Starting /dee2/code/volunteer_pipeline.sh SRR18694428 current disk space = 1525997625344 free memory = 1551127432 SRR18694428 SRAfilesize e8c630a154baa95b929b7d50bfd6e8a6 SRR18694428.sra SRR18694428.sra file validated SRR18694428 is paired end SRR18694428 is conventional basespace SRR18694428 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694428_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1255 37.0 37.0 37.0 37.0 37.0 2 35.9155 37.0 37.0 37.0 37.0 37.0 3 36.3885 37.0 37.0 37.0 37.0 37.0 4 36.521 37.0 37.0 37.0 37.0 37.0 5 36.5545 37.0 37.0 37.0 37.0 37.0 6 36.55 37.0 37.0 37.0 37.0 37.0 7 36.468 37.0 37.0 37.0 37.0 37.0 8 36.5705 37.0 37.0 37.0 37.0 37.0 9 36.503 37.0 37.0 37.0 37.0 37.0 10-14 36.6134 37.0 37.0 37.0 37.0 37.0 15-19 36.5714 37.0 37.0 37.0 37.0 37.0 20-24 36.573 37.0 37.0 37.0 37.0 37.0 25-29 36.516 37.0 37.0 37.0 37.0 37.0 30-34 36.474000000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.5966 37.0 37.0 37.0 37.0 37.0 40-44 36.524 37.0 37.0 37.0 37.0 37.0 45-49 36.3732 37.0 37.0 37.0 37.0 37.0 50-54 36.4345 37.0 37.0 37.0 37.0 37.0 55-59 36.3915 37.0 37.0 37.0 37.0 37.0 60-64 36.4083 37.0 37.0 37.0 37.0 37.0 65-69 36.1906 37.0 37.0 37.0 37.0 37.0 70-74 36.309000000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.4093 37.0 37.0 37.0 37.0 37.0 80-84 36.2938 37.0 37.0 37.0 37.0 37.0 85-89 36.054500000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.281099999999995 37.0 37.0 37.0 27.4 37.0 95-99 36.0126 37.0 37.0 37.0 37.0 37.0 100-104 36.0222 37.0 37.0 37.0 37.0 37.0 105-109 36.028200000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.074200000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.325 37.0 37.0 37.0 37.0 37.0 120-124 36.4 37.0 37.0 37.0 37.0 37.0 125-129 36.3414 37.0 37.0 37.0 37.0 37.0 130-134 36.299 37.0 37.0 37.0 37.0 37.0 135-139 36.2281 37.0 37.0 37.0 37.0 37.0 140-144 36.018600000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.9885 37.0 37.0 37.0 37.0 37.0 150-151 33.5035 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 1.0 23 0.0 24 1.0 25 0.0 26 2.0 27 9.0 28 6.0 29 8.0 30 12.0 31 26.0 32 45.0 33 65.0 34 124.0 35 367.0 36 3193.0 37 138.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.0 10.725 5.45 35.825 2 22.065491183879093 9.017632241813601 38.86649874055416 30.05037783375315 3 19.55 14.799999999999999 26.224999999999998 39.425 4 25.25 20.849999999999998 24.05 29.849999999999998 5 23.974999999999998 26.900000000000002 24.575 24.55 6 23.825 31.175000000000004 21.975 23.025000000000002 7 16.725 25.924999999999997 40.775 16.575 8 18.099999999999998 23.724999999999998 31.874999999999996 26.3 9 20.05 22.25 34.075 23.625 10-14 22.21 26.905 27.589999999999996 23.294999999999998 15-19 22.095000000000002 25.96 27.465 24.48 20-24 22.655 26.875 26.640000000000004 23.830000000000002 25-29 22.375 26.56 26.085 24.98 30-34 22.755 26.400000000000002 26.169999999999998 24.675 35-39 22.55 25.39 26.979999999999997 25.080000000000002 40-44 22.53 25.840000000000003 26.76 24.87 45-49 22.945 25.05 26.525 25.480000000000004 50-54 22.925 26.31 26.619999999999997 24.145 55-59 22.57 26.325 26.16 24.945 60-64 22.975 25.71 26.165 25.15 65-69 23.085 25.94 26.465 24.51 70-74 22.400000000000002 26.590000000000003 26.31 24.7 75-79 22.405 26.540000000000003 26.035000000000004 25.019999999999996 80-84 21.98 25.230000000000004 27.345000000000002 25.445 85-89 22.54 26.384999999999998 26.009999999999998 25.064999999999998 90-94 22.405 26.3 25.96 25.335 95-99 22.81 26.32 25.979999999999997 24.89 100-104 22.985 26.174999999999997 25.945 24.895 105-109 22.939999999999998 26.05 26.1 24.91 110-114 23.244999999999997 26.085 26.195 24.474999999999998 115-119 22.615 26.174999999999997 26.82 24.39 120-124 23.145 26.075 26.02 24.759999999999998 125-129 23.135 26.669999999999998 25.705 24.490000000000002 130-134 23.44 26.424999999999997 25.380000000000003 24.755 135-139 23.125 26.19 25.75 24.935 140-144 22.95 26.345000000000002 25.724999999999998 24.98 145-149 23.46 26.1 25.66 24.779999999999998 150-151 23.3125 25.275 24.975 26.437500000000004 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.5 15 2.0 16 1.0 17 1.0 18 3.0 19 2.5 20 1.5 21 2.5 22 3.5 23 3.5 24 5.0 25 6.5 26 9.5 27 14.0 28 15.5 29 20.0 30 24.5 31 29.5 32 29.0 33 40.5 34 61.5 35 68.0 36 77.0 37 89.5 38 97.5 39 100.5 40 112.5 41 135.5 42 153.5 43 163.5 44 176.5 45 189.0 46 196.5 47 192.0 48 184.0 49 170.5 50 148.0 51 136.5 52 132.5 53 126.5 54 108.5 55 94.5 56 85.5 57 72.5 58 63.0 59 66.0 60 60.5 61 49.5 62 44.0 63 48.5 64 52.0 65 48.5 66 50.0 67 53.0 68 46.5 69 30.0 70 25.0 71 24.0 72 15.5 73 8.0 74 8.0 75 6.5 76 4.5 77 2.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.75 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.15 #Duplication Level Percentage of deduplicated Percentage of total 1 88.20998278829603 76.875 2 9.81067125645439 17.1 3 1.4916810097532989 3.9 4 0.3729202524383247 1.3 5 0.028686173264486515 0.125 6 0.028686173264486515 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05737234652897303 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTCAGCATGATCCTCAAAACTGAAAGAAACAGGTTCATCTTGCACAGT 11 0.27499999999999997 No Hit GTCGCCATGGAGGTTGCTGAGGCCGTAGCCCTCGAACTGGCAGATGAGCG 11 0.27499999999999997 No Hit CCAGAGTTGGTCTCAGGGAAGACCCAACGGTCCGTCTGAGGCTTGATGGT 6 0.15 No Hit CTCACATGATGTTGAACCACCAGGTAGAAGACGCTGAACAACCGCTGGTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.38749999999999996 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.075 0.0 0.0 0.0 0.0 116-117 2.5625 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.3125 0.0 0.0 0.0 0.0 122-123 3.6375 0.0 0.0 0.0 0.0 124-125 4.0625 0.0 0.0 0.0 0.0 126-127 4.35 0.0 0.0 0.0 0.0 128-129 4.737500000000001 0.0 0.0 0.0 0.0 130-131 5.2625 0.0 0.0 0.0 0.0 132-133 5.8875 0.0 0.0 0.0 0.0 134-135 6.4625 0.0 0.0 0.0 0.0 136-137 6.825 0.0 0.0 0.0 0.0 138-139 7.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGCAC 10 0.006830828 145.0 2 ACGTCTG 20 0.00593511 29.0 130-134 CACGTCT 20 0.00593511 29.0 130-134 TGAACTC 20 0.00593511 29.0 135-139 >>END_MODULE SRR18694428 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694428_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.876 37.0 37.0 37.0 25.0 37.0 2 34.361 37.0 37.0 37.0 25.0 37.0 3 34.775 37.0 37.0 37.0 25.0 37.0 4 34.923 37.0 37.0 37.0 25.0 37.0 5 34.75 37.0 37.0 37.0 25.0 37.0 6 34.888 37.0 37.0 37.0 25.0 37.0 7 34.908 37.0 37.0 37.0 25.0 37.0 8 35.468 37.0 37.0 37.0 37.0 37.0 9 35.3235 37.0 37.0 37.0 25.0 37.0 10-14 35.4242 37.0 37.0 37.0 37.0 37.0 15-19 35.4341 37.0 37.0 37.0 32.2 37.0 20-24 35.1968 37.0 37.0 37.0 27.4 37.0 25-29 35.3871 37.0 37.0 37.0 32.2 37.0 30-34 35.6126 37.0 37.0 37.0 37.0 37.0 35-39 35.431599999999996 37.0 37.0 37.0 32.2 37.0 40-44 35.1171 37.0 37.0 37.0 29.8 37.0 45-49 35.3771 37.0 37.0 37.0 34.6 37.0 50-54 34.7534 37.0 37.0 37.0 27.0 37.0 55-59 34.1334 37.0 37.0 37.0 25.0 37.0 60-64 34.85080000000001 37.0 37.0 37.0 27.4 37.0 65-69 34.15560000000001 37.0 34.6 37.0 27.4 37.0 70-74 33.0456 37.0 29.8 37.0 22.2 37.0 75-79 33.5738 37.0 34.6 37.0 22.2 37.0 80-84 34.4206 37.0 37.0 37.0 25.0 37.0 85-89 32.4533 37.0 32.2 37.0 19.4 37.0 90-94 33.95890000000001 37.0 37.0 37.0 25.0 37.0 95-99 33.7884 37.0 37.0 37.0 25.0 37.0 100-104 33.2581 37.0 37.0 37.0 25.0 37.0 105-109 34.02569999999999 37.0 37.0 37.0 25.0 37.0 110-114 34.2692 37.0 37.0 37.0 25.0 37.0 115-119 34.2935 37.0 37.0 37.0 25.0 37.0 120-124 33.7885 37.0 37.0 37.0 25.0 37.0 125-129 33.6759 37.0 37.0 37.0 25.0 37.0 130-134 33.468 37.0 34.6 37.0 25.0 37.0 135-139 31.8772 37.0 25.0 37.0 13.8 37.0 140-144 31.3502 37.0 25.0 37.0 11.0 37.0 145-149 30.9818 37.0 25.0 37.0 11.0 37.0 150-151 30.46275 37.0 25.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 2.0 18 4.0 19 6.0 20 5.0 21 3.0 22 1.0 23 7.0 24 6.0 25 15.0 26 11.0 27 23.0 28 31.0 29 59.0 30 87.0 31 185.0 32 317.0 33 609.0 34 1146.0 35 1292.0 36 190.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.175000000000004 21.25 8.625 27.950000000000003 2 28.575 24.625 29.549999999999997 17.25 3 21.875 25.2 31.5 21.425 4 25.825 30.7 21.625 21.85 5 28.075 34.875 19.55 17.5 6 22.8 36.375 20.424999999999997 20.4 7 22.475 21.15 34.2 22.175 8 21.725 23.849999999999998 25.825 28.599999999999998 9 22.8 21.475 29.625 26.1 10-14 24.92 26.405 24.58 24.095 15-19 24.995 26.525 24.935 23.544999999999998 20-24 24.425 26.685 25.195 23.695 25-29 24.83 26.19 24.97 24.01 30-34 24.95 25.900000000000002 25.695 23.455000000000002 35-39 25.564999999999998 26.229999999999997 25.240000000000002 22.965 40-44 25.41 26.33 24.97 23.29 45-49 25.224999999999998 25.77 25.655 23.35 50-54 23.605 26.229999999999997 26.685 23.48 55-59 24.9 26.445 25.405 23.25 60-64 25.074999999999996 26.51 25.97 22.445 65-69 25.480000000000004 26.25 24.935 23.335 70-74 25.540000000000003 25.650000000000002 25.619999999999997 23.189999999999998 75-79 26.345000000000002 24.779999999999998 25.94 22.935 80-84 25.035 26.745 25.395 22.825 85-89 22.085 29.549999999999997 25.395 22.97 90-94 25.235000000000003 25.979999999999997 25.330000000000002 23.455000000000002 95-99 24.945 26.58 25.380000000000003 23.095 100-104 25.345000000000002 26.419999999999998 25.465 22.770000000000003 105-109 25.330000000000002 26.369999999999997 25.490000000000002 22.81 110-114 24.895 26.77 25.629999999999995 22.705000000000002 115-119 25.330000000000002 26.565 25.35 22.755 120-124 25.75 26.005 26.179999999999996 22.065 125-129 25.55 26.555 25.765 22.13 130-134 25.705 26.595000000000002 25.705 21.995 135-139 25.635 26.555 25.724999999999998 22.085 140-144 25.929999999999996 26.76 24.91 22.400000000000002 145-149 26.290000000000003 26.900000000000002 25.0 21.81 150-151 24.25 25.650000000000002 28.249999999999996 21.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 2.0 18 3.0 19 3.5 20 5.5 21 6.5 22 6.0 23 7.5 24 6.5 25 6.5 26 11.0 27 19.0 28 27.0 29 25.0 30 26.0 31 34.0 32 40.5 33 46.5 34 46.5 35 54.0 36 75.5 37 80.5 38 86.5 39 92.0 40 106.0 41 136.0 42 143.0 43 151.5 44 162.0 45 177.0 46 180.0 47 164.0 48 161.0 49 153.0 50 146.5 51 142.5 52 119.0 53 118.5 54 122.5 55 103.0 56 98.5 57 80.5 58 70.0 59 73.5 60 76.0 61 74.0 62 59.5 63 58.5 64 57.0 65 50.0 66 43.5 67 37.5 68 41.0 69 47.5 70 36.5 71 27.0 72 22.5 73 11.5 74 8.0 75 9.5 76 8.5 77 4.5 78 2.5 79 1.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.75 #Duplication Level Percentage of deduplicated Percentage of total 1 89.77464788732394 79.675 2 8.507042253521128 15.1 3 1.4084507042253522 3.75 4 0.22535211267605634 0.8 5 0.028169014084507043 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.056338028169014086 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTGCTGATGTCGATGATGATGAGGATGACGAGTGAAGAGTGTAGTCTCT 11 0.27499999999999997 No Hit ATTTAATTTTGGCAGGTCCTAAGCATCTGATCTGGTTCGGGACCAAGGCG 11 0.27499999999999997 No Hit CTTATGAGGGCTACTGATGTTATGATTGCTGGCAAGGTTGCCGTGGTCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.0875 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.9624999999999999 0.0 0.0 0.0 0.0 104-105 1.1749999999999998 0.0 0.0 0.0 0.0 106-107 1.325 0.0 0.0 0.0 0.0 108-109 1.4874999999999998 0.0 0.0 0.0 0.0 110-111 1.7 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.0999999999999996 0.0 0.0 0.0 0.0 116-117 2.5875 0.0 0.0 0.0 0.0 118-119 3.0125 0.0 0.0 0.0 0.0 120-121 3.3375000000000004 0.0 0.0 0.0 0.0 122-123 3.6624999999999996 0.0 0.0 0.0 0.0 124-125 4.0625 0.0 0.0 0.0 0.0 126-127 4.35 0.0 0.0 0.0 0.0 128-129 4.737500000000001 0.0 0.0 0.0 0.0 130-131 5.2375 0.0 0.0 0.0 0.0 132-133 5.8625 0.0 0.0 0.0 0.0 134-135 6.4125 0.0 0.0 0.0 0.0 136-137 6.775 0.0 0.0 0.0 0.0 138-139 7.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGAAA 10 0.006830828 145.0 5 TCGTGTA 20 0.00593511 29.0 130-134 AGGGAAA 20 0.00593511 29.0 135-139 CGTGTAG 20 0.00593511 29.0 130-134 >>END_MODULE Read 1062599 spots for SRR18694428.sra Written 1062599 spots for SRR18694428.sra Read 1062599 spots for SRR18694428.sra Written 1062599 spots for SRR18694428.sra Read 1062599 spots for SRR18694428.sra Written 1062599 spots for SRR18694428.sra Read 1062599 spots for SRR18694428.sra Written 1062599 spots for SRR18694428.sra Read 1062599 spots for SRR18694428.sra Written 1062599 spots for SRR18694428.sra Read 1062599 spots for SRR18694428.sra Written 1062599 spots for SRR18694428.sra Read 1062599 spots for SRR18694428.sra Written 1062599 spots for SRR18694428.sra Read 1062599 spots for SRR18694428.sra Written 1062599 spots for SRR18694428.sra Read 1062599 spots for SRR18694428.sra Written 1062599 spots for SRR18694428.sra Read 1062599 spots for SRR18694428.sra Written 1062599 spots for SRR18694428.sra Read 1062599 spots for SRR18694428.sra Written 1062599 spots for SRR18694428.sra Read 1062599 spots for SRR18694428.sra Written 1062599 spots for SRR18694428.sra Read 1062599 spots for SRR18694428.sra Written 1062599 spots for SRR18694428.sra Read 1062599 spots for SRR18694428.sra Written 1062599 spots for SRR18694428.sra Read 1062599 spots for SRR18694428.sra Written 1062599 spots for SRR18694428.sra Read 1062614 spots for SRR18694428.sra Written 1062614 spots for SRR18694428.sra Read 1062599 spots for SRR18694428.sra Written 1062599 spots for SRR18694428.sra Read 1062599 spots for SRR18694428.sra Written 1062599 spots for SRR18694428.sra Read 1062599 spots for SRR18694428.sra Written 1062599 spots for SRR18694428.sra Read 1062599 spots for SRR18694428.sra Written 1062599 spots for SRR18694428.sra SRR ids: ['SRR18694428.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iylj1q7u SRR18694428.sra spots: 21251995 blocks: [[1, 1062599], [1062600, 2125198], [2125199, 3187797], [3187798, 4250396], [4250397, 5312995], [5312996, 6375594], [6375595, 7438193], [7438194, 8500792], [8500793, 9563391], [9563392, 10625990], [10625991, 11688589], [11688590, 12751188], [12751189, 13813787], [13813788, 14876386], [14876387, 15938985], [15938986, 17001584], [17001585, 18064183], [18064184, 19126782], [19126783, 20189381], [20189382, 21251995]] SRR18694428 file size 7200657 SRR18694428 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694428 SRR18694428_1.fastq SRR18694428_2.fastq Input file: SRR18694428_1.fastq Paired file: SRR18694428_2.fastq trimmed: SRR18694428-trimmed-pair1.fastq, SRR18694428-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:37:18 2024 >> started Tue Dec 10 06:37:42 2024 >> done (24.072s) 21251995 read pairs processed; of these: 252 ( 0.00%) short read pairs filtered out after trimming by size control 5090 ( 0.02%) empty read pairs filtered out after trimming by size control 21246653 (99.97%) read pairs available; of these: 2662476 (12.53%) trimmed read pairs available after processing 18584177 (87.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 33 0.00% 20 28 0.00% 21 39 0.00% 22 35 0.00% 23 43 0.00% 24 50 0.00% 25 38 0.00% 26 33 0.00% 27 62 0.00% 28 62 0.00% 29 80 0.00% 30 80 0.00% 31 69 0.00% 32 82 0.00% 33 76 0.00% 34 82 0.00% 35 84 0.00% 36 71 0.00% 37 97 0.00% 38 96 0.00% 39 99 0.00% 40 96 0.00% 41 123 0.00% 42 112 0.00% 43 119 0.00% 44 184 0.00% 45 100 0.00% 46 120 0.00% 47 158 0.00% 48 150 0.00% 49 152 0.00% 50 138 0.00% 51 160 0.00% 52 181 0.00% 53 197 0.00% 54 200 0.00% 55 199 0.00% 56 229 0.00% 57 272 0.00% 58 307 0.00% 59 337 0.00% 60 348 0.00% 61 446 0.00% 62 450 0.00% 63 523 0.00% 64 545 0.00% 65 573 0.00% 66 614 0.00% 67 753 0.00% 68 821 0.00% 69 917 0.00% 70 1029 0.00% 71 1233 0.01% 72 1340 0.01% 73 1608 0.01% 74 1705 0.01% 75 1880 0.01% 76 2149 0.01% 77 2304 0.01% 78 2716 0.01% 79 2904 0.01% 80 3159 0.01% 81 3714 0.02% 82 4291 0.02% 83 4724 0.02% 84 5137 0.02% 85 5795 0.03% 86 6194 0.03% 87 6621 0.03% 88 7506 0.04% 89 7834 0.04% 90 8722 0.04% 91 9711 0.05% 92 10246 0.05% 93 11020 0.05% 94 11869 0.06% 95 12824 0.06% 96 13277 0.06% 97 14617 0.07% 98 15331 0.07% 99 16187 0.08% 100 17327 0.08% 101 18298 0.09% 102 19054 0.09% 103 20407 0.10% 104 21704 0.10% 105 22606 0.11% 106 23478 0.11% 107 24759 0.12% 108 25594 0.12% 109 26504 0.12% 110 27862 0.13% 111 28800 0.14% 112 30572 0.14% 113 31862 0.15% 114 33254 0.16% 115 34850 0.16% 116 35836 0.17% 117 36772 0.17% 118 37948 0.18% 119 39307 0.19% 120 40566 0.19% 121 42098 0.20% 122 43454 0.20% 123 45841 0.22% 124 47562 0.22% 125 47774 0.22% 126 49684 0.23% 127 50563 0.24% 128 51612 0.24% 129 53339 0.25% 130 53944 0.25% 131 55333 0.26% 132 57374 0.27% 133 58087 0.27% 134 59440 0.28% 135 61360 0.29% 136 63895 0.30% 137 64159 0.30% 138 65482 0.31% 139 66961 0.32% 140 67507 0.32% 141 68277 0.32% 142 70979 0.33% 143 71749 0.34% 144 73105 0.34% 145 74360 0.35% 146 75961 0.36% 147 77758 0.37% 148 78794 0.37% 149 79077 0.37% 150 81060 0.38% 151 18584177 87.47% 21246653 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=28 prefix-density=0.15 prefix-fanout=2.4 sequence=GCCAAAGATGTATA criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=141.44 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=18.5 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=28 prefix-density=0.51 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=966.23 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=20.0 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR18694428 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:38:58 Started mapping on | Dec 10 06:38:58 Finished on | Dec 10 06:50:36 Mapping speed, Million of reads per hour | 109.58 Number of input reads | 21246653 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16878518 Uniquely mapped reads % | 79.44% Average mapped length | 294.49 Number of splices: Total | 17908124 Number of splices: Annotated (sjdb) | 16816696 Number of splices: GT/AG | 17666342 Number of splices: GC/AG | 203069 Number of splices: AT/AC | 11182 Number of splices: Non-canonical | 27531 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.01% Deletion average length | 2.57 Insertion rate per base | 0.01% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 218514 % of reads mapped to multiple loci | 1.03% Number of reads mapped to too many loci | 47260 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 16.87% % of reads unmapped: other | 2.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4149621 4149621 4149621 N_multimapping 218514 218514 218514 N_noFeature 659956 16476387 790013 N_ambiguous 317002 2033 45432 UnstrandedReadsAssigned:15901560 PositiveStrandReadsAssigned:400098 NegativeStrandReadsAssigned:16043073 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694428 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694428-trimmed-pair1.fastq SRR18694428-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,246,653 reads, 16,324,562 reads pseudoaligned [quant] estimated average fragment length: 253.618 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52973 SRR18694428.ke.tsv 35125 SRR18694428.se.tsv 88098 total ==> SRR18694428.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 683.793 0 0 PNS24247 1044 791.382 66.6277 7.56182 PNS24249 1928 1675.38 52.6014 2.81995 PNS24246 1044 791.382 66.6277 7.56182 PNS24248 1044 791.382 66.6277 7.56182 PNS24244 1471 1218.38 103.515 7.63096 PNS24243 293 98.4744 0 0 KQK14069 1603 1350.38 2542.1 169.08 KQK14071 474 242.498 33.5921 12.4419 ==> SRR18694428.se.tsv <== BRADI_1g14170v3 2777 BRADI_1g53295v3 45 BRADI_1g59795v3 347 BRADI_1g07683v3 0 BRADI_1g00485v3 32 BRADI_1g20270v3 626 BRADI_1g74790v3 79 BRADI_1g09890v3 0 BRADI_1g77505v3 126 BRADI_1g48960v3 0 SRR18694428 completed mapping pipeline successfully