR18694427_1.fastq SRR18694427_2.fastq Input file: SRR18694427_1.fastq Paired file: SRR18694427_2.fastq trimmed: SRR18694427-trimmed-pair1.fastq, SRR18694427-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:34:56 2024 >> started Tue Dec 10 06:35:13 2024 >> done (16.192s) 14425764 read pairs processed; of these: 199 ( 0.00%) short read pairs filtered out after trimming by size control 1043 ( 0.01%) empty read pairs filtered out after trimming by size control 14424522 (99.99%) read pairs available; of these: 1326019 ( 9.19%) trimmed read pairs available after processing 13098503 (90.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 26 0.00% 20 19 0.00% 21 19 0.00% 22 13 0.00% 23 17 0.00% 24 26 0.00% 25 17 0.00% 26 23 0.00% 27 37 0.00% 28 38 0.00% 29 31 0.00% 30 36 0.00% 31 49 0.00% 32 48 0.00% 33 37 0.00% 34 51 0.00% 35 34 0.00% 36 51 0.00% 37 38 0.00% 38 49 0.00% 39 47 0.00% 40 38 0.00% 41 51 0.00% 42 65 0.00% 43 50 0.00% 44 46 0.00% 45 40 0.00% 46 55 0.00% 47 77 0.00% 48 58 0.00% 49 99 0.00% 50 95 0.00% 51 84 0.00% 52 103 0.00% 53 97 0.00% 54 104 0.00% 55 110 0.00% 56 130 0.00% 57 149 0.00% 58 155 0.00% 59 184 0.00% 60 220 0.00% 61 244 0.00% 62 255 0.00% 63 275 0.00% 64 324 0.00% 65 380 0.00% 66 388 0.00% 67 443 0.00% 68 453 0.00% 69 621 0.00% 70 648 0.00% 71 805 0.01% 72 819 0.01% 73 997 0.01% 74 964 0.01% 75 1205 0.01% 76 1287 0.01% 77 1403 0.01% 78 1516 0.01% 79 1704 0.01% 80 1859 0.01% 81 2161 0.01% 82 2398 0.02% 83 2583 0.02% 84 2897 0.02% 85 3053 0.02% 86 3395 0.02% 87 3538 0.02% 88 3925 0.03% 89 4221 0.03% 90 4367 0.03% 91 4859 0.03% 92 5135 0.04% 93 5598 0.04% 94 5820 0.04% 95 6468 0.04% 96 6672 0.05% 97 7105 0.05% 98 7579 0.05% 99 7911 0.05% 100 8421 0.06% 101 8453 0.06% 102 9339 0.06% 103 9744 0.07% 104 10303 0.07% 105 10452 0.07% 106 11029 0.08% 107 11675 0.08% 108 12085 0.08% 109 12370 0.09% 110 12886 0.09% 111 13515 0.09% 112 14507 0.10% 113 14669 0.10% 114 15624 0.11% 115 16106 0.11% 116 16731 0.12% 117 17492 0.12% 118 18390 0.13% 119 18546 0.13% 120 19418 0.13% 121 19980 0.14% 122 20590 0.14% 123 21639 0.15% 124 22757 0.16% 125 23348 0.16% 126 23889 0.17% 127 24700 0.17% 128 25487 0.18% 129 26257 0.18% 130 26314 0.18% 131 26977 0.19% 132 27937 0.19% 133 29004 0.20% 134 29397 0.20% 135 29983 0.21% 136 31445 0.22% 137 32011 0.22% 138 32540 0.23% 139 33980 0.24% 140 34560 0.24% 141 34868 0.24% 142 36063 0.25% 143 36329 0.25% 144 37740 0.26% 145 38727 0.27% 146 39739 0.28% 147 41383 0.29% 148 41453 0.29% 149 42473 0.29% 150 43687 0.30% 151 13098503 90.81% 14424522 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=31 prefix-density=0.35 prefix-fanout=2.3 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=374.00 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=32.2 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=30 prefix-density=0.34 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=350.09 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=15.5 sequence=CGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGA SRR18694427 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:36:00 Started mapping on | Dec 10 06:36:00 Finished on | Dec 10 06:37:51 Mapping speed, Million of reads per hour | 467.82 Number of input reads | 14424522 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13464367 Uniquely mapped reads % | 93.34% Average mapped length | 295.99 Number of splices: Total | 14623945 Number of splices: Annotated (sjdb) | 13705608 Number of splices: GT/AG | 14436253 Number of splices: GC/AG | 155928 Number of splices: AT/AC | 8764 Number of splices: Non-canonical | 23000 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.01% Deletion average length | 2.52 Insertion rate per base | 0.01% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 201858 % of reads mapped to multiple loci | 1.40% Number of reads mapped to too many loci | 26126 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.31% % of reads unmapped: other | 1.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 758297 758297 758297 N_multimapping 201858 201858 201858 N_noFeature 627240 13109991 747122 N_ambiguous 279491 1980 45544 UnstrandedReadsAssigned:12557636 PositiveStrandReadsAssigned:352396 NegativeStrandReadsAssigned:12671701 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694427 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694427-trimmed-pair1.fastq SRR18694427-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,424,522 reads, 12,873,697 reads pseudoaligned [quant] estimated average fragment length: 265.989 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52973 SRR18694427.ke.tsv 35125 SRR18694427.se.tsv 88098 total ==> SRR18694427.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 671.492 0 0 PNS24247 1044 779.011 67.304 10.5725 PNS24249 1928 1663.01 31.4105 2.31132 PNS24246 1044 779.011 67.304 10.5725 PNS24248 1044 779.011 67.304 10.5725 PNS24244 1471 1206.01 94.6775 9.60672 PNS24243 293 92.0259 0 0 KQK14069 1603 1338.01 2404.08 219.871 KQK14071 474 233.289 29.2363 15.3359 ==> SRR18694427.se.tsv <== BRADI_1g14170v3 2701 BRADI_1g53295v3 97 BRADI_1g59795v3 514 BRADI_1g07683v3 0 BRADI_1g00485v3 46 BRADI_1g20270v3 1094 BRADI_1g74790v3 179 BRADI_1g09890v3 5 BRADI_1g77505v3 160 BRADI_1g48960v3 0 SRR18694427 completed mapping pipeline successfully