Starting /dee2/code/volunteer_pipeline.sh SRR18694433 current disk space = 1526022950912 free memory = 1602350236 SRR18694433 SRAfilesize 04bd934eb4f61b8ffb6cf68e0cd559e4 SRR18694433.sra SRR18694433.sra file validated SRR18694433 is paired end SRR18694433 is conventional basespace SRR18694433 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694433_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.145 37.0 37.0 37.0 37.0 37.0 2 36.0495 37.0 37.0 37.0 37.0 37.0 3 36.448 37.0 37.0 37.0 37.0 37.0 4 36.526 37.0 37.0 37.0 37.0 37.0 5 36.534 37.0 37.0 37.0 37.0 37.0 6 36.483 37.0 37.0 37.0 37.0 37.0 7 36.531 37.0 37.0 37.0 37.0 37.0 8 36.5445 37.0 37.0 37.0 37.0 37.0 9 36.6125 37.0 37.0 37.0 37.0 37.0 10-14 36.599799999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.568400000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.65859999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.5769 37.0 37.0 37.0 37.0 37.0 30-34 36.5308 37.0 37.0 37.0 37.0 37.0 35-39 36.6621 37.0 37.0 37.0 37.0 37.0 40-44 36.6346 37.0 37.0 37.0 37.0 37.0 45-49 36.379599999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.522999999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.521 37.0 37.0 37.0 37.0 37.0 60-64 36.5107 37.0 37.0 37.0 37.0 37.0 65-69 36.2984 37.0 37.0 37.0 37.0 37.0 70-74 36.3835 37.0 37.0 37.0 37.0 37.0 75-79 36.4866 37.0 37.0 37.0 37.0 37.0 80-84 36.398300000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.1464 37.0 37.0 37.0 37.0 37.0 90-94 35.4045 37.0 37.0 37.0 29.8 37.0 95-99 36.126599999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.14149999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.138799999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.227700000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.4684 37.0 37.0 37.0 37.0 37.0 120-124 36.5146 37.0 37.0 37.0 37.0 37.0 125-129 36.512600000000006 37.0 37.0 37.0 37.0 37.0 130-134 36.4654 37.0 37.0 37.0 37.0 37.0 135-139 36.396 37.0 37.0 37.0 37.0 37.0 140-144 36.192899999999995 37.0 37.0 37.0 37.0 37.0 145-149 36.1606 37.0 37.0 37.0 37.0 37.0 150-151 33.698499999999996 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 1.0 28 3.0 29 9.0 30 9.0 31 18.0 32 26.0 33 50.0 34 125.0 35 312.0 36 3278.0 37 166.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.925 8.825 5.025 41.225 2 20.536609829488466 11.183550651955867 36.91073219658977 31.3691073219659 3 20.175 13.125 25.474999999999998 41.225 4 25.45 21.0 21.875 31.674999999999997 5 27.750000000000004 26.474999999999998 22.75 23.025000000000002 6 24.474999999999998 30.625000000000004 22.625 22.275 7 18.725 25.074999999999996 37.974999999999994 18.224999999999998 8 19.825 23.7 32.300000000000004 24.175 9 20.275000000000002 20.674999999999997 35.275 23.775 10-14 22.5 26.595000000000002 26.474999999999998 24.43 15-19 23.385 25.0 26.200000000000003 25.415 20-24 22.935 25.855 25.585 25.624999999999996 25-29 22.845 26.179999999999996 25.615 25.36 30-34 22.58 25.31 25.94 26.169999999999998 35-39 23.665 25.525 25.3 25.509999999999998 40-44 22.994999999999997 26.165 25.080000000000002 25.759999999999998 45-49 22.515 25.424999999999997 26.055 26.005 50-54 23.035 25.64 25.595000000000002 25.729999999999997 55-59 22.75 25.314999999999998 25.61 26.325 60-64 23.064999999999998 24.67 26.009999999999998 26.255 65-69 23.095 24.66 25.95 26.295 70-74 22.74 25.635 25.3 26.325 75-79 23.56 25.15 25.314999999999998 25.974999999999998 80-84 23.405 25.240000000000002 25.629999999999995 25.724999999999998 85-89 23.655 24.925 25.585 25.835 90-94 23.555 25.085 25.295 26.064999999999998 95-99 24.060000000000002 24.75 25.495 25.695 100-104 23.59 25.285000000000004 25.555 25.569999999999997 105-109 23.525 25.365 25.15 25.96 110-114 23.96 25.230000000000004 25.615 25.195 115-119 24.044999999999998 25.629999999999995 24.695 25.629999999999995 120-124 24.085 25.135 25.095 25.685000000000002 125-129 23.405 24.9 24.93 26.765 130-134 23.244999999999997 25.169999999999998 25.25 26.334999999999997 135-139 23.775 25.564999999999998 25.480000000000004 25.180000000000003 140-144 23.385 24.805 25.655 26.155 145-149 23.405 24.990000000000002 25.21 26.395000000000003 150-151 23.1875 25.2875 25.662499999999998 25.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 0.5 27 2.0 28 3.0 29 5.0 30 5.0 31 5.0 32 9.5 33 18.0 34 21.5 35 23.0 36 42.5 37 64.5 38 77.5 39 97.5 40 129.5 41 142.0 42 150.0 43 168.5 44 190.0 45 205.5 46 223.0 47 219.0 48 191.0 49 184.0 50 183.0 51 176.0 52 162.5 53 143.5 54 125.5 55 114.5 56 91.5 57 72.0 58 76.5 59 65.5 60 48.5 61 55.0 62 68.0 63 66.5 64 57.0 65 56.0 66 61.0 67 55.0 68 37.5 69 25.5 70 15.5 71 11.5 72 11.5 73 12.0 74 10.0 75 5.5 76 4.0 77 4.5 78 2.0 79 0.5 80 1.0 81 0.5 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.1 #Duplication Level Percentage of deduplicated Percentage of total 1 87.9735935706085 76.625 2 9.988518943742825 17.4 3 1.7221584385763489 4.5 4 0.20091848450057406 0.7000000000000001 5 0.0574052812858783 0.25 6 0.0 0.0 7 0.02870264064293915 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02870264064293915 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCAGAGATTGCGTCGATGGTCATGGAGGGTGAAGAGATGCATGCCTCTA 14 0.35000000000000003 No Hit GACAGGAGAAGTCTGGCGTCGGCCAGCTCCTATGGGGTTGACACAAACAT 7 0.17500000000000002 No Hit CCCCCGGTTTGAGGCCGCGGCCGCAGCAGAAGCAGCGGCTGGCGACCATG 5 0.125 No Hit GTTGTACTTCCTCTGCAGCCGGCGGTTCCTGACCTTGGCGTTCTCCGTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.8375 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.2625 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.8125 0.0 0.0 0.0 0.0 116-117 2.0625 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.5 0.0 0.0 0.0 0.0 122-123 2.7125 0.0 0.0 0.0 0.0 124-125 2.9125 0.0 0.0 0.0 0.0 126-127 3.1375 0.0 0.0 0.0 0.0 128-129 3.4875 0.0 0.0 0.0 0.0 130-131 3.8375 0.0 0.0 0.0 0.0 132-133 4.0875 0.0 0.0 0.0 0.0 134-135 4.35 0.0 0.0 0.0 0.0 136-137 4.612500000000001 0.0 0.0 0.0 0.0 138-139 5.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGCTG 10 0.006830828 145.0 2 >>END_MODULE SRR18694433 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694433_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.08 37.0 37.0 37.0 25.0 37.0 2 34.9895 37.0 37.0 37.0 25.0 37.0 3 35.0795 37.0 37.0 37.0 25.0 37.0 4 35.2545 37.0 37.0 37.0 25.0 37.0 5 35.219 37.0 37.0 37.0 25.0 37.0 6 35.3005 37.0 37.0 37.0 25.0 37.0 7 35.193 37.0 37.0 37.0 25.0 37.0 8 35.516 37.0 37.0 37.0 37.0 37.0 9 35.566 37.0 37.0 37.0 37.0 37.0 10-14 35.6494 37.0 37.0 37.0 37.0 37.0 15-19 35.625299999999996 37.0 37.0 37.0 37.0 37.0 20-24 35.438599999999994 37.0 37.0 37.0 34.6 37.0 25-29 35.5804 37.0 37.0 37.0 32.2 37.0 30-34 35.815200000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.6672 37.0 37.0 37.0 37.0 37.0 40-44 35.40220000000001 37.0 37.0 37.0 29.8 37.0 45-49 35.5524 37.0 37.0 37.0 37.0 37.0 50-54 35.038 37.0 37.0 37.0 32.2 37.0 55-59 34.4037 37.0 37.0 37.0 25.0 37.0 60-64 35.054199999999994 37.0 37.0 37.0 27.4 37.0 65-69 34.321600000000004 37.0 34.6 37.0 27.4 37.0 70-74 33.0765 37.0 29.8 37.0 22.2 37.0 75-79 33.6927 37.0 34.6 37.0 22.2 37.0 80-84 34.6397 37.0 37.0 37.0 25.0 37.0 85-89 32.7142 37.0 32.2 37.0 19.4 37.0 90-94 34.285000000000004 37.0 37.0 37.0 25.0 37.0 95-99 33.967499999999994 37.0 37.0 37.0 25.0 37.0 100-104 33.5924 37.0 37.0 37.0 25.0 37.0 105-109 34.262800000000006 37.0 37.0 37.0 25.0 37.0 110-114 34.528800000000004 37.0 37.0 37.0 25.0 37.0 115-119 34.540800000000004 37.0 37.0 37.0 25.0 37.0 120-124 34.162 37.0 37.0 37.0 25.0 37.0 125-129 34.052200000000006 37.0 37.0 37.0 25.0 37.0 130-134 33.7693 37.0 34.6 37.0 25.0 37.0 135-139 32.251400000000004 37.0 27.4 37.0 13.8 37.0 140-144 31.7885 37.0 25.0 37.0 11.0 37.0 145-149 31.305799999999998 37.0 25.0 37.0 11.0 37.0 150-151 30.9105 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 2.0 19 4.0 20 1.0 21 1.0 22 4.0 23 3.0 24 4.0 25 8.0 26 6.0 27 23.0 28 22.0 29 43.0 30 79.0 31 139.0 32 270.0 33 534.0 34 1162.0 35 1477.0 36 217.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.775 21.05 9.049999999999999 30.125 2 29.025000000000002 23.525 27.450000000000003 20.0 3 21.925 24.05 29.7 24.325 4 27.400000000000002 28.775000000000002 21.05 22.775000000000002 5 28.000000000000004 33.300000000000004 18.3 20.4 6 22.975 35.575 19.2 22.25 7 23.9 18.775 34.699999999999996 22.625 8 22.650000000000002 22.6 23.5 31.25 9 23.925 22.075 27.700000000000003 26.3 10-14 25.679999999999996 25.974999999999998 23.565 24.779999999999998 15-19 25.735000000000003 25.06 23.97 25.235000000000003 20-24 25.330000000000002 25.645 24.0 25.025 25-29 25.735000000000003 26.040000000000003 23.880000000000003 24.345 30-34 25.82 25.05 24.27 24.86 35-39 25.105 25.685000000000002 24.27 24.94 40-44 26.025 24.82 24.48 24.675 45-49 26.93 25.275 24.0 23.794999999999998 50-54 24.675 25.785000000000004 25.71 23.830000000000002 55-59 25.275 26.155 24.42 24.15 60-64 26.505000000000003 24.915000000000003 24.279999999999998 24.3 65-69 25.855 25.335 24.58 24.23 70-74 26.91 24.645 24.099999999999998 24.345 75-79 27.42 23.580000000000002 25.045 23.955000000000002 80-84 26.009999999999998 25.005 24.545 24.44 85-89 23.785 27.935 25.03 23.25 90-94 25.88 25.629999999999995 24.044999999999998 24.445 95-99 25.86 25.259999999999998 24.565 24.315 100-104 26.165 25.715 24.465 23.655 105-109 26.985 25.224999999999998 24.47 23.32 110-114 26.545 25.424999999999997 24.42 23.61 115-119 26.27 25.795 24.705 23.23 120-124 27.1 25.365 24.515 23.02 125-129 26.435 25.740000000000002 24.92 22.905 130-134 26.56 25.615 24.64 23.185 135-139 26.43 26.0 24.560000000000002 23.01 140-144 26.009999999999998 26.340000000000003 24.345 23.305 145-149 26.82 25.465 24.57 23.145 150-151 25.5 26.05 26.1125 22.3375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 1.5 26 1.0 27 0.5 28 2.0 29 4.0 30 4.5 31 6.0 32 9.0 33 14.0 34 19.0 35 28.5 36 38.5 37 48.5 38 71.5 39 98.5 40 122.0 41 137.5 42 148.5 43 190.5 44 210.0 45 186.0 46 183.5 47 181.5 48 168.5 49 171.0 50 158.0 51 144.0 52 142.5 53 136.5 54 132.0 55 111.5 56 92.5 57 94.5 58 89.5 59 88.0 60 79.0 61 62.5 62 70.5 63 70.0 64 67.0 65 65.0 66 64.5 67 60.5 68 50.0 69 42.5 70 35.5 71 26.0 72 15.5 73 11.0 74 10.5 75 9.0 76 6.0 77 3.5 78 1.5 79 1.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 1.0 95 1.5 96 0.5 97 0.0 98 1.0 99 2.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.875 #Duplication Level Percentage of deduplicated Percentage of total 1 88.9900426742532 78.2 2 9.160739687055477 16.1 3 1.4509246088193457 3.8249999999999997 4 0.25604551920341395 0.8999999999999999 5 0.05689900426742533 0.25 6 0.0 0.0 7 0.028449502133712664 0.17500000000000002 8 0.028449502133712664 0.2 9 0.0 0.0 >10 0.028449502133712664 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TCTCATTCTCATATCCCCAAACTCAACACAGAGAAAAGAGTTTCAGCATC 14 0.35000000000000003 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit GTCATCTCTCTGTTATCAGTGGCAACCCACTGTCCTTGGAGCAATGGGGA 7 0.17500000000000002 No Hit CAACTCTCCCCAATCCTCCACTCGCCTCAGAGCAATGGCGTCCATCATCG 5 0.125 No Hit GGCCACCCTCGCCATGCCCCGCCACCTCGAGGCACAATTGCTTCGTGTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.7875 0.0 0.0 0.0 0.0 106-107 0.9625 0.0 0.0 0.0 0.0 108-109 1.05 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.5125 0.0 0.0 0.0 0.0 114-115 1.7625 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.2125 0.0 0.0 0.0 0.0 120-121 2.45 0.0 0.0 0.0 0.0 122-123 2.6625 0.0 0.0 0.0 0.0 124-125 2.8625 0.0 0.0 0.0 0.0 126-127 3.0875 0.0 0.0 0.0 0.0 128-129 3.4375 0.0 0.0 0.0 0.0 130-131 3.7875 0.0 0.0 0.0 0.0 132-133 4.0375 0.0 0.0 0.0 0.0 134-135 4.3 0.0 0.0 0.0 0.0 136-137 4.5625 0.0 0.0 0.0 0.0 138-139 4.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 561585 spots for SRR18694433.sra Written 561585 spots for SRR18694433.sra Read 561585 spots for SRR18694433.sra Written 561585 spots for SRR18694433.sra Read 561585 spots for SRR18694433.sra Written 561585 spots for SRR18694433.sra Read 561585 spots for SRR18694433.sra Written 561585 spots for SRR18694433.sra Read 561585 spots for SRR18694433.sra Written 561585 spots for SRR18694433.sra Read 561585 spots for SRR18694433.sra Written 561585 spots for SRR18694433.sra Read 561585 spots for SRR18694433.sra Written 561585 spots for SRR18694433.sra Read 561585 spots for SRR18694433.sra Written 561585 spots for SRR18694433.sra Read 561585 spots for SRR18694433.sra Written 561585 spots for SRR18694433.sra Read 561585 spots for SRR18694433.sra Written 561585 spots for SRR18694433.sra Read 561585 spots for SRR18694433.sra Written 561585 spots for SRR18694433.sra Read 561585 spots for SRR18694433.sra Written 561585 spots for SRR18694433.sra Read 561588 spots for SRR18694433.sra Written 561588 spots for SRR18694433.sra Read 561585 spots for SRR18694433.sra Written 561585 spots for SRR18694433.sra Read 561585 spots for SRR18694433.sra Written 561585 spots for SRR18694433.sra Read 561585 spots for SRR18694433.sra Written 561585 spots for SRR18694433.sra Read 561585 spots for SRR18694433.sra Written 561585 spots for SRR18694433.sra Read 561585 spots for SRR18694433.sra Written 561585 spots for SRR18694433.sra Read 561585 spots for SRR18694433.sra Written 561585 spots for SRR18694433.sra Read 561585 spots for SRR18694433.sra Written 561585 spots for SRR18694433.sra SRR ids: ['SRR18694433.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ea4fw1ef SRR18694433.sra spots: 11231703 blocks: [[1, 561585], [561586, 1123170], [1123171, 1684755], [1684756, 2246340], [2246341, 2807925], [2807926, 3369510], [3369511, 3931095], [3931096, 4492680], [4492681, 5054265], [5054266, 5615850], [5615851, 6177435], [6177436, 6739020], [6739021, 7300605], [7300606, 7862190], [7862191, 8423775], [8423776, 8985360], [8985361, 9546945], [9546946, 10108530], [10108531, 10670115], [10670116, 11231703]] SRR18694433 file size 3795323 SRR18694433 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694433 SRR18694433_1.fastq SRR18694433_2.fastq Input file: SRR18694433_1.fastq Paired file: SRR18694433_2.fastq trimmed: SRR18694433-trimmed-pair1.fastq, SRR18694433-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:45:13 2024 >> started Tue Dec 10 06:45:26 2024 >> done (12.847s) 11231703 read pairs processed; of these: 129 ( 0.00%) short read pairs filtered out after trimming by size control 657 ( 0.01%) empty read pairs filtered out after trimming by size control 11230917 (99.99%) read pairs available; of these: 909011 ( 8.09%) trimmed read pairs available after processing 10321906 (91.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 10 0.00% 20 12 0.00% 21 14 0.00% 22 20 0.00% 23 17 0.00% 24 13 0.00% 25 16 0.00% 26 20 0.00% 27 23 0.00% 28 19 0.00% 29 22 0.00% 30 26 0.00% 31 27 0.00% 32 26 0.00% 33 26 0.00% 34 22 0.00% 35 34 0.00% 36 30 0.00% 37 42 0.00% 38 22 0.00% 39 37 0.00% 40 29 0.00% 41 33 0.00% 42 40 0.00% 43 34 0.00% 44 34 0.00% 45 36 0.00% 46 37 0.00% 47 35 0.00% 48 42 0.00% 49 50 0.00% 50 54 0.00% 51 58 0.00% 52 74 0.00% 53 56 0.00% 54 59 0.00% 55 82 0.00% 56 69 0.00% 57 81 0.00% 58 88 0.00% 59 123 0.00% 60 121 0.00% 61 137 0.00% 62 149 0.00% 63 151 0.00% 64 175 0.00% 65 209 0.00% 66 193 0.00% 67 250 0.00% 68 272 0.00% 69 312 0.00% 70 313 0.00% 71 433 0.00% 72 469 0.00% 73 534 0.00% 74 533 0.00% 75 619 0.01% 76 654 0.01% 77 799 0.01% 78 866 0.01% 79 848 0.01% 80 1064 0.01% 81 1116 0.01% 82 1275 0.01% 83 1448 0.01% 84 1610 0.01% 85 1712 0.02% 86 1860 0.02% 87 2037 0.02% 88 2225 0.02% 89 2378 0.02% 90 2632 0.02% 91 2749 0.02% 92 3083 0.03% 93 3251 0.03% 94 3568 0.03% 95 3777 0.03% 96 4107 0.04% 97 4281 0.04% 98 4573 0.04% 99 4785 0.04% 100 5183 0.05% 101 5311 0.05% 102 5722 0.05% 103 6180 0.06% 104 6531 0.06% 105 6815 0.06% 106 7262 0.06% 107 7430 0.07% 108 7798 0.07% 109 8187 0.07% 110 8470 0.08% 111 8973 0.08% 112 9294 0.08% 113 9736 0.09% 114 10301 0.09% 115 10858 0.10% 116 11177 0.10% 117 11749 0.10% 118 11868 0.11% 119 12773 0.11% 120 13049 0.12% 121 13682 0.12% 122 13824 0.12% 123 14421 0.13% 124 15397 0.14% 125 15733 0.14% 126 16584 0.15% 127 16476 0.15% 128 17277 0.15% 129 17969 0.16% 130 18315 0.16% 131 18651 0.17% 132 19676 0.18% 133 20558 0.18% 134 20713 0.18% 135 21515 0.19% 136 22163 0.20% 137 22595 0.20% 138 23063 0.21% 139 23761 0.21% 140 24608 0.22% 141 24998 0.22% 142 26104 0.23% 143 26650 0.24% 144 27167 0.24% 145 28543 0.25% 146 28735 0.26% 147 29732 0.26% 148 30657 0.27% 149 30590 0.27% 150 31016 0.28% 151 10321906 91.91% 11230917 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=6.07 fanout-score-rank=22 prefix-density=0.27 prefix-fanout=3.2 sequence=AAGATCTGCATGCCACCACG criterion=fanout-score sequence-density=0.08 sequence-density-rank=17 fanout-score=154.02 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=26.7 sequence=ATCTTCTTCTTG criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=31 prefix-density=0.46 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=703.90 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=18.9 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR18694433 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:46:14 Started mapping on | Dec 10 06:46:14 Finished on | Dec 10 06:47:33 Mapping speed, Million of reads per hour | 511.79 Number of input reads | 11230917 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 10539369 Uniquely mapped reads % | 93.84% Average mapped length | 297.02 Number of splices: Total | 11619811 Number of splices: Annotated (sjdb) | 10943011 Number of splices: GT/AG | 11469206 Number of splices: GC/AG | 126500 Number of splices: AT/AC | 7563 Number of splices: Non-canonical | 16542 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.61 Insertion rate per base | 0.01% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 154163 % of reads mapped to multiple loci | 1.37% Number of reads mapped to too many loci | 24185 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.76% % of reads unmapped: other | 1.81% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 537385 537385 537385 N_multimapping 154163 154163 154163 N_noFeature 376542 10306355 448970 N_ambiguous 186960 1242 26910 UnstrandedReadsAssigned:9975867 PositiveStrandReadsAssigned:231772 NegativeStrandReadsAssigned:10063489 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694433 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694433-trimmed-pair1.fastq SRR18694433-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,230,917 reads, 10,187,885 reads pseudoaligned [quant] estimated average fragment length: 266.22 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52973 SRR18694433.ke.tsv 35125 SRR18694433.se.tsv 88098 total ==> SRR18694433.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 671.238 0 0 PNS24247 1044 778.78 27.6226 5.28076 PNS24249 1928 1662.78 55.4274 4.96291 PNS24246 1044 778.78 27.6226 5.28076 PNS24248 1044 778.78 27.6226 5.28076 PNS24244 1471 1205.78 69.7047 8.60677 PNS24243 293 89.3619 0 0 KQK14069 1603 1337.78 1095.06 121.87 KQK14071 474 230.566 12.3111 7.94964 ==> SRR18694433.se.tsv <== BRADI_1g14170v3 1176 BRADI_1g53295v3 35 BRADI_1g59795v3 207 BRADI_1g07683v3 0 BRADI_1g00485v3 28 BRADI_1g20270v3 590 BRADI_1g74790v3 36 BRADI_1g09890v3 0 BRADI_1g77505v3 55 BRADI_1g48960v3 0 SRR18694433 completed mapping pipeline successfully