Starting /dee2/code/volunteer_pipeline.sh SRR18694435 current disk space = 1525991763968 free memory = 1599810872 SRR18694435 SRAfilesize 5752080adc39e4c9f6ae744f90b63e23 SRR18694435.sra SRR18694435.sra file validated SRR18694435 is paired end SRR18694435 is conventional basespace SRR18694435 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694435_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.176 37.0 37.0 37.0 37.0 37.0 2 35.935 37.0 37.0 37.0 37.0 37.0 3 36.4565 37.0 37.0 37.0 37.0 37.0 4 36.5435 37.0 37.0 37.0 37.0 37.0 5 36.5225 37.0 37.0 37.0 37.0 37.0 6 36.542 37.0 37.0 37.0 37.0 37.0 7 36.5015 37.0 37.0 37.0 37.0 37.0 8 36.567 37.0 37.0 37.0 37.0 37.0 9 36.614 37.0 37.0 37.0 37.0 37.0 10-14 36.6302 37.0 37.0 37.0 37.0 37.0 15-19 36.6145 37.0 37.0 37.0 37.0 37.0 20-24 36.6254 37.0 37.0 37.0 37.0 37.0 25-29 36.524800000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.5135 37.0 37.0 37.0 37.0 37.0 35-39 36.6258 37.0 37.0 37.0 37.0 37.0 40-44 36.5971 37.0 37.0 37.0 37.0 37.0 45-49 36.3557 37.0 37.0 37.0 37.0 37.0 50-54 36.4503 37.0 37.0 37.0 37.0 37.0 55-59 36.5197 37.0 37.0 37.0 37.0 37.0 60-64 36.5205 37.0 37.0 37.0 37.0 37.0 65-69 36.3131 37.0 37.0 37.0 37.0 37.0 70-74 36.370799999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.4688 37.0 37.0 37.0 37.0 37.0 80-84 36.361200000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.20269999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.3658 37.0 37.0 37.0 29.8 37.0 95-99 36.060900000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.1311 37.0 37.0 37.0 37.0 37.0 105-109 36.1555 37.0 37.0 37.0 37.0 37.0 110-114 36.1757 37.0 37.0 37.0 37.0 37.0 115-119 36.479699999999994 37.0 37.0 37.0 37.0 37.0 120-124 36.5371 37.0 37.0 37.0 37.0 37.0 125-129 36.4753 37.0 37.0 37.0 37.0 37.0 130-134 36.4721 37.0 37.0 37.0 37.0 37.0 135-139 36.3985 37.0 37.0 37.0 37.0 37.0 140-144 36.2456 37.0 37.0 37.0 37.0 37.0 145-149 36.2239 37.0 37.0 37.0 37.0 37.0 150-151 33.72125 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 0.0 24 0.0 25 2.0 26 5.0 27 3.0 28 4.0 29 7.0 30 6.0 31 11.0 32 21.0 33 63.0 34 119.0 35 374.0 36 3199.0 37 184.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.075 10.125 4.625 37.175000000000004 2 21.52184831742843 9.090909090909092 38.448016072325466 30.939226519337016 3 20.5 13.075000000000001 24.875 41.55 4 27.325 19.975 22.325 30.375000000000004 5 26.700000000000003 27.375 22.375 23.549999999999997 6 23.674999999999997 30.075000000000003 22.175 24.075 7 18.925 27.0 37.574999999999996 16.5 8 20.4 22.35 31.25 26.0 9 18.625 19.5 35.15 26.724999999999998 10-14 22.97 26.235000000000003 25.94 24.855 15-19 23.185 25.650000000000002 26.11 25.055 20-24 23.325000000000003 24.55 26.35 25.775 25-29 23.064999999999998 25.165 26.07 25.7 30-34 23.04 24.69 25.735000000000003 26.534999999999997 35-39 22.64 25.595000000000002 25.15 26.615 40-44 23.43 25.564999999999998 24.94 26.064999999999998 45-49 23.849999999999998 25.77 24.895 25.485000000000003 50-54 22.955000000000002 25.31 25.64 26.095000000000002 55-59 23.195 25.005 25.195 26.605 60-64 23.265 24.81 25.91 26.015 65-69 23.39 25.715 25.34 25.555 70-74 23.69 25.080000000000002 25.15 26.08 75-79 23.13 25.585 24.834999999999997 26.450000000000003 80-84 23.26 25.130000000000003 25.395 26.215 85-89 23.575 25.395 24.92 26.11 90-94 23.91 25.025 25.615 25.45 95-99 23.87 25.324999999999996 25.03 25.775 100-104 23.330000000000002 25.595000000000002 25.474999999999998 25.6 105-109 24.725 24.654999999999998 25.21 25.41 110-114 23.51 25.28 24.98 26.229999999999997 115-119 24.135 25.069999999999997 25.264999999999997 25.53 120-124 23.169999999999998 25.34 25.095 26.395000000000003 125-129 23.985 25.230000000000004 24.315 26.47 130-134 24.07 25.995 24.685000000000002 25.25 135-139 24.215 26.115 24.625 25.045 140-144 24.455 25.25 24.975 25.319999999999997 145-149 24.925 25.2 24.05 25.825 150-151 23.9 25.6125 24.175 26.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 0.5 24 0.5 25 1.0 26 1.5 27 1.5 28 2.0 29 5.5 30 8.0 31 10.5 32 17.0 33 22.0 34 27.0 35 31.5 36 38.0 37 55.0 38 77.5 39 99.5 40 119.5 41 147.5 42 166.5 43 177.5 44 188.0 45 206.5 46 230.0 47 213.5 48 179.0 49 170.0 50 168.5 51 141.5 52 116.0 53 116.0 54 101.0 55 77.0 56 87.5 57 91.5 58 84.0 59 78.0 60 72.0 61 77.0 62 63.0 63 57.0 64 68.0 65 71.5 66 64.0 67 49.5 68 49.5 69 48.0 70 34.0 71 24.5 72 20.0 73 16.5 74 12.5 75 5.5 76 2.0 77 1.5 78 0.5 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 86.26244874048038 73.625 2 11.013473930872877 18.8 3 2.0796719390743994 5.325 4 0.5858230814294083 2.0 5 0.05858230814294083 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGTTATCTCGTTCACTTCTCGGAGCGCCACCGCCGGCACCTCGATCGT 5 0.125 No Hit GCTTCATCTACCCGGGCCTGTGCTTCAATGTAGCTTGGGAAGTCATAGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.48750000000000004 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.325 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.6375 0.0 0.0 0.0 0.0 108-109 1.8 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.7625 0.0 0.0 0.0 0.0 116-117 3.0 0.0 0.0 0.0 0.0 118-119 3.2750000000000004 0.0 0.0 0.0 0.0 120-121 3.5250000000000004 0.0 0.0 0.0 0.0 122-123 3.7875 0.0 0.0 0.0 0.0 124-125 4.1 0.0 0.0 0.0 0.0 126-127 4.5 0.0 0.0 0.0 0.0 128-129 4.975 0.0 0.0 0.0 0.0 130-131 5.4375 0.0 0.0 0.0 0.0 132-133 5.9375 0.0 0.0 0.0 0.0 134-135 6.300000000000001 0.0 0.0 0.0 0.0 136-137 6.8125 0.0 0.0 0.0 0.0 138-139 7.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGAAG 10 0.006830828 145.0 6 TCCATTA 10 0.006830828 145.0 145 CCCCTCT 10 0.006830828 145.0 3 CAGAAGC 10 0.006830828 145.0 7 >>END_MODULE SRR18694435 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694435_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.388 37.0 37.0 37.0 25.0 37.0 2 35.211 37.0 37.0 37.0 25.0 37.0 3 35.2125 37.0 37.0 37.0 25.0 37.0 4 35.297 37.0 37.0 37.0 25.0 37.0 5 35.1815 37.0 37.0 37.0 25.0 37.0 6 35.313 37.0 37.0 37.0 37.0 37.0 7 35.3625 37.0 37.0 37.0 25.0 37.0 8 35.4495 37.0 37.0 37.0 37.0 37.0 9 35.583 37.0 37.0 37.0 37.0 37.0 10-14 35.584700000000005 37.0 37.0 37.0 37.0 37.0 15-19 35.6293 37.0 37.0 37.0 37.0 37.0 20-24 35.4602 37.0 37.0 37.0 34.6 37.0 25-29 35.5749 37.0 37.0 37.0 34.6 37.0 30-34 35.782000000000004 37.0 37.0 37.0 37.0 37.0 35-39 35.635999999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.3673 37.0 37.0 37.0 29.8 37.0 45-49 35.5176 37.0 37.0 37.0 37.0 37.0 50-54 34.9713 37.0 37.0 37.0 32.2 37.0 55-59 34.3963 37.0 37.0 37.0 25.0 37.0 60-64 35.0695 37.0 37.0 37.0 27.4 37.0 65-69 34.292199999999994 37.0 34.6 37.0 27.4 37.0 70-74 33.0363 37.0 29.8 37.0 22.2 37.0 75-79 33.5592 37.0 34.6 37.0 22.2 37.0 80-84 34.6024 37.0 37.0 37.0 25.0 37.0 85-89 32.666 37.0 32.2 37.0 19.4 37.0 90-94 34.0945 37.0 37.0 37.0 25.0 37.0 95-99 33.9212 37.0 37.0 37.0 25.0 37.0 100-104 33.5103 37.0 37.0 37.0 25.0 37.0 105-109 34.212599999999995 37.0 37.0 37.0 25.0 37.0 110-114 34.6006 37.0 37.0 37.0 25.0 37.0 115-119 34.460899999999995 37.0 37.0 37.0 25.0 37.0 120-124 34.11149999999999 37.0 37.0 37.0 25.0 37.0 125-129 34.082300000000004 37.0 37.0 37.0 25.0 37.0 130-134 33.736599999999996 37.0 34.6 37.0 25.0 37.0 135-139 32.1515 37.0 27.4 37.0 13.8 37.0 140-144 31.550599999999996 37.0 25.0 37.0 11.0 37.0 145-149 31.1803 37.0 25.0 37.0 11.0 37.0 150-151 30.89575 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 5.0 17 1.0 18 4.0 19 1.0 20 2.0 21 3.0 22 4.0 23 3.0 24 8.0 25 14.0 26 11.0 27 12.0 28 22.0 29 31.0 30 71.0 31 143.0 32 304.0 33 523.0 34 1134.0 35 1488.0 36 215.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.475 22.225 8.525 27.775 2 30.225 22.275 27.875 19.625 3 23.275000000000002 24.8 28.925 23.0 4 25.224999999999998 31.175000000000004 21.2 22.400000000000002 5 30.75 31.5 17.325 20.424999999999997 6 23.925 35.825 19.2 21.05 7 23.1 20.05 33.975 22.875 8 22.35 22.75 25.6 29.299999999999997 9 22.775000000000002 21.775 28.825 26.625 10-14 25.685000000000002 25.779999999999998 23.68 24.855 15-19 25.945 25.36 24.025 24.67 20-24 25.865 25.36 24.135 24.64 25-29 26.16 24.89 24.72 24.23 30-34 25.629999999999995 24.69 25.119999999999997 24.560000000000002 35-39 25.83 25.2 24.240000000000002 24.73 40-44 25.41 25.16 24.834999999999997 24.595 45-49 25.919999999999998 24.85 24.72 24.51 50-54 25.435000000000002 24.7 25.605 24.26 55-59 25.71 24.27 24.955 25.064999999999998 60-64 26.179999999999996 24.88 24.795 24.145 65-69 25.735000000000003 25.415 24.759999999999998 24.09 70-74 26.815 24.755 24.05 24.38 75-79 27.725 23.915 24.65 23.71 80-84 26.13 25.545 24.58 23.745 85-89 23.885 27.765 24.154999999999998 24.195 90-94 26.155 24.86 25.314999999999998 23.669999999999998 95-99 26.090000000000003 25.695 23.94 24.275 100-104 26.555 25.575 23.95 23.919999999999998 105-109 25.89 25.785000000000004 24.795 23.53 110-114 26.55 24.779999999999998 24.875 23.794999999999998 115-119 27.13 25.314999999999998 24.05 23.505000000000003 120-124 26.415 25.6 24.75 23.235 125-129 26.314999999999998 24.965 25.509999999999998 23.21 130-134 26.85 25.295 24.86 22.994999999999997 135-139 27.1 25.729999999999997 24.36 22.81 140-144 27.245 25.81 24.18 22.765 145-149 27.375 24.945 24.740000000000002 22.939999999999998 150-151 25.0125 25.3 26.974999999999998 22.7125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 1.0 24 0.0 25 0.5 26 0.5 27 3.0 28 5.5 29 6.5 30 10.5 31 13.0 32 11.0 33 13.5 34 23.5 35 33.0 36 38.0 37 47.5 38 71.0 39 88.5 40 112.0 41 140.0 42 165.0 43 186.5 44 192.0 45 193.5 46 186.0 47 177.5 48 171.5 49 166.5 50 153.0 51 125.5 52 111.5 53 111.5 54 108.0 55 101.5 56 95.5 57 90.5 58 95.0 59 99.0 60 97.0 61 93.0 62 93.0 63 94.0 64 82.5 65 70.0 66 63.5 67 55.0 68 40.0 69 36.0 70 35.0 71 27.0 72 20.5 73 13.0 74 7.5 75 6.5 76 5.5 77 4.0 78 2.0 79 0.5 80 0.5 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.95 #Duplication Level Percentage of deduplicated Percentage of total 1 87.63657274295572 76.2 2 10.293271995399655 17.9 3 1.5526164462334675 4.05 4 0.46003450258769407 1.6 5 0.05750431282346176 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit GTTCAAACCAGACCCACGCTTTGAAGAAGCCAAGCAACTTGTAAGGAGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.36250000000000004 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.2 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.5125 0.0 0.0 0.0 0.0 108-109 1.675 0.0 0.0 0.0 0.0 110-111 1.95 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 2.8625 0.0 0.0 0.0 0.0 118-119 3.125 0.0 0.0 0.0 0.0 120-121 3.375 0.0 0.0 0.0 0.0 122-123 3.6375 0.0 0.0 0.0 0.0 124-125 3.9375 0.0 0.0 0.0 0.0 126-127 4.325 0.0 0.0 0.0 0.0 128-129 4.800000000000001 0.0 0.0 0.0 0.0 130-131 5.2625 0.0 0.0 0.0 0.0 132-133 5.7625 0.0 0.0 0.0 0.0 134-135 6.125 0.0 0.0 0.0 0.0 136-137 6.6 0.0 0.0 0.0 0.0 138-139 6.949999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCCGCG 10 0.006830828 145.0 3 GCGGAGC 10 0.006830828 145.0 2 AAGTGTC 10 0.006830828 145.0 6 GGCGGAG 10 0.006830828 145.0 1 >>END_MODULE Read 784505 spots for SRR18694435.sra Written 784505 spots for SRR18694435.sra Read 784505 spots for SRR18694435.sra Written 784505 spots for SRR18694435.sra Read 784505 spots for SRR18694435.sra Written 784505 spots for SRR18694435.sra Read 784505 spots for SRR18694435.sra Written 784505 spots for SRR18694435.sra Read 784505 spots for SRR18694435.sra Written 784505 spots for SRR18694435.sra Read 784505 spots for SRR18694435.sra Written 784505 spots for SRR18694435.sra Read 784505 spots for SRR18694435.sra Written 784505 spots for SRR18694435.sra Read 784505 spots for SRR18694435.sra Written 784505 spots for SRR18694435.sra Read 784505 spots for SRR18694435.sra Written 784505 spots for SRR18694435.sra Read 784512 spots for SRR18694435.sra Written 784512 spots for SRR18694435.sra Read 784505 spots for SRR18694435.sra Written 784505 spots for SRR18694435.sra Read 784505 spots for SRR18694435.sra Written 784505 spots for SRR18694435.sra Read 784505 spots for SRR18694435.sra Written 784505 spots for SRR18694435.sra Read 784505 spots for SRR18694435.sra Written 784505 spots for SRR18694435.sra Read 784505 spots for SRR18694435.sra Written 784505 spots for SRR18694435.sra Read 784505 spots for SRR18694435.sra Written 784505 spots for SRR18694435.sra Read 784505 spots for SRR18694435.sra Written 784505 spots for SRR18694435.sra Read 784505 spots for SRR18694435.sra Written 784505 spots for SRR18694435.sra Read 784505 spots for SRR18694435.sra Written 784505 spots for SRR18694435.sra Read 784505 spots for SRR18694435.sra Written 784505 spots for SRR18694435.sra SRR ids: ['SRR18694435.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gasr1ok9 SRR18694435.sra spots: 15690107 blocks: [[1, 784505], [784506, 1569010], [1569011, 2353515], [2353516, 3138020], [3138021, 3922525], [3922526, 4707030], [4707031, 5491535], [5491536, 6276040], [6276041, 7060545], [7060546, 7845050], [7845051, 8629555], [8629556, 9414060], [9414061, 10198565], [10198566, 10983070], [10983071, 11767575], [11767576, 12552080], [12552081, 13336585], [13336586, 14121090], [14121091, 14905595], [14905596, 15690107]] SRR18694435 file size 5310484 SRR18694435 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694435 SRR18694435_1.fastq SRR18694435_2.fastq Input file: SRR18694435_1.fastq Paired file: SRR18694435_2.fastq trimmed: SRR18694435-trimmed-pair1.fastq, SRR18694435-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:47:08 2024 >> started Tue Dec 10 06:47:25 2024 >> done (17.749s) 15690107 read pairs processed; of these: 220 ( 0.00%) short read pairs filtered out after trimming by size control 6766 ( 0.04%) empty read pairs filtered out after trimming by size control 15683121 (99.96%) read pairs available; of these: 1904441 (12.14%) trimmed read pairs available after processing 13778680 (87.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 21 0.00% 20 19 0.00% 21 25 0.00% 22 18 0.00% 23 22 0.00% 24 23 0.00% 25 32 0.00% 26 36 0.00% 27 43 0.00% 28 38 0.00% 29 29 0.00% 30 30 0.00% 31 44 0.00% 32 43 0.00% 33 37 0.00% 34 51 0.00% 35 60 0.00% 36 51 0.00% 37 63 0.00% 38 67 0.00% 39 60 0.00% 40 64 0.00% 41 74 0.00% 42 85 0.00% 43 59 0.00% 44 59 0.00% 45 72 0.00% 46 93 0.00% 47 88 0.00% 48 88 0.00% 49 89 0.00% 50 116 0.00% 51 129 0.00% 52 139 0.00% 53 142 0.00% 54 169 0.00% 55 167 0.00% 56 187 0.00% 57 196 0.00% 58 223 0.00% 59 240 0.00% 60 299 0.00% 61 352 0.00% 62 412 0.00% 63 452 0.00% 64 510 0.00% 65 517 0.00% 66 558 0.00% 67 654 0.00% 68 756 0.00% 69 792 0.01% 70 992 0.01% 71 1114 0.01% 72 1135 0.01% 73 1386 0.01% 74 1480 0.01% 75 1790 0.01% 76 1848 0.01% 77 2001 0.01% 78 2262 0.01% 79 2662 0.02% 80 2907 0.02% 81 3160 0.02% 82 3740 0.02% 83 4135 0.03% 84 4375 0.03% 85 4634 0.03% 86 4958 0.03% 87 5434 0.03% 88 5970 0.04% 89 6255 0.04% 90 6506 0.04% 91 7477 0.05% 92 7986 0.05% 93 8358 0.05% 94 8916 0.06% 95 9402 0.06% 96 9982 0.06% 97 10705 0.07% 98 10869 0.07% 99 11879 0.08% 100 12332 0.08% 101 13341 0.09% 102 13955 0.09% 103 14515 0.09% 104 15310 0.10% 105 16018 0.10% 106 16930 0.11% 107 17435 0.11% 108 17744 0.11% 109 18976 0.12% 110 19431 0.12% 111 20162 0.13% 112 21778 0.14% 113 21995 0.14% 114 23839 0.15% 115 24564 0.16% 116 24833 0.16% 117 26274 0.17% 118 26452 0.17% 119 27382 0.17% 120 28942 0.18% 121 29336 0.19% 122 30316 0.19% 123 31839 0.20% 124 33460 0.21% 125 33844 0.22% 126 34806 0.22% 127 35297 0.23% 128 36507 0.23% 129 37931 0.24% 130 38002 0.24% 131 39035 0.25% 132 40292 0.26% 133 41893 0.27% 134 42910 0.27% 135 44033 0.28% 136 44728 0.29% 137 45152 0.29% 138 46046 0.29% 139 47473 0.30% 140 47866 0.31% 141 48241 0.31% 142 50289 0.32% 143 50453 0.32% 144 52549 0.34% 145 54311 0.35% 146 54173 0.35% 147 56754 0.36% 148 56952 0.36% 149 56589 0.36% 150 58226 0.37% 151 13778680 87.86% 15683121 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=24 prefix-density=0.67 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=100.67 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=13.0 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=28 prefix-density=0.71 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.20 sequence-density-rank=24 fanout-score=9.12 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=4.3 sequence=CAGGCCATCGTCACCGGCAA SRR18694435 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:48:18 Started mapping on | Dec 10 06:48:18 Finished on | Dec 10 06:49:49 Mapping speed, Million of reads per hour | 620.43 Number of input reads | 15683121 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14775244 Uniquely mapped reads % | 94.21% Average mapped length | 294.72 Number of splices: Total | 15070652 Number of splices: Annotated (sjdb) | 14101303 Number of splices: GT/AG | 14852629 Number of splices: GC/AG | 183926 Number of splices: AT/AC | 6093 Number of splices: Non-canonical | 28004 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.39 Insertion rate per base | 0.01% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 229362 % of reads mapped to multiple loci | 1.46% Number of reads mapped to too many loci | 21366 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.09% % of reads unmapped: other | 1.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 678515 678515 678515 N_multimapping 229362 229362 229362 N_noFeature 803347 14353599 930904 N_ambiguous 354721 2123 61224 UnstrandedReadsAssigned:13617176 PositiveStrandReadsAssigned:419522 NegativeStrandReadsAssigned:13783116 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694435 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694435-trimmed-pair1.fastq SRR18694435-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,683,121 reads, 13,976,779 reads pseudoaligned [quant] estimated average fragment length: 252.945 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52973 SRR18694435.ke.tsv 35125 SRR18694435.se.tsv 88098 total ==> SRR18694435.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 684.535 0 0 PNS24247 1044 792.055 81.093 10.5786 PNS24249 1928 1676.06 44.303 2.73116 PNS24246 1044 792.055 81.093 10.5786 PNS24248 1044 792.055 81.093 10.5786 PNS24244 1471 1219.06 90.418 7.66361 PNS24243 293 97.9124 0 0 KQK14069 1603 1351.06 1080.84 82.6592 KQK14071 474 242.588 11.2667 4.79878 ==> SRR18694435.se.tsv <== BRADI_1g14170v3 1248 BRADI_1g53295v3 61 BRADI_1g59795v3 1016 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 298 BRADI_1g74790v3 121 BRADI_1g09890v3 0 BRADI_1g77505v3 160 BRADI_1g48960v3 2 SRR18694435 completed mapping pipeline successfully