Starting /dee2/code/volunteer_pipeline.sh SRR18694430 current disk space = 1526037225472 free memory = 1556795760 SRR18694430 SRAfilesize 4ab4b30dacbc2b4ed39cb2fff2183f4f SRR18694430.sra SRR18694430.sra file validated SRR18694430 is paired end SRR18694430 is conventional basespace SRR18694430 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694430_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9735 37.0 37.0 37.0 37.0 37.0 2 35.78975 37.0 37.0 37.0 37.0 37.0 3 36.343 37.0 37.0 37.0 37.0 37.0 4 36.4545 37.0 37.0 37.0 37.0 37.0 5 36.395 37.0 37.0 37.0 37.0 37.0 6 36.4375 37.0 37.0 37.0 37.0 37.0 7 36.434 37.0 37.0 37.0 37.0 37.0 8 36.477 37.0 37.0 37.0 37.0 37.0 9 36.603 37.0 37.0 37.0 37.0 37.0 10-14 36.588499999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5995 37.0 37.0 37.0 37.0 37.0 20-24 36.6026 37.0 37.0 37.0 37.0 37.0 25-29 36.5266 37.0 37.0 37.0 37.0 37.0 30-34 36.5065 37.0 37.0 37.0 37.0 37.0 35-39 36.6713 37.0 37.0 37.0 37.0 37.0 40-44 36.6095 37.0 37.0 37.0 37.0 37.0 45-49 36.4002 37.0 37.0 37.0 37.0 37.0 50-54 36.48950000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.486599999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.505700000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3106 37.0 37.0 37.0 37.0 37.0 70-74 36.406400000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.4793 37.0 37.0 37.0 37.0 37.0 80-84 36.400999999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.18480000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.4092 37.0 37.0 37.0 29.8 37.0 95-99 36.101699999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.16459999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.1398 37.0 37.0 37.0 37.0 37.0 110-114 36.224199999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.464800000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.5899 37.0 37.0 37.0 37.0 37.0 125-129 36.4959 37.0 37.0 37.0 37.0 37.0 130-134 36.5407 37.0 37.0 37.0 37.0 37.0 135-139 36.369299999999996 37.0 37.0 37.0 37.0 37.0 140-144 36.22 37.0 37.0 37.0 37.0 37.0 145-149 36.2202 37.0 37.0 37.0 37.0 37.0 150-151 33.89575 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 0.0 25 1.0 26 0.0 27 3.0 28 5.0 29 3.0 30 10.0 31 13.0 32 30.0 33 52.0 34 123.0 35 365.0 36 3225.0 37 168.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.125 9.8 4.9 38.175 2 20.31682172491828 9.982398793060096 37.79230575810913 31.908473723912493 3 20.45 13.350000000000001 25.224999999999998 40.975 4 25.575 21.425 21.0 32.0 5 26.5 26.150000000000002 23.125 24.224999999999998 6 24.15 29.325000000000003 22.6 23.925 7 19.175 24.65 37.55 18.625 8 18.05 24.25 32.475 25.224999999999998 9 18.675 21.25 34.925 25.15 10-14 21.97 27.77 26.365 23.895 15-19 22.655 25.105 26.224999999999998 26.015 20-24 22.235 26.009999999999998 26.575 25.180000000000003 25-29 22.855 25.435000000000002 25.580000000000002 26.13 30-34 22.27 25.924999999999997 25.845000000000002 25.96 35-39 21.89 26.135 26.619999999999997 25.355 40-44 22.900000000000002 26.155 25.915 25.03 45-49 22.24 26.405 26.125 25.230000000000004 50-54 22.09 26.165 26.36 25.385 55-59 22.85 25.865 26.119999999999997 25.165 60-64 22.615 27.005000000000003 25.185000000000002 25.195 65-69 22.82 25.95 25.580000000000002 25.650000000000002 70-74 22.705000000000002 25.790000000000003 26.229999999999997 25.275 75-79 22.81 26.009999999999998 25.39 25.790000000000003 80-84 22.165000000000003 25.924999999999997 25.835 26.075 85-89 22.98 25.36 26.590000000000003 25.069999999999997 90-94 22.84 25.595000000000002 25.945 25.619999999999997 95-99 22.895 25.71 26.0 25.395 100-104 23.119999999999997 25.965 25.564999999999998 25.35 105-109 22.34 25.35 26.07 26.240000000000002 110-114 23.25 25.759999999999998 25.2 25.790000000000003 115-119 23.745 26.105 24.605 25.545 120-124 22.97 26.02 24.89 26.119999999999997 125-129 22.495 26.39 25.21 25.905 130-134 22.43 26.224999999999998 25.655 25.69 135-139 23.365 25.835 25.205 25.595000000000002 140-144 23.544999999999998 25.569999999999997 25.285000000000004 25.6 145-149 23.5 25.955000000000002 25.665 24.88 150-151 22.8875 26.2625 24.175 26.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.5 28 4.5 29 8.5 30 9.5 31 11.0 32 16.0 33 25.0 34 30.0 35 29.5 36 47.0 37 67.0 38 75.5 39 90.0 40 115.0 41 143.5 42 186.5 43 208.5 44 203.5 45 213.5 46 217.5 47 196.0 48 191.5 49 204.5 50 196.0 51 171.5 52 148.0 53 125.5 54 116.0 55 109.0 56 95.5 57 98.5 58 87.5 59 70.5 60 58.0 61 65.5 62 68.0 63 49.5 64 44.5 65 39.0 66 33.0 67 30.0 68 30.5 69 24.5 70 13.5 71 10.0 72 7.0 73 4.0 74 2.5 75 2.0 76 1.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.25 #Duplication Level Percentage of deduplicated Percentage of total 1 86.24633431085044 73.52499999999999 2 11.495601173020528 19.6 3 1.7008797653958945 4.35 4 0.41055718475073316 1.4000000000000001 5 0.02932551319648094 0.125 6 0.05865102639296188 0.3 7 0.0 0.0 8 0.02932551319648094 0.2 9 0.0 0.0 >10 0.02932551319648094 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGGGACCGACTTGCTCGCCTCGCCTGCAGCTGCTAATCCGCCAAGATC 20 0.5 No Hit GCTCTCTCTTGCTCCTCCGTTAGTCTCGTCACTCCCGTCCGCCAAAACTC 8 0.2 No Hit GGGGTCCTGGTAGCGTGCATCGCTCAGTGAGGCTGTTCCAGCGGCATCCC 6 0.15 No Hit ATTACAGTCAAGCGGTTTGGTTCCTTCCCTTCCTCTACATACATTCAGAA 6 0.15 No Hit GCAAGGATTTGTATATGGTGAGGAGAATGGATTCTCCAATATATGGCCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.3875000000000002 0.0 0.0 0.0 0.0 108-109 1.6 0.0 0.0 0.0 0.0 110-111 1.8375 0.0 0.0 0.0 0.0 112-113 2.0875 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.7750000000000004 0.0 0.0 0.0 0.0 118-119 2.975 0.0 0.0 0.0 0.0 120-121 3.2625 0.0 0.0 0.0 0.0 122-123 3.425 0.0 0.0 0.0 0.0 124-125 3.7125000000000004 0.0 0.0 0.0 0.0 126-127 4.2625 0.0 0.0 0.0 0.0 128-129 4.625 0.0 0.0 0.0 0.0 130-131 5.1625 0.0 0.0 0.0 0.0 132-133 5.5 0.0 0.0 0.0 0.0 134-135 5.824999999999999 0.0 0.0 0.0 0.0 136-137 6.449999999999999 0.0 0.0 0.0 0.0 138-139 6.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGAGAT 10 0.006830828 145.0 145 ACGACGA 10 0.006830828 145.0 4 >>END_MODULE SRR18694430 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694430_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.1155 37.0 37.0 37.0 25.0 37.0 2 35.168 37.0 37.0 37.0 25.0 37.0 3 35.392 37.0 37.0 37.0 37.0 37.0 4 35.386 37.0 37.0 37.0 37.0 37.0 5 35.233 37.0 37.0 37.0 25.0 37.0 6 35.358 37.0 37.0 37.0 37.0 37.0 7 35.429 37.0 37.0 37.0 37.0 37.0 8 35.4145 37.0 37.0 37.0 37.0 37.0 9 35.408 37.0 37.0 37.0 37.0 37.0 10-14 35.562599999999996 37.0 37.0 37.0 37.0 37.0 15-19 35.613800000000005 37.0 37.0 37.0 37.0 37.0 20-24 35.449799999999996 37.0 37.0 37.0 34.6 37.0 25-29 35.5917 37.0 37.0 37.0 34.6 37.0 30-34 35.8447 37.0 37.0 37.0 37.0 37.0 35-39 35.625 37.0 37.0 37.0 34.6 37.0 40-44 35.4084 37.0 37.0 37.0 29.8 37.0 45-49 35.6207 37.0 37.0 37.0 37.0 37.0 50-54 35.1094 37.0 37.0 37.0 32.2 37.0 55-59 34.3007 37.0 37.0 37.0 25.0 37.0 60-64 35.1082 37.0 37.0 37.0 27.4 37.0 65-69 34.2405 37.0 34.6 37.0 27.4 37.0 70-74 32.978500000000004 37.0 29.8 37.0 22.2 37.0 75-79 33.52890000000001 37.0 34.6 37.0 22.2 37.0 80-84 34.5905 37.0 37.0 37.0 25.0 37.0 85-89 32.54540000000001 37.0 32.2 37.0 19.4 37.0 90-94 34.3067 37.0 37.0 37.0 25.0 37.0 95-99 33.9764 37.0 37.0 37.0 25.0 37.0 100-104 33.4785 37.0 37.0 37.0 25.0 37.0 105-109 34.2656 37.0 37.0 37.0 25.0 37.0 110-114 34.5952 37.0 37.0 37.0 25.0 37.0 115-119 34.5142 37.0 37.0 37.0 25.0 37.0 120-124 34.2429 37.0 37.0 37.0 25.0 37.0 125-129 34.04 37.0 37.0 37.0 25.0 37.0 130-134 33.837599999999995 37.0 34.6 37.0 25.0 37.0 135-139 32.212199999999996 37.0 27.4 37.0 13.8 37.0 140-144 31.650800000000004 37.0 25.0 37.0 11.0 37.0 145-149 31.2692 37.0 25.0 37.0 11.0 37.0 150-151 30.930750000000003 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 2.0 18 2.0 19 0.0 20 5.0 21 5.0 22 4.0 23 5.0 24 4.0 25 8.0 26 4.0 27 16.0 28 27.0 29 40.0 30 83.0 31 129.0 32 276.0 33 555.0 34 1155.0 35 1463.0 36 216.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.625 21.175 8.450000000000001 29.75 2 29.599999999999998 23.400000000000002 28.125 18.875 3 23.400000000000002 24.375 31.525 20.7 4 25.85 30.55 20.325 23.275000000000002 5 27.875 32.824999999999996 18.625 20.674999999999997 6 23.325000000000003 36.325 21.224999999999998 19.125 7 22.025 21.5 34.050000000000004 22.425 8 22.6 23.674999999999997 26.025 27.700000000000003 9 22.775000000000002 22.125 29.925 25.174999999999997 10-14 25.4 26.575 23.445 24.58 15-19 25.369999999999997 25.97 24.959999999999997 23.7 20-24 25.77 25.52 24.7 24.01 25-29 25.435000000000002 25.85 24.875 23.84 30-34 25.34 25.655 25.455 23.549999999999997 35-39 25.374999999999996 26.035000000000004 25.040000000000003 23.549999999999997 40-44 25.535000000000004 25.430000000000003 25.2 23.835 45-49 25.39 25.695 24.945 23.97 50-54 24.235 26.295 26.1 23.369999999999997 55-59 25.174999999999997 25.785000000000004 25.385 23.655 60-64 26.245 25.72 25.259999999999998 22.775000000000002 65-69 25.679999999999996 26.14 25.595000000000002 22.585 70-74 26.584999999999997 25.16 24.81 23.445 75-79 27.529999999999998 23.990000000000002 25.45 23.03 80-84 25.445 26.27 25.46 22.825 85-89 23.169999999999998 28.325 24.805 23.7 90-94 25.91 25.480000000000004 26.095000000000002 22.515 95-99 26.07 26.419999999999998 24.625 22.884999999999998 100-104 26.240000000000002 25.380000000000003 25.045 23.335 105-109 25.105 26.375 25.135 23.385 110-114 25.75 25.81 25.495 22.945 115-119 26.14 25.795 24.959999999999997 23.105 120-124 25.900000000000002 26.06 25.06 22.98 125-129 26.47 25.929999999999996 24.69 22.91 130-134 26.195 26.1 25.365 22.34 135-139 26.450000000000003 26.290000000000003 25.4 21.86 140-144 26.36 26.419999999999998 25.115 22.105 145-149 26.755000000000003 26.125 25.39 21.73 150-151 24.825 26.5375 26.8375 21.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 1.0 23 0.5 24 1.0 25 2.0 26 1.0 27 1.0 28 1.5 29 1.5 30 3.5 31 6.5 32 12.0 33 18.0 34 25.5 35 36.0 36 47.5 37 63.5 38 86.5 39 102.5 40 114.5 41 140.5 42 178.0 43 193.0 44 193.5 45 207.0 46 200.5 47 198.0 48 201.5 49 194.5 50 178.5 51 145.5 52 138.0 53 136.0 54 126.0 55 119.0 56 96.5 57 82.5 58 78.0 59 71.5 60 70.5 61 70.5 62 64.5 63 53.5 64 51.5 65 54.0 66 42.0 67 30.5 68 38.5 69 33.0 70 19.0 71 16.0 72 11.5 73 9.5 74 8.0 75 6.0 76 3.0 77 1.0 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 1.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.95 #Duplication Level Percentage of deduplicated Percentage of total 1 88.01035077630821 76.525 2 10.178263369752731 17.7 3 1.3225991949396205 3.45 4 0.3162737205290397 1.0999999999999999 5 0.08625646923519263 0.375 6 0.02875215641173088 0.15 7 0.0 0.0 8 0.0 0.0 9 0.02875215641173088 0.22499999999999998 >10 0.02875215641173088 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTTTTCTTGGTAGCAGGTAGAGCAAGAGCCAAGAATTCCGATATCGATC 19 0.475 No Hit GGGCCTGCAGTCCCTTGGCAGCCTCCGAGATTTGACAGTACGTAACTGCC 9 0.22499999999999998 No Hit CCATCGTGCTCCCCGCTTCCTCCCGCCGCGCCTCCGACCCCGTCGTCCCC 6 0.15 No Hit GCCATCCTAGATCACTGCAATCTAGTACTACTGAAACCGGCCATCAAACG 5 0.125 No Hit CCTCAACCTGTGAATCAGTATTCCACTACATATTCTGCTTATGATAACTA 5 0.125 No Hit CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.3624999999999998 0.0 0.0 0.0 0.0 108-109 1.55 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 2.0374999999999996 0.0 0.0 0.0 0.0 114-115 2.4375 0.0 0.0 0.0 0.0 116-117 2.7249999999999996 0.0 0.0 0.0 0.0 118-119 2.925 0.0 0.0 0.0 0.0 120-121 3.2125 0.0 0.0 0.0 0.0 122-123 3.375 0.0 0.0 0.0 0.0 124-125 3.6624999999999996 0.0 0.0 0.0 0.0 126-127 4.2125 0.0 0.0 0.0 0.0 128-129 4.575 0.0 0.0 0.0 0.0 130-131 5.112500000000001 0.0 0.0 0.0 0.0 132-133 5.45 0.0 0.0 0.0 0.0 134-135 5.775 0.0 0.0 0.0 0.0 136-137 6.4 0.0 0.0 0.0 0.0 138-139 6.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCAAG 10 0.006830828 145.0 5 AAAACCT 10 0.006830828 145.0 3 AAAAACC 10 0.006830828 145.0 2 CAAAAAC 10 0.006830828 145.0 1 >>END_MODULE Read 684207 spots for SRR18694430.sra Written 684207 spots for SRR18694430.sra Read 684207 spots for SRR18694430.sra Written 684207 spots for SRR18694430.sra Read 684207 spots for SRR18694430.sra Written 684207 spots for SRR18694430.sra Read 684207 spots for SRR18694430.sra Written 684207 spots for SRR18694430.sra Read 684207 spots for SRR18694430.sra Written 684207 spots for SRR18694430.sra Read 684207 spots for SRR18694430.sra Written 684207 spots for SRR18694430.sra Read 684207 spots for SRR18694430.sra Written 684207 spots for SRR18694430.sra Read 684207 spots for SRR18694430.sra Written 684207 spots for SRR18694430.sra Read 684207 spots for SRR18694430.sra Written 684207 spots for SRR18694430.sra Read 684207 spots for SRR18694430.sra Written 684207 spots for SRR18694430.sra Read 684207 spots for SRR18694430.sra Written 684207 spots for SRR18694430.sra Read 684207 spots for SRR18694430.sra Written 684207 spots for SRR18694430.sra Read 684207 spots for SRR18694430.sra Written 684207 spots for SRR18694430.sra Read 684207 spots for SRR18694430.sra Written 684207 spots for SRR18694430.sra Read 684207 spots for SRR18694430.sra Written 684207 spots for SRR18694430.sra Read 684207 spots for SRR18694430.sra Written 684207 spots for SRR18694430.sra Read 684207 spots for SRR18694430.sra Written 684207 spots for SRR18694430.sra Read 684207 spots for SRR18694430.sra Written 684207 spots for SRR18694430.sra Read 684222 spots for SRR18694430.sra Written 684222 spots for SRR18694430.sra Read 684207 spots for SRR18694430.sra Written 684207 spots for SRR18694430.sra SRR ids: ['SRR18694430.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pfkj27jx SRR18694430.sra spots: 13684155 blocks: [[1, 684207], [684208, 1368414], [1368415, 2052621], [2052622, 2736828], [2736829, 3421035], [3421036, 4105242], [4105243, 4789449], [4789450, 5473656], [5473657, 6157863], [6157864, 6842070], [6842071, 7526277], [7526278, 8210484], [8210485, 8894691], [8894692, 9578898], [9578899, 10263105], [10263106, 10947312], [10947313, 11631519], [11631520, 12315726], [12315727, 12999933], [12999934, 13684155]] SRR18694430 file size 4628774 SRR18694430 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694430 SRR18694430_1.fastq SRR18694430_2.fastq Input file: SRR18694430_1.fastq Paired file: SRR18694430_2.fastq trimmed: SRR18694430-trimmed-pair1.fastq, SRR18694430-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:44:32 2024 >> started Tue Dec 10 06:44:48 2024 >> done (15.253s) 13684155 read pairs processed; of these: 176 ( 0.00%) short read pairs filtered out after trimming by size control 3741 ( 0.03%) empty read pairs filtered out after trimming by size control 13680238 (99.97%) read pairs available; of these: 1209059 ( 8.84%) trimmed read pairs available after processing 12471179 (91.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 17 0.00% 20 6 0.00% 21 17 0.00% 22 16 0.00% 23 12 0.00% 24 17 0.00% 25 26 0.00% 26 18 0.00% 27 25 0.00% 28 33 0.00% 29 25 0.00% 30 30 0.00% 31 28 0.00% 32 34 0.00% 33 28 0.00% 34 46 0.00% 35 46 0.00% 36 37 0.00% 37 32 0.00% 38 46 0.00% 39 34 0.00% 40 42 0.00% 41 34 0.00% 42 56 0.00% 43 56 0.00% 44 35 0.00% 45 36 0.00% 46 62 0.00% 47 58 0.00% 48 59 0.00% 49 58 0.00% 50 80 0.00% 51 79 0.00% 52 105 0.00% 53 86 0.00% 54 99 0.00% 55 115 0.00% 56 116 0.00% 57 118 0.00% 58 121 0.00% 59 158 0.00% 60 168 0.00% 61 199 0.00% 62 225 0.00% 63 288 0.00% 64 308 0.00% 65 237 0.00% 66 299 0.00% 67 350 0.00% 68 447 0.00% 69 462 0.00% 70 574 0.00% 71 620 0.00% 72 739 0.01% 73 792 0.01% 74 928 0.01% 75 916 0.01% 76 1046 0.01% 77 1141 0.01% 78 1245 0.01% 79 1463 0.01% 80 1641 0.01% 81 1887 0.01% 82 2072 0.02% 83 2290 0.02% 84 2492 0.02% 85 2818 0.02% 86 3051 0.02% 87 3136 0.02% 88 3754 0.03% 89 3694 0.03% 90 3994 0.03% 91 4363 0.03% 92 4657 0.03% 93 4977 0.04% 94 5438 0.04% 95 5795 0.04% 96 5997 0.04% 97 6614 0.05% 98 6782 0.05% 99 6905 0.05% 100 7355 0.05% 101 7776 0.06% 102 8307 0.06% 103 8873 0.06% 104 9442 0.07% 105 9767 0.07% 106 10236 0.07% 107 10482 0.08% 108 11181 0.08% 109 11298 0.08% 110 11946 0.09% 111 12527 0.09% 112 13499 0.10% 113 13750 0.10% 114 14249 0.10% 115 14995 0.11% 116 15599 0.11% 117 15726 0.11% 118 16630 0.12% 119 17102 0.13% 120 17825 0.13% 121 18306 0.13% 122 18983 0.14% 123 19820 0.14% 124 20589 0.15% 125 21439 0.16% 126 22209 0.16% 127 22567 0.16% 128 22700 0.17% 129 23527 0.17% 130 24123 0.18% 131 24532 0.18% 132 25196 0.18% 133 26316 0.19% 134 26978 0.20% 135 28080 0.21% 136 28591 0.21% 137 29187 0.21% 138 30345 0.22% 139 30571 0.22% 140 31322 0.23% 141 32146 0.23% 142 32901 0.24% 143 33811 0.25% 144 34906 0.26% 145 35693 0.26% 146 36495 0.27% 147 37389 0.27% 148 37892 0.28% 149 37933 0.28% 150 38985 0.28% 151 12471179 91.16% 13680238 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=36 prefix-density=0.15 prefix-fanout=2.5 sequence=GCCAAAGATGTATA criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=458.28 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=34.8 sequence=CTTCTTCTTGAT criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=30 prefix-density=0.38 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=400.60 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=17.0 sequence=CGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGG SRR18694430 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:45:39 Started mapping on | Dec 10 06:45:40 Finished on | Dec 10 06:47:27 Mapping speed, Million of reads per hour | 460.27 Number of input reads | 13680238 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12711116 Uniquely mapped reads % | 92.92% Average mapped length | 296.48 Number of splices: Total | 14310849 Number of splices: Annotated (sjdb) | 13482970 Number of splices: GT/AG | 14125372 Number of splices: GC/AG | 155966 Number of splices: AT/AC | 9611 Number of splices: Non-canonical | 19900 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.55 Insertion rate per base | 0.01% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 181152 % of reads mapped to multiple loci | 1.32% Number of reads mapped to too many loci | 37755 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.18% % of reads unmapped: other | 2.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 787970 787970 787970 N_multimapping 181152 181152 181152 N_noFeature 509537 12420081 598718 N_ambiguous 236193 1675 35047 UnstrandedReadsAssigned:11965386 PositiveStrandReadsAssigned:289360 NegativeStrandReadsAssigned:12077351 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694430 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694430-trimmed-pair1.fastq SRR18694430-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,680,238 reads, 12,249,217 reads pseudoaligned [quant] estimated average fragment length: 269.522 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52973 SRR18694430.ke.tsv 35125 SRR18694430.se.tsv 88098 total ==> SRR18694430.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 668.08 0 0 PNS24247 1044 775.478 53.4857 8.81455 PNS24249 1928 1659.48 34.3088 2.6422 PNS24246 1044 775.478 53.4857 8.81455 PNS24248 1044 775.478 53.4857 8.81455 PNS24244 1471 1202.48 109.234 11.6095 PNS24243 293 91.2051 1 1.40124 KQK14069 1603 1334.48 1129.24 108.145 KQK14071 474 231.152 7.63133 4.21925 ==> SRR18694430.se.tsv <== BRADI_1g14170v3 1222 BRADI_1g53295v3 47 BRADI_1g59795v3 246 BRADI_1g07683v3 0 BRADI_1g00485v3 49 BRADI_1g20270v3 744 BRADI_1g74790v3 63 BRADI_1g09890v3 0 BRADI_1g77505v3 75 BRADI_1g48960v3 0 SRR18694430 completed mapping pipeline successfully