Starting /dee2/code/volunteer_pipeline.sh SRR18694429 current disk space = 1526041993216 free memory = 1559696400 SRR18694429 SRAfilesize d80fb9aa999bff8eb505c1e36710155c SRR18694429.sra SRR18694429.sra file validated SRR18694429 is paired end SRR18694429 is conventional basespace SRR18694429 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694429_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0875 37.0 37.0 37.0 37.0 37.0 2 36.062 37.0 37.0 37.0 37.0 37.0 3 36.47 37.0 37.0 37.0 37.0 37.0 4 36.5785 37.0 37.0 37.0 37.0 37.0 5 36.528 37.0 37.0 37.0 37.0 37.0 6 36.548 37.0 37.0 37.0 37.0 37.0 7 36.5965 37.0 37.0 37.0 37.0 37.0 8 36.5825 37.0 37.0 37.0 37.0 37.0 9 36.614 37.0 37.0 37.0 37.0 37.0 10-14 36.6356 37.0 37.0 37.0 37.0 37.0 15-19 36.5991 37.0 37.0 37.0 37.0 37.0 20-24 36.6323 37.0 37.0 37.0 37.0 37.0 25-29 36.544 37.0 37.0 37.0 37.0 37.0 30-34 36.5135 37.0 37.0 37.0 37.0 37.0 35-39 36.663799999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.602500000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.364599999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.4702 37.0 37.0 37.0 37.0 37.0 55-59 36.4567 37.0 37.0 37.0 37.0 37.0 60-64 36.4702 37.0 37.0 37.0 37.0 37.0 65-69 36.279399999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.398399999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.470299999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.3438 37.0 37.0 37.0 37.0 37.0 85-89 36.1452 37.0 37.0 37.0 37.0 37.0 90-94 35.3153 37.0 37.0 37.0 29.8 37.0 95-99 36.082300000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.0702 37.0 37.0 37.0 37.0 37.0 105-109 36.1096 37.0 37.0 37.0 37.0 37.0 110-114 36.202799999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.3865 37.0 37.0 37.0 37.0 37.0 120-124 36.4975 37.0 37.0 37.0 37.0 37.0 125-129 36.4401 37.0 37.0 37.0 37.0 37.0 130-134 36.41609999999999 37.0 37.0 37.0 37.0 37.0 135-139 36.3137 37.0 37.0 37.0 37.0 37.0 140-144 36.1323 37.0 37.0 37.0 37.0 37.0 145-149 36.0801 37.0 37.0 37.0 37.0 37.0 150-151 33.638 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 1.0 23 0.0 24 3.0 25 3.0 26 3.0 27 3.0 28 3.0 29 5.0 30 12.0 31 16.0 32 22.0 33 63.0 34 131.0 35 330.0 36 3239.0 37 165.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.525 11.15 6.225 38.1 2 21.023582538886103 9.959859508278976 38.3843452082288 30.632212744606118 3 18.475 13.775 26.724999999999998 41.025 4 23.400000000000002 21.825 23.5 31.275 5 26.174999999999997 27.250000000000004 23.925 22.650000000000002 6 23.125 31.85 22.2 22.825 7 17.125 26.3 40.65 15.925 8 17.8 25.575 31.924999999999997 24.7 9 19.45 21.325 36.125 23.1 10-14 22.465 27.99 26.43 23.115 15-19 22.189999999999998 25.495 27.224999999999998 25.09 20-24 22.29 26.290000000000003 26.529999999999998 24.89 25-29 22.555 25.75 26.540000000000003 25.155 30-34 22.505 25.485000000000003 26.265 25.745 35-39 22.105 25.64 26.905 25.35 40-44 22.325 25.665 26.615 25.395 45-49 23.125 25.3 26.724999999999998 24.85 50-54 22.68 26.555 25.985000000000003 24.779999999999998 55-59 22.689999999999998 25.705 26.13 25.474999999999998 60-64 22.62 25.905 26.005 25.47 65-69 21.709999999999997 26.295 26.845000000000002 25.15 70-74 22.705000000000002 25.740000000000002 26.545 25.009999999999998 75-79 22.785 25.540000000000003 26.19 25.485000000000003 80-84 23.11 25.31 26.32 25.259999999999998 85-89 23.14 25.88 25.474999999999998 25.505 90-94 22.99 25.765 26.19 25.055 95-99 23.365 26.165 25.775 24.695 100-104 23.335 25.06 26.290000000000003 25.314999999999998 105-109 22.89 25.825 25.775 25.509999999999998 110-114 22.735 25.745 26.32 25.2 115-119 23.035 25.629999999999995 26.3 25.035 120-124 23.53 25.97 25.915 24.585 125-129 23.919999999999998 25.835 25.47 24.775 130-134 23.345 26.525 25.624999999999996 24.505 135-139 23.044999999999998 26.14 24.93 25.885 140-144 23.3 25.900000000000002 25.61 25.19 145-149 23.580000000000002 25.765 25.215 25.44 150-151 23.3625 25.8125 24.4125 26.4125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.5 18 1.0 19 2.5 20 3.5 21 3.0 22 4.0 23 3.0 24 2.0 25 4.0 26 8.0 27 12.5 28 12.0 29 11.0 30 12.0 31 20.5 32 36.5 33 46.0 34 51.0 35 58.5 36 61.5 37 64.0 38 77.5 39 101.5 40 114.5 41 118.0 42 148.0 43 189.0 44 190.5 45 184.0 46 202.0 47 200.0 48 187.5 49 183.0 50 177.0 51 176.5 52 149.5 53 119.5 54 115.5 55 103.0 56 93.5 57 85.0 58 71.0 59 58.5 60 52.5 61 56.0 62 54.0 63 49.5 64 48.5 65 51.0 66 42.5 67 34.0 68 31.5 69 22.0 70 16.0 71 17.0 72 16.0 73 12.0 74 11.0 75 7.0 76 4.5 77 5.5 78 3.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.0 #Duplication Level Percentage of deduplicated Percentage of total 1 88.29545454545455 77.7 2 10.02840909090909 17.65 3 1.4488636363636362 3.8249999999999997 4 0.19886363636363635 0.7000000000000001 5 0.028409090909090908 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTATCATATGAGATGCACCAGCACCACCCTCCTCAGCAGGTTGGAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.65 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.3499999999999996 0.0 0.0 0.0 0.0 116-117 2.5125 0.0 0.0 0.0 0.0 118-119 2.8375 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.7875 0.0 0.0 0.0 0.0 124-125 4.199999999999999 0.0 0.0 0.0 0.0 126-127 4.5375 0.0 0.0 0.0 0.0 128-129 4.9625 0.0 0.0 0.0 0.0 130-131 5.2625 0.0 0.0 0.0 0.0 132-133 5.8 0.0 0.0 0.0 0.0 134-135 6.35 0.0 0.0 0.0 0.0 136-137 6.7625 0.0 0.0 0.0 0.0 138-139 7.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGAGAC 10 0.006830828 145.0 7 ATCGTCT 10 0.006830828 145.0 9 TTTTTTT 20 0.00593511 29.0 60-64 >>END_MODULE SRR18694429 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694429_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.293 37.0 37.0 37.0 25.0 37.0 2 35.1425 37.0 37.0 37.0 25.0 37.0 3 35.243 37.0 37.0 37.0 25.0 37.0 4 35.354 37.0 37.0 37.0 37.0 37.0 5 35.249 37.0 37.0 37.0 25.0 37.0 6 35.3365 37.0 37.0 37.0 37.0 37.0 7 35.1215 37.0 37.0 37.0 25.0 37.0 8 35.379 37.0 37.0 37.0 37.0 37.0 9 35.6435 37.0 37.0 37.0 37.0 37.0 10-14 35.6028 37.0 37.0 37.0 37.0 37.0 15-19 35.688300000000005 37.0 37.0 37.0 37.0 37.0 20-24 35.3938 37.0 37.0 37.0 34.6 37.0 25-29 35.54109999999999 37.0 37.0 37.0 32.2 37.0 30-34 35.7836 37.0 37.0 37.0 37.0 37.0 35-39 35.5689 37.0 37.0 37.0 37.0 37.0 40-44 35.3374 37.0 37.0 37.0 29.8 37.0 45-49 35.5372 37.0 37.0 37.0 37.0 37.0 50-54 35.0206 37.0 37.0 37.0 32.2 37.0 55-59 34.380700000000004 37.0 37.0 37.0 25.0 37.0 60-64 35.049400000000006 37.0 37.0 37.0 27.4 37.0 65-69 34.2445 37.0 34.6 37.0 27.4 37.0 70-74 33.0229 37.0 29.8 37.0 22.2 37.0 75-79 33.566199999999995 37.0 34.6 37.0 22.2 37.0 80-84 34.5481 37.0 37.0 37.0 25.0 37.0 85-89 32.6744 37.0 32.2 37.0 19.4 37.0 90-94 34.031800000000004 37.0 37.0 37.0 25.0 37.0 95-99 33.7968 37.0 37.0 37.0 25.0 37.0 100-104 33.326 37.0 34.6 37.0 25.0 37.0 105-109 34.1637 37.0 37.0 37.0 25.0 37.0 110-114 34.47109999999999 37.0 37.0 37.0 25.0 37.0 115-119 34.4661 37.0 37.0 37.0 25.0 37.0 120-124 33.996 37.0 37.0 37.0 25.0 37.0 125-129 33.9738 37.0 37.0 37.0 25.0 37.0 130-134 33.7695 37.0 37.0 37.0 25.0 37.0 135-139 32.195899999999995 37.0 27.4 37.0 13.8 37.0 140-144 31.599399999999996 37.0 25.0 37.0 11.0 37.0 145-149 31.2235 37.0 25.0 37.0 11.0 37.0 150-151 30.81 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 1.0 18 1.0 19 1.0 20 0.0 21 5.0 22 5.0 23 6.0 24 6.0 25 11.0 26 15.0 27 20.0 28 27.0 29 46.0 30 85.0 31 131.0 32 266.0 33 561.0 34 1196.0 35 1400.0 36 216.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.2 21.4 8.450000000000001 29.95 2 30.525000000000002 23.3 28.275 17.9 3 20.225 25.525 30.875000000000004 23.375 4 26.05 31.55 20.474999999999998 21.925 5 27.400000000000002 34.25 18.6 19.75 6 22.975 37.275000000000006 19.025 20.724999999999998 7 22.475 21.099999999999998 34.625 21.8 8 21.425 23.75 26.224999999999998 28.599999999999998 9 23.025000000000002 22.025 28.975 25.974999999999998 10-14 25.009999999999998 27.07 23.985 23.935000000000002 15-19 24.89 25.919999999999998 24.79 24.4 20-24 25.174999999999997 26.61 24.505 23.71 25-29 24.705 25.595000000000002 26.305 23.395 30-34 25.05 26.16 24.925 23.865 35-39 25.305 26.44 24.725 23.53 40-44 25.695 25.645 25.224999999999998 23.435 45-49 25.395 25.77 25.14 23.695 50-54 23.925 26.119999999999997 26.235000000000003 23.72 55-59 25.145 26.825 24.15 23.880000000000003 60-64 25.230000000000004 25.924999999999997 25.71 23.135 65-69 25.935000000000002 25.619999999999997 25.145 23.3 70-74 25.905 25.21 25.485000000000003 23.400000000000002 75-79 26.63 24.555 25.685000000000002 23.13 80-84 25.224999999999998 27.034999999999997 24.585 23.155 85-89 22.875 28.735 24.745 23.645 90-94 25.19 26.265 24.9 23.645 95-99 26.224999999999998 26.33 24.165 23.28 100-104 26.015 26.400000000000002 24.795 22.79 105-109 25.365 25.96 25.564999999999998 23.11 110-114 25.995 26.575 24.535 22.895 115-119 25.845000000000002 26.155 24.884999999999998 23.115 120-124 26.36 25.624999999999996 25.88 22.134999999999998 125-129 25.47 26.529999999999998 25.590000000000003 22.41 130-134 26.435 26.305 25.130000000000003 22.13 135-139 25.81 26.474999999999998 25.074999999999996 22.64 140-144 26.445 26.584999999999997 24.765 22.205 145-149 27.015 26.555 24.895 21.535 150-151 24.7 26.1125 28.125 21.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 1.0 12 0.5 13 0.5 14 1.0 15 1.0 16 0.5 17 2.0 18 3.0 19 3.0 20 2.5 21 1.5 22 4.0 23 5.5 24 5.0 25 4.0 26 5.5 27 6.5 28 9.0 29 15.0 30 16.5 31 21.5 32 29.5 33 34.0 34 47.5 35 62.0 36 63.5 37 74.0 38 86.0 39 102.0 40 111.0 41 121.5 42 147.5 43 179.5 44 189.5 45 186.0 46 183.0 47 174.0 48 167.0 49 152.5 50 134.0 51 123.0 52 127.0 53 124.5 54 116.0 55 107.5 56 107.0 57 100.0 58 86.0 59 75.0 60 71.5 61 67.5 62 59.0 63 60.5 64 60.5 65 57.0 66 51.0 67 42.0 68 40.0 69 39.5 70 38.0 71 30.0 72 16.0 73 11.0 74 10.0 75 8.5 76 6.0 77 2.5 78 2.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.375 #Duplication Level Percentage of deduplicated Percentage of total 1 89.62237762237763 80.10000000000001 2 9.062937062937063 16.2 3 1.1468531468531469 3.075 4 0.13986013986013987 0.5 5 0.027972027972027972 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAGAATTGACGGTGTGATGCACGCCTGTGGTCATGATGTGCACACCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2125 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.36250000000000004 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.1124999999999998 0.0 0.0 0.0 0.0 104-105 1.3250000000000002 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.575 0.0 0.0 0.0 0.0 110-111 1.7375 0.0 0.0 0.0 0.0 112-113 1.9375 0.0 0.0 0.0 0.0 114-115 2.2750000000000004 0.0 0.0 0.0 0.0 116-117 2.4375 0.0 0.0 0.0 0.0 118-119 2.7375 0.0 0.0 0.0 0.0 120-121 3.2625 0.0 0.0 0.0 0.0 122-123 3.6625 0.0 0.0 0.0 0.0 124-125 4.075 0.0 0.0 0.0 0.0 126-127 4.4125 0.0 0.0 0.0 0.0 128-129 4.8375 0.0 0.0 0.0 0.0 130-131 5.1375 0.0 0.0 0.0 0.0 132-133 5.675 0.0 0.0 0.0 0.0 134-135 6.225 0.0 0.0 0.0 0.0 136-137 6.6375 0.0 0.0 0.0 0.0 138-139 7.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGGCCA 10 0.006830828 145.0 8 >>END_MODULE Read 624225 spots for SRR18694429.sra Written 624225 spots for SRR18694429.sra Read 624225 spots for SRR18694429.sra Written 624225 spots for SRR18694429.sra Read 624225 spots for SRR18694429.sra Written 624225 spots for SRR18694429.sra Read 624225 spots for SRR18694429.sra Written 624225 spots for SRR18694429.sra Read 624225 spots for SRR18694429.sra Written 624225 spots for SRR18694429.sra Read 624225 spots for SRR18694429.sra Written 624225 spots for SRR18694429.sra Read 624225 spots for SRR18694429.sra Written 624225 spots for SRR18694429.sra Read 624225 spots for SRR18694429.sra Written 624225 spots for SRR18694429.sra Read 624225 spots for SRR18694429.sra Written 624225 spots for SRR18694429.sra Read 624225 spots for SRR18694429.sra Written 624225 spots for SRR18694429.sra Read 624225 spots for SRR18694429.sra Written 624225 spots for SRR18694429.sra Read 624225 spots for SRR18694429.sra Written 624225 spots for SRR18694429.sra Read 624225 spots for SRR18694429.sra Written 624225 spots for SRR18694429.sra Read 624225 spots for SRR18694429.sra Written 624225 spots for SRR18694429.sra Read 624225 spots for SRR18694429.sra Written 624225 spots for SRR18694429.sra Read 624241 spots for SRR18694429.sra Written 624241 spots for SRR18694429.sra Read 624225 spots for SRR18694429.sra Written 624225 spots for SRR18694429.sra Read 624225 spots for SRR18694429.sra Written 624225 spots for SRR18694429.sra Read 624225 spots for SRR18694429.sra Written 624225 spots for SRR18694429.sra Read 624225 spots for SRR18694429.sra Written 624225 spots for SRR18694429.sra SRR ids: ['SRR18694429.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ab3z6i6g SRR18694429.sra spots: 12484516 blocks: [[1, 624225], [624226, 1248450], [1248451, 1872675], [1872676, 2496900], [2496901, 3121125], [3121126, 3745350], [3745351, 4369575], [4369576, 4993800], [4993801, 5618025], [5618026, 6242250], [6242251, 6866475], [6866476, 7490700], [7490701, 8114925], [8114926, 8739150], [8739151, 9363375], [9363376, 9987600], [9987601, 10611825], [10611826, 11236050], [11236051, 11860275], [11860276, 12484516]] SRR18694429 file size 4221084 SRR18694429 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694429 SRR18694429_1.fastq SRR18694429_2.fastq Input file: SRR18694429_1.fastq Paired file: SRR18694429_2.fastq trimmed: SRR18694429-trimmed-pair1.fastq, SRR18694429-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:40:36 2024 >> started Tue Dec 10 06:42:11 2024 >> done (95.330s) 12484516 read pairs processed; of these: 111 ( 0.00%) short read pairs filtered out after trimming by size control 2878 ( 0.02%) empty read pairs filtered out after trimming by size control 12481527 (99.98%) read pairs available; of these: 1284472 (10.29%) trimmed read pairs available after processing 11197055 (89.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 9 0.00% 20 15 0.00% 21 19 0.00% 22 13 0.00% 23 18 0.00% 24 23 0.00% 25 34 0.00% 26 28 0.00% 27 30 0.00% 28 31 0.00% 29 34 0.00% 30 35 0.00% 31 43 0.00% 32 42 0.00% 33 42 0.00% 34 36 0.00% 35 46 0.00% 36 50 0.00% 37 55 0.00% 38 56 0.00% 39 47 0.00% 40 46 0.00% 41 38 0.00% 42 57 0.00% 43 69 0.00% 44 64 0.00% 45 53 0.00% 46 65 0.00% 47 70 0.00% 48 64 0.00% 49 65 0.00% 50 86 0.00% 51 79 0.00% 52 101 0.00% 53 102 0.00% 54 81 0.00% 55 112 0.00% 56 113 0.00% 57 113 0.00% 58 154 0.00% 59 181 0.00% 60 210 0.00% 61 181 0.00% 62 262 0.00% 63 299 0.00% 64 283 0.00% 65 320 0.00% 66 323 0.00% 67 358 0.00% 68 423 0.00% 69 513 0.00% 70 613 0.00% 71 636 0.01% 72 793 0.01% 73 753 0.01% 74 923 0.01% 75 985 0.01% 76 1069 0.01% 77 1147 0.01% 78 1289 0.01% 79 1560 0.01% 80 1669 0.01% 81 1788 0.01% 82 2151 0.02% 83 2406 0.02% 84 2538 0.02% 85 2742 0.02% 86 3021 0.02% 87 3387 0.03% 88 3514 0.03% 89 3793 0.03% 90 4058 0.03% 91 4629 0.04% 92 4777 0.04% 93 5208 0.04% 94 5714 0.05% 95 6168 0.05% 96 6301 0.05% 97 6601 0.05% 98 7134 0.06% 99 7455 0.06% 100 7963 0.06% 101 8296 0.07% 102 8698 0.07% 103 9392 0.08% 104 10131 0.08% 105 10123 0.08% 106 10738 0.09% 107 11309 0.09% 108 11281 0.09% 109 11968 0.10% 110 12307 0.10% 111 13120 0.11% 112 14005 0.11% 113 14253 0.11% 114 15523 0.12% 115 15991 0.13% 116 16453 0.13% 117 17148 0.14% 118 17225 0.14% 119 18237 0.15% 120 18870 0.15% 121 19297 0.15% 122 19966 0.16% 123 21038 0.17% 124 22470 0.18% 125 22778 0.18% 126 23524 0.19% 127 23670 0.19% 128 24737 0.20% 129 24677 0.20% 130 25484 0.20% 131 26629 0.21% 132 27437 0.22% 133 28355 0.23% 134 28930 0.23% 135 30440 0.24% 136 31000 0.25% 137 31510 0.25% 138 32126 0.26% 139 32648 0.26% 140 33495 0.27% 141 33881 0.27% 142 35413 0.28% 143 35576 0.29% 144 37476 0.30% 145 37977 0.30% 146 38714 0.31% 147 39343 0.32% 148 40398 0.32% 149 40683 0.33% 150 41349 0.33% 151 11197055 89.71% 12481527 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=30 prefix-density=0.18 prefix-fanout=2.5 sequence=GCCAAAGATGTATA criterion=fanout-score sequence-density=0.06 sequence-density-rank=32 fanout-score=118.50 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=20.2 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=31 prefix-density=0.50 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=944.09 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=19.7 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGC SRR18694429 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:49:11 Started mapping on | Dec 10 06:49:12 Finished on | Dec 10 07:38:20 Mapping speed, Million of reads per hour | 15.24 Number of input reads | 12481527 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 10267485 Uniquely mapped reads % | 82.26% Average mapped length | 295.90 Number of splices: Total | 10966415 Number of splices: Annotated (sjdb) | 10304421 Number of splices: GT/AG | 10820331 Number of splices: GC/AG | 123313 Number of splices: AT/AC | 6663 Number of splices: Non-canonical | 16108 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.01% Deletion average length | 2.55 Insertion rate per base | 0.01% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 134415 % of reads mapped to multiple loci | 1.08% Number of reads mapped to too many loci | 38015 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.03% % of reads unmapped: other | 3.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2079627 2079627 2079627 N_multimapping 134415 134415 134415 N_noFeature 371021 10027106 443840 N_ambiguous 193706 1098 26529 UnstrandedReadsAssigned:9702758 PositiveStrandReadsAssigned:239281 NegativeStrandReadsAssigned:9797116 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694429 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694429-trimmed-pair1.fastq SRR18694429-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,481,527 reads, 9,936,326 reads pseudoaligned [quant] estimated average fragment length: 258.485 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52973 SRR18694429.ke.tsv 35125 SRR18694429.se.tsv 88098 total ==> SRR18694429.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 679.019 14.9221 3.19456 PNS24247 1044 786.515 28.7438 5.31252 PNS24249 1928 1670.51 52.4875 4.56739 PNS24246 1044 786.515 28.7438 5.31252 PNS24248 1044 786.515 28.7438 5.31252 PNS24244 1471 1213.51 52.3589 6.27203 PNS24243 293 93.4459 0 0 KQK14069 1603 1345.51 1255.95 135.689 KQK14071 474 236.897 15.8444 9.72254 ==> SRR18694429.se.tsv <== BRADI_1g14170v3 1351 BRADI_1g53295v3 14 BRADI_1g59795v3 195 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 333 BRADI_1g74790v3 27 BRADI_1g09890v3 0 BRADI_1g77505v3 56 BRADI_1g48960v3 0 SRR18694429 completed mapping pipeline successfully