Starting /dee2/code/volunteer_pipeline.sh SRR18694434 current disk space = 1526019239936 free memory = 1556102736 SRR18694434 SRAfilesize 610317fcf9f071ad24b1c1e5aac0ad0b SRR18694434.sra SRR18694434.sra file validated SRR18694434 is paired end SRR18694434 is conventional basespace SRR18694434 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694434_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.086 37.0 37.0 37.0 37.0 37.0 2 35.959 37.0 37.0 37.0 37.0 37.0 3 36.4315 37.0 37.0 37.0 37.0 37.0 4 36.524 37.0 37.0 37.0 37.0 37.0 5 36.572 37.0 37.0 37.0 37.0 37.0 6 36.5995 37.0 37.0 37.0 37.0 37.0 7 36.541 37.0 37.0 37.0 37.0 37.0 8 36.653 37.0 37.0 37.0 37.0 37.0 9 36.588 37.0 37.0 37.0 37.0 37.0 10-14 36.6178 37.0 37.0 37.0 37.0 37.0 15-19 36.6237 37.0 37.0 37.0 37.0 37.0 20-24 36.6468 37.0 37.0 37.0 37.0 37.0 25-29 36.5774 37.0 37.0 37.0 37.0 37.0 30-34 36.55329999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.7028 37.0 37.0 37.0 37.0 37.0 40-44 36.612199999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.454499999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.5466 37.0 37.0 37.0 37.0 37.0 55-59 36.5495 37.0 37.0 37.0 37.0 37.0 60-64 36.5301 37.0 37.0 37.0 37.0 37.0 65-69 36.281000000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.444599999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.5277 37.0 37.0 37.0 37.0 37.0 80-84 36.4448 37.0 37.0 37.0 37.0 37.0 85-89 36.235499999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.5243 37.0 37.0 37.0 29.8 37.0 95-99 36.2494 37.0 37.0 37.0 37.0 37.0 100-104 36.2675 37.0 37.0 37.0 37.0 37.0 105-109 36.2598 37.0 37.0 37.0 37.0 37.0 110-114 36.293400000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.5484 37.0 37.0 37.0 37.0 37.0 120-124 36.676 37.0 37.0 37.0 37.0 37.0 125-129 36.59740000000001 37.0 37.0 37.0 37.0 37.0 130-134 36.575700000000005 37.0 37.0 37.0 37.0 37.0 135-139 36.4822 37.0 37.0 37.0 37.0 37.0 140-144 36.3294 37.0 37.0 37.0 37.0 37.0 145-149 36.2873 37.0 37.0 37.0 37.0 37.0 150-151 33.653999999999996 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 0.0 26 2.0 27 0.0 28 2.0 29 2.0 30 11.0 31 20.0 32 24.0 33 48.0 34 87.0 35 324.0 36 3246.0 37 233.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.575 9.875 5.8500000000000005 37.7 2 22.738693467336685 9.623115577889447 36.10552763819096 31.532663316582916 3 20.549999999999997 13.425 23.225 42.8 4 25.775 19.0 22.525000000000002 32.7 5 28.499999999999996 25.8 23.549999999999997 22.15 6 25.624999999999996 27.375 22.0 25.0 7 20.525 25.0 36.449999999999996 18.025 8 21.5 23.225 29.5 25.775 9 20.125 19.525000000000002 33.675 26.674999999999997 10-14 24.085 25.41 25.174999999999997 25.330000000000002 15-19 23.945 24.685000000000002 25.040000000000003 26.33 20-24 23.76 24.035 25.82 26.384999999999998 25-29 24.16 23.985 25.215 26.640000000000004 30-34 24.834999999999997 23.715 25.285000000000004 26.165 35-39 24.295 24.545 24.91 26.25 40-44 24.15 24.65 24.785 26.415 45-49 23.535 24.275 25.19 27.0 50-54 24.47 24.03 24.39 27.11 55-59 24.215 24.044999999999998 25.205 26.534999999999997 60-64 24.67 23.18 24.7 27.450000000000003 65-69 24.73 23.69 25.28 26.3 70-74 24.884999999999998 23.635 24.94 26.540000000000003 75-79 25.4 23.810000000000002 24.555 26.235000000000003 80-84 24.285 25.05 24.82 25.845000000000002 85-89 25.395 23.885 24.465 26.255 90-94 24.85 24.23 24.435000000000002 26.484999999999996 95-99 25.305 23.27 24.63 26.795 100-104 25.31 24.58 24.13 25.979999999999997 105-109 25.669999999999998 23.685000000000002 23.91 26.735 110-114 25.415 23.145 24.4 27.04 115-119 24.990000000000002 24.345 24.035 26.63 120-124 25.130000000000003 24.09 23.895 26.884999999999998 125-129 24.099999999999998 24.41 24.305 27.185 130-134 25.45 24.255 24.02 26.275 135-139 24.85 24.32 23.57 27.26 140-144 25.569999999999997 24.515 23.630000000000003 26.284999999999997 145-149 25.765 24.235 24.25 25.75 150-151 25.887500000000003 25.224999999999998 23.5 25.387500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 0.5 28 2.5 29 5.0 30 3.5 31 7.0 32 15.0 33 17.0 34 20.0 35 25.0 36 36.0 37 51.5 38 63.5 39 89.0 40 100.5 41 109.0 42 135.0 43 160.5 44 183.0 45 198.5 46 187.0 47 174.5 48 174.0 49 169.0 50 161.0 51 135.0 52 120.0 53 111.5 54 106.0 55 103.5 56 95.5 57 87.5 58 86.0 59 89.0 60 96.5 61 94.5 62 87.0 63 83.0 64 71.0 65 71.0 66 75.5 67 65.5 68 56.0 69 59.0 70 51.5 71 36.0 72 31.0 73 26.0 74 26.0 75 21.5 76 7.5 77 4.0 78 7.5 79 5.0 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.925 #Duplication Level Percentage of deduplicated Percentage of total 1 86.9653767820774 74.725 2 10.503345941227815 18.05 3 1.9493744544661042 5.025 4 0.40733197556008144 1.4000000000000001 5 0.11638056444573756 0.5 6 0.05819028222286878 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGCTGAATTCCCTCTTCAAACCCTGTACTGTGGTCAGACTCTTGCGGCCA 6 0.15 No Hit GTTTATCACTTCTTCTCGTCCTTCTCTGCCTCAGCGGCCTTCTTCATCCG 6 0.15 No Hit CGCTGAATTCCTTCTTCAAACCCTGTACTGTGGTCAGACTCTTGCGGCCA 5 0.125 No Hit GTTAGGGTTGCCCAGGTAGTCCAGGCCGCCCTCGGAGAAGATCTGCGAGC 5 0.125 No Hit TGCACCTGATCCTTCCACCGTTGGAGACGCTGCCGAGACCAGCGCTGGCT 5 0.125 No Hit GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.9249999999999999 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.5125000000000002 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 2.075 0.0 0.0 0.0 0.0 110-111 2.2750000000000004 0.0 0.0 0.0 0.0 112-113 2.475 0.0 0.0 0.0 0.0 114-115 2.7 0.0 0.0 0.0 0.0 116-117 2.875 0.0 0.0 0.0 0.0 118-119 3.075 0.0 0.0 0.0 0.0 120-121 3.2249999999999996 0.0 0.0 0.0 0.0 122-123 3.5875 0.0 0.0 0.0 0.0 124-125 3.9875 0.0 0.0 0.0 0.0 126-127 4.25 0.0 0.0 0.0 0.0 128-129 4.725 0.0 0.0 0.0 0.0 130-131 5.1 0.0 0.0 0.0 0.0 132-133 5.7375 0.0 0.0 0.0 0.0 134-135 6.275 0.0 0.0 0.0 0.0 136-137 6.8125 0.0 0.0 0.0 0.0 138-139 7.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18694434 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694434_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.4595 37.0 37.0 37.0 25.0 37.0 2 35.383 37.0 37.0 37.0 37.0 37.0 3 35.296 37.0 37.0 37.0 37.0 37.0 4 35.564 37.0 37.0 37.0 37.0 37.0 5 35.398 37.0 37.0 37.0 37.0 37.0 6 35.562 37.0 37.0 37.0 37.0 37.0 7 35.4735 37.0 37.0 37.0 37.0 37.0 8 35.65 37.0 37.0 37.0 37.0 37.0 9 35.844 37.0 37.0 37.0 37.0 37.0 10-14 35.7914 37.0 37.0 37.0 37.0 37.0 15-19 35.8415 37.0 37.0 37.0 37.0 37.0 20-24 35.6629 37.0 37.0 37.0 37.0 37.0 25-29 35.7454 37.0 37.0 37.0 34.6 37.0 30-34 35.950599999999994 37.0 37.0 37.0 37.0 37.0 35-39 35.786699999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.574299999999994 37.0 37.0 37.0 34.6 37.0 45-49 35.6991 37.0 37.0 37.0 37.0 37.0 50-54 35.1725 37.0 37.0 37.0 34.6 37.0 55-59 34.5796 37.0 37.0 37.0 25.0 37.0 60-64 35.226800000000004 37.0 37.0 37.0 29.8 37.0 65-69 34.258500000000005 37.0 34.6 37.0 27.4 37.0 70-74 33.056799999999996 37.0 29.8 37.0 22.2 37.0 75-79 33.6285 37.0 34.6 37.0 22.2 37.0 80-84 34.7576 37.0 37.0 37.0 25.0 37.0 85-89 32.8546 37.0 32.2 37.0 19.4 37.0 90-94 34.3686 37.0 37.0 37.0 25.0 37.0 95-99 34.2323 37.0 37.0 37.0 25.0 37.0 100-104 33.689499999999995 37.0 37.0 37.0 25.0 37.0 105-109 34.364000000000004 37.0 37.0 37.0 25.0 37.0 110-114 34.8323 37.0 37.0 37.0 25.0 37.0 115-119 34.720299999999995 37.0 37.0 37.0 25.0 37.0 120-124 34.4136 37.0 37.0 37.0 25.0 37.0 125-129 34.170700000000004 37.0 37.0 37.0 25.0 37.0 130-134 34.06869999999999 37.0 37.0 37.0 25.0 37.0 135-139 32.2621 37.0 27.4 37.0 13.8 37.0 140-144 31.7478 37.0 25.0 37.0 11.0 37.0 145-149 31.2185 37.0 25.0 37.0 11.0 37.0 150-151 31.05175 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 2.0 17 2.0 18 8.0 19 4.0 20 1.0 21 0.0 22 4.0 23 5.0 24 4.0 25 3.0 26 12.0 27 15.0 28 21.0 29 24.0 30 67.0 31 100.0 32 222.0 33 505.0 34 1079.0 35 1661.0 36 260.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.175 19.725 8.450000000000001 30.65 2 30.599999999999998 22.175 25.3 21.925 3 23.5 22.575 28.999999999999996 24.925 4 27.525 28.1 19.85 24.525 5 29.875 31.275 18.325 20.525 6 23.225 33.7 19.1 23.974999999999998 7 23.925 18.75 33.324999999999996 24.0 8 22.525000000000002 22.825 24.25 30.4 9 24.425 20.775 26.1 28.7 10-14 26.724999999999998 25.240000000000002 22.43 25.605 15-19 27.35 23.974999999999998 23.01 25.665 20-24 27.05 24.275 22.85 25.825 25-29 26.75 24.14 22.855 26.255 30-34 26.729999999999997 24.36 23.474999999999998 25.435000000000002 35-39 26.96 24.545 23.035 25.46 40-44 26.38 23.91 23.645 26.064999999999998 45-49 26.97 24.345 22.91 25.775 50-54 25.840000000000003 24.47 24.51 25.180000000000003 55-59 26.46 24.29 22.994999999999997 26.255 60-64 27.365000000000002 24.0 23.294999999999998 25.34 65-69 26.69 24.135 23.195 25.979999999999997 70-74 26.974999999999998 23.49 23.945 25.590000000000003 75-79 28.235 22.765 23.18 25.82 80-84 26.474999999999998 24.595 23.095 25.835 85-89 24.395 27.01 22.71 25.885 90-94 26.515 24.255 23.77 25.46 95-99 26.33 24.235 23.54 25.895000000000003 100-104 26.855 24.675 23.165 25.305 105-109 26.735 24.94 23.075000000000003 25.25 110-114 26.640000000000004 24.91 23.14 25.31 115-119 27.295 24.84 23.145 24.72 120-124 27.55 24.795 23.189999999999998 24.465 125-129 27.084999999999997 24.265 23.775 24.875 130-134 28.215 24.605 23.185 23.995 135-139 27.925 24.89 23.07 24.115000000000002 140-144 27.625 24.94 23.400000000000002 24.035 145-149 28.060000000000002 24.79 23.145 24.005000000000003 150-151 26.2625 24.762500000000003 25.35 23.625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 0.5 26 3.0 27 5.0 28 2.5 29 1.5 30 4.5 31 10.0 32 11.5 33 11.0 34 15.0 35 22.5 36 29.0 37 36.5 38 53.0 39 80.0 40 94.5 41 116.5 42 137.0 43 151.0 44 157.5 45 162.0 46 176.0 47 161.5 48 159.0 49 152.5 50 117.0 51 115.5 52 112.0 53 97.5 54 100.5 55 107.5 56 100.0 57 99.0 58 126.0 59 122.5 60 106.0 61 104.0 62 104.0 63 101.0 64 89.0 65 80.0 66 82.5 67 79.5 68 76.5 69 64.5 70 53.0 71 46.0 72 34.5 73 33.0 74 28.5 75 18.0 76 12.5 77 8.5 78 5.5 79 4.5 80 2.0 81 4.0 82 3.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 1.5 89 2.0 90 0.5 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 87.72437753329473 75.75 2 9.814707585408222 16.950000000000003 3 1.8529241459177763 4.8 4 0.4342790966994789 1.5 5 0.05790387955993051 0.25 6 0.05790387955993051 0.3 7 0.028951939779965255 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.028951939779965255 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGGTTGATCTCCTCTTCGACCACCTCCGAGGTTCTTGGTGTAGCTTTT 11 0.27499999999999997 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 7 0.17500000000000002 No Hit GGTGATTCTACCCCAGAGGAGCTTGCTACTGCAACCCAGGTCCAGGGTGA 6 0.15 No Hit CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 6 0.15 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 5 0.125 No Hit CAGAGACGTTCGCCAAGAACAGGGAGCTCGAGGTGATCCACTCTCGTTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.3624999999999998 0.0 0.0 0.0 0.0 106-107 1.5 0.0 0.0 0.0 0.0 108-109 1.925 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.325 0.0 0.0 0.0 0.0 114-115 2.55 0.0 0.0 0.0 0.0 116-117 2.75 0.0 0.0 0.0 0.0 118-119 2.975 0.0 0.0 0.0 0.0 120-121 3.125 0.0 0.0 0.0 0.0 122-123 3.4875 0.0 0.0 0.0 0.0 124-125 3.8875 0.0 0.0 0.0 0.0 126-127 4.15 0.0 0.0 0.0 0.0 128-129 4.612500000000001 0.0 0.0 0.0 0.0 130-131 4.975 0.0 0.0 0.0 0.0 132-133 5.5875 0.0 0.0 0.0 0.0 134-135 6.125 0.0 0.0 0.0 0.0 136-137 6.6625 0.0 0.0 0.0 0.0 138-139 7.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 800971 spots for SRR18694434.sra Written 800971 spots for SRR18694434.sra Read 800971 spots for SRR18694434.sra Written 800971 spots for SRR18694434.sra Read 800971 spots for SRR18694434.sra Written 800971 spots for SRR18694434.sra Read 800971 spots for SRR18694434.sra Written 800971 spots for SRR18694434.sra Read 800987 spots for SRR18694434.sra Written 800987 spots for SRR18694434.sra Read 800971 spots for SRR18694434.sra Written 800971 spots for SRR18694434.sra Read 800971 spots for SRR18694434.sra Written 800971 spots for SRR18694434.sra Read 800971 spots for SRR18694434.sra Written 800971 spots for SRR18694434.sra Read 800971 spots for SRR18694434.sra Written 800971 spots for SRR18694434.sra Read 800971 spots for SRR18694434.sra Written 800971 spots for SRR18694434.sra Read 800971 spots for SRR18694434.sra Written 800971 spots for SRR18694434.sra Read 800971 spots for SRR18694434.sra Written 800971 spots for SRR18694434.sra Read 800971 spots for SRR18694434.sra Written 800971 spots for SRR18694434.sra Read 800971 spots for SRR18694434.sra Written 800971 spots for SRR18694434.sra Read 800971 spots for SRR18694434.sra Written 800971 spots for SRR18694434.sra Read 800971 spots for SRR18694434.sra Written 800971 spots for SRR18694434.sra Read 800971 spots for SRR18694434.sra Written 800971 spots for SRR18694434.sra Read 800971 spots for SRR18694434.sra Written 800971 spots for SRR18694434.sra Read 800971 spots for SRR18694434.sra Written 800971 spots for SRR18694434.sra Read 800971 spots for SRR18694434.sra Written 800971 spots for SRR18694434.sra SRR ids: ['SRR18694434.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e17to23w SRR18694434.sra spots: 16019436 blocks: [[1, 800971], [800972, 1601942], [1601943, 2402913], [2402914, 3203884], [3203885, 4004855], [4004856, 4805826], [4805827, 5606797], [5606798, 6407768], [6407769, 7208739], [7208740, 8009710], [8009711, 8810681], [8810682, 9611652], [9611653, 10412623], [10412624, 11213594], [11213595, 12014565], [12014566, 12815536], [12815537, 13616507], [13616508, 14417478], [14417479, 15218449], [15218450, 16019436]] SRR18694434 file size 5422404 SRR18694434 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694434 SRR18694434_1.fastq SRR18694434_2.fastq Input file: SRR18694434_1.fastq Paired file: SRR18694434_2.fastq trimmed: SRR18694434-trimmed-pair1.fastq, SRR18694434-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:46:08 2024 >> started Tue Dec 10 06:46:30 2024 >> done (21.632s) 16019436 read pairs processed; of these: 155 ( 0.00%) short read pairs filtered out after trimming by size control 8283 ( 0.05%) empty read pairs filtered out after trimming by size control 16010998 (99.95%) read pairs available; of these: 1797010 (11.22%) trimmed read pairs available after processing 14213988 (88.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 7 0.00% 20 13 0.00% 21 11 0.00% 22 26 0.00% 23 25 0.00% 24 12 0.00% 25 33 0.00% 26 21 0.00% 27 35 0.00% 28 43 0.00% 29 38 0.00% 30 41 0.00% 31 46 0.00% 32 40 0.00% 33 33 0.00% 34 34 0.00% 35 53 0.00% 36 33 0.00% 37 58 0.00% 38 40 0.00% 39 53 0.00% 40 55 0.00% 41 77 0.00% 42 57 0.00% 43 56 0.00% 44 61 0.00% 45 75 0.00% 46 73 0.00% 47 82 0.00% 48 77 0.00% 49 99 0.00% 50 96 0.00% 51 153 0.00% 52 130 0.00% 53 127 0.00% 54 110 0.00% 55 126 0.00% 56 155 0.00% 57 179 0.00% 58 246 0.00% 59 202 0.00% 60 292 0.00% 61 300 0.00% 62 337 0.00% 63 384 0.00% 64 451 0.00% 65 467 0.00% 66 568 0.00% 67 612 0.00% 68 660 0.00% 69 813 0.01% 70 855 0.01% 71 1024 0.01% 72 1203 0.01% 73 1245 0.01% 74 1397 0.01% 75 1636 0.01% 76 1747 0.01% 77 1878 0.01% 78 2094 0.01% 79 2484 0.02% 80 2572 0.02% 81 3045 0.02% 82 3239 0.02% 83 3719 0.02% 84 3974 0.02% 85 4499 0.03% 86 4576 0.03% 87 4855 0.03% 88 5631 0.04% 89 5763 0.04% 90 6090 0.04% 91 6550 0.04% 92 7097 0.04% 93 7722 0.05% 94 8198 0.05% 95 8672 0.05% 96 9127 0.06% 97 9763 0.06% 98 10015 0.06% 99 10586 0.07% 100 11147 0.07% 101 11920 0.07% 102 12489 0.08% 103 13295 0.08% 104 14117 0.09% 105 14619 0.09% 106 15410 0.10% 107 16012 0.10% 108 16865 0.11% 109 17438 0.11% 110 17859 0.11% 111 19015 0.12% 112 19930 0.12% 113 20347 0.13% 114 21236 0.13% 115 22497 0.14% 116 23357 0.15% 117 23915 0.15% 118 25378 0.16% 119 25613 0.16% 120 26676 0.17% 121 27349 0.17% 122 27506 0.17% 123 29317 0.18% 124 30698 0.19% 125 31287 0.20% 126 32523 0.20% 127 33405 0.21% 128 34581 0.22% 129 35945 0.22% 130 36234 0.23% 131 37196 0.23% 132 38471 0.24% 133 39927 0.25% 134 40311 0.25% 135 41933 0.26% 136 42510 0.27% 137 43572 0.27% 138 43949 0.27% 139 44887 0.28% 140 46253 0.29% 141 47337 0.30% 142 48317 0.30% 143 49407 0.31% 144 50667 0.32% 145 52144 0.33% 146 52234 0.33% 147 54204 0.34% 148 55140 0.34% 149 55267 0.35% 150 56215 0.35% 151 14213988 88.78% 16010998 reads passed initial QC criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=16 prefix-density=0.97 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=32 fanout-score=93.63 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=10.2 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=26 prefix-density=0.71 prefix-fanout=2.0 sequence=CCCATGTTCGGGTGCACCGACGCCACGCAGGTGCTAAAGGAGCTGGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=10.68 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.6 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR18694434 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:47:17 Started mapping on | Dec 10 06:47:17 Finished on | Dec 10 06:49:33 Mapping speed, Million of reads per hour | 423.82 Number of input reads | 16010998 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15079011 Uniquely mapped reads % | 94.18% Average mapped length | 295.53 Number of splices: Total | 15080791 Number of splices: Annotated (sjdb) | 14180831 Number of splices: GT/AG | 14867106 Number of splices: GC/AG | 183397 Number of splices: AT/AC | 5555 Number of splices: Non-canonical | 24733 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 2.44 Insertion rate per base | 0.01% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 215843 % of reads mapped to multiple loci | 1.35% Number of reads mapped to too many loci | 30875 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.59% % of reads unmapped: other | 1.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 716144 716144 716144 N_multimapping 215843 215843 215843 N_noFeature 630872 14649252 736549 N_ambiguous 382173 1935 58260 UnstrandedReadsAssigned:14065966 PositiveStrandReadsAssigned:427824 NegativeStrandReadsAssigned:14284202 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694434 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694434-trimmed-pair1.fastq SRR18694434-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,010,998 reads, 14,428,487 reads pseudoaligned [quant] estimated average fragment length: 249.318 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52973 SRR18694434.ke.tsv 35125 SRR18694434.se.tsv 88098 total ==> SRR18694434.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 688.054 0 0 PNS24247 1044 795.682 39.2228 4.50955 PNS24249 1928 1679.68 60.9603 3.32012 PNS24246 1044 795.682 39.2228 4.50955 PNS24248 1044 795.682 39.2228 4.50955 PNS24244 1471 1222.68 57.3714 4.29256 PNS24243 293 96.0265 0 0 KQK14069 1603 1354.68 2746.95 185.502 KQK14071 474 242.835 77.1434 29.0618 ==> SRR18694434.se.tsv <== BRADI_1g14170v3 3036 BRADI_1g53295v3 43 BRADI_1g59795v3 651 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 257 BRADI_1g74790v3 138 BRADI_1g09890v3 0 BRADI_1g77505v3 163 BRADI_1g48960v3 0 SRR18694434 completed mapping pipeline successfully