Starting /dee2/code/volunteer_pipeline.sh SRR18694436 current disk space = 1525988147200 free memory = 1422257852 SRR18694436 SRAfilesize ef13fff1403890a9685cf1cf3f9b09ed SRR18694436.sra SRR18694436.sra file validated SRR18694436 is paired end SRR18694436 is conventional basespace SRR18694436 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694436_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1525 37.0 37.0 37.0 37.0 37.0 2 36.03325 37.0 37.0 37.0 37.0 37.0 3 36.447 37.0 37.0 37.0 37.0 37.0 4 36.56 37.0 37.0 37.0 37.0 37.0 5 36.518 37.0 37.0 37.0 37.0 37.0 6 36.511 37.0 37.0 37.0 37.0 37.0 7 36.6255 37.0 37.0 37.0 37.0 37.0 8 36.617 37.0 37.0 37.0 37.0 37.0 9 36.701 37.0 37.0 37.0 37.0 37.0 10-14 36.64019999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.5573 37.0 37.0 37.0 37.0 37.0 20-24 36.6499 37.0 37.0 37.0 37.0 37.0 25-29 36.5419 37.0 37.0 37.0 37.0 37.0 30-34 36.509100000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.6827 37.0 37.0 37.0 37.0 37.0 40-44 36.5828 37.0 37.0 37.0 37.0 37.0 45-49 36.4357 37.0 37.0 37.0 37.0 37.0 50-54 36.514300000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.557900000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.5133 37.0 37.0 37.0 37.0 37.0 65-69 36.3178 37.0 37.0 37.0 37.0 37.0 70-74 36.414 37.0 37.0 37.0 37.0 37.0 75-79 36.4818 37.0 37.0 37.0 37.0 37.0 80-84 36.4063 37.0 37.0 37.0 37.0 37.0 85-89 36.150400000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.4114 37.0 37.0 37.0 29.8 37.0 95-99 36.1051 37.0 37.0 37.0 37.0 37.0 100-104 36.1382 37.0 37.0 37.0 37.0 37.0 105-109 36.1175 37.0 37.0 37.0 37.0 37.0 110-114 36.130399999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.459 37.0 37.0 37.0 37.0 37.0 120-124 36.5524 37.0 37.0 37.0 37.0 37.0 125-129 36.4812 37.0 37.0 37.0 37.0 37.0 130-134 36.484500000000004 37.0 37.0 37.0 37.0 37.0 135-139 36.3769 37.0 37.0 37.0 37.0 37.0 140-144 36.2693 37.0 37.0 37.0 37.0 37.0 145-149 36.201100000000004 37.0 37.0 37.0 37.0 37.0 150-151 33.7075 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 1.0 23 0.0 24 1.0 25 0.0 26 4.0 27 3.0 28 3.0 29 6.0 30 5.0 31 18.0 32 24.0 33 53.0 34 116.0 35 354.0 36 3233.0 37 178.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.925000000000004 9.725 5.65 34.699999999999996 2 23.473234481025386 9.499874340286505 36.541844684594125 30.485046494093993 3 20.0 14.649999999999999 25.124999999999996 40.225 4 25.4 20.349999999999998 21.9 32.35 5 26.424999999999997 28.1 24.5 20.974999999999998 6 24.325 30.725 22.95 22.0 7 19.1 25.224999999999998 38.9 16.775000000000002 8 20.525 23.875 30.225 25.374999999999996 9 19.825 21.7 33.125 25.35 10-14 23.695 25.905 25.895000000000003 24.505 15-19 23.805 25.645 25.09 25.46 20-24 24.33 25.230000000000004 24.9 25.540000000000003 25-29 23.474999999999998 25.335 25.555 25.635 30-34 23.22 25.805 25.019999999999996 25.955000000000002 35-39 23.52 25.314999999999998 25.91 25.255 40-44 23.96 25.295 24.9 25.845000000000002 45-49 24.305 24.959999999999997 24.72 26.015 50-54 23.95 25.28 24.935 25.835 55-59 23.395 24.87 25.305 26.43 60-64 23.494999999999997 25.119999999999997 25.31 26.075 65-69 23.93 25.06 25.485000000000003 25.525 70-74 23.82 25.3 24.535 26.345000000000002 75-79 24.21 25.069999999999997 24.68 26.040000000000003 80-84 23.86 25.095 24.95 26.095000000000002 85-89 24.34 24.97 24.915000000000003 25.775 90-94 23.815 24.615000000000002 25.41 26.16 95-99 24.315 24.915000000000003 25.255 25.515 100-104 23.925 25.290000000000003 24.955 25.83 105-109 24.4 24.759999999999998 25.35 25.490000000000002 110-114 24.295 25.535000000000004 24.585 25.585 115-119 24.465 25.165 24.55 25.82 120-124 24.085 25.314999999999998 24.34 26.26 125-129 23.9 25.569999999999997 24.615000000000002 25.915 130-134 24.3 25.83 24.185000000000002 25.685000000000002 135-139 24.115000000000002 25.16 24.675 26.05 140-144 24.44 24.545 24.610000000000003 26.405 145-149 24.610000000000003 25.169999999999998 23.885 26.334999999999997 150-151 23.9875 24.7 25.0625 26.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.0 26 2.0 27 4.0 28 6.0 29 6.5 30 8.0 31 12.0 32 17.5 33 24.5 34 28.0 35 34.0 36 46.0 37 67.5 38 84.5 39 95.5 40 115.0 41 134.0 42 155.0 43 173.0 44 191.0 45 191.0 46 199.5 47 198.0 48 169.0 49 164.0 50 168.0 51 148.0 52 116.5 53 98.5 54 94.5 55 101.5 56 103.0 57 91.0 58 79.5 59 76.0 60 76.0 61 73.5 62 70.0 63 64.5 64 62.0 65 61.0 66 58.0 67 59.5 68 50.5 69 46.0 70 43.5 71 33.5 72 34.5 73 24.5 74 10.0 75 9.5 76 9.0 77 5.5 78 2.0 79 1.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.525 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 87.10610002891009 75.325 2 10.75455333911535 18.6 3 1.850245735761781 4.8 4 0.11564035848511131 0.4 5 0.057820179242555655 0.25 6 0.08673026886383348 0.44999999999999996 7 0.028910089621277828 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTCTTTCGTGTTTTTCTTCTCTTAGAAGTTTTCTCTGTCTTTCCTGCA 7 0.17500000000000002 No Hit CTCGTCTTCGTCGTCGTCGCCGTCTCCCAGAAACCCTCCACATCTGAACC 6 0.15 No Hit ATGCATTGTTGTTGACTGGGTCGGCGACGTGGTCGAAGAGGTTCTCGACG 6 0.15 No Hit AGGGGAGGAGGCGGCGGGCGGAGGCGGATCTGTGAGGAGTAGGGCGGAGG 6 0.15 No Hit CTCCACAAGCAGCCCCTTGGAGTCCACCAGCCAGATCTTCTTGCGGCAGT 5 0.125 No Hit GCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCATTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1625 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 2.125 0.0 0.0 0.0 0.0 106-107 2.5625 0.0 0.0 0.0 0.0 108-109 2.8 0.0 0.0 0.0 0.0 110-111 3.2625 0.0 0.0 0.0 0.0 112-113 3.575 0.0 0.0 0.0 0.0 114-115 4.025 0.0 0.0 0.0 0.0 116-117 4.475 0.0 0.0 0.0 0.0 118-119 4.824999999999999 0.0 0.0 0.0 0.0 120-121 5.4 0.0 0.0 0.0 0.0 122-123 5.9375 0.0 0.0 0.0 0.0 124-125 6.5 0.0 0.0 0.0 0.0 126-127 7.074999999999999 0.0 0.0 0.0 0.0 128-129 7.8 0.0 0.0 0.0 0.0 130-131 8.275 0.0 0.0 0.0 0.0 132-133 8.975000000000001 0.0 0.0 0.0 0.0 134-135 9.875 0.0 0.0 0.0 0.0 136-137 10.524999999999999 0.0 0.0 0.0 0.0 138-139 11.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18694436 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694436_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.1975 37.0 37.0 37.0 25.0 37.0 2 35.2875 37.0 37.0 37.0 25.0 37.0 3 35.4845 37.0 37.0 37.0 37.0 37.0 4 35.3465 37.0 37.0 37.0 37.0 37.0 5 35.316 37.0 37.0 37.0 25.0 37.0 6 35.3985 37.0 37.0 37.0 37.0 37.0 7 35.448 37.0 37.0 37.0 37.0 37.0 8 35.5325 37.0 37.0 37.0 37.0 37.0 9 35.705 37.0 37.0 37.0 37.0 37.0 10-14 35.653499999999994 37.0 37.0 37.0 37.0 37.0 15-19 35.6335 37.0 37.0 37.0 37.0 37.0 20-24 35.514599999999994 37.0 37.0 37.0 34.6 37.0 25-29 35.6752 37.0 37.0 37.0 37.0 37.0 30-34 35.9082 37.0 37.0 37.0 37.0 37.0 35-39 35.7024 37.0 37.0 37.0 37.0 37.0 40-44 35.4525 37.0 37.0 37.0 32.2 37.0 45-49 35.5762 37.0 37.0 37.0 37.0 37.0 50-54 35.028499999999994 37.0 37.0 37.0 32.2 37.0 55-59 34.4405 37.0 37.0 37.0 25.0 37.0 60-64 35.1306 37.0 37.0 37.0 27.4 37.0 65-69 34.3144 37.0 34.6 37.0 27.4 37.0 70-74 32.9717 37.0 29.8 37.0 22.2 37.0 75-79 33.582 37.0 34.6 37.0 22.2 37.0 80-84 34.6822 37.0 37.0 37.0 25.0 37.0 85-89 32.728699999999996 37.0 32.2 37.0 19.4 37.0 90-94 34.1303 37.0 37.0 37.0 25.0 37.0 95-99 33.935500000000005 37.0 37.0 37.0 25.0 37.0 100-104 33.5185 37.0 37.0 37.0 25.0 37.0 105-109 34.2393 37.0 37.0 37.0 25.0 37.0 110-114 34.5813 37.0 37.0 37.0 25.0 37.0 115-119 34.5 37.0 37.0 37.0 25.0 37.0 120-124 34.0711 37.0 37.0 37.0 25.0 37.0 125-129 34.010000000000005 37.0 37.0 37.0 25.0 37.0 130-134 33.7367 37.0 37.0 37.0 25.0 37.0 135-139 32.1055 37.0 27.4 37.0 13.8 37.0 140-144 31.4295 37.0 25.0 37.0 11.0 37.0 145-149 30.997799999999994 37.0 25.0 37.0 11.0 37.0 150-151 30.62375 37.0 25.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 5.0 18 1.0 19 2.0 20 2.0 21 10.0 22 4.0 23 3.0 24 3.0 25 5.0 26 8.0 27 20.0 28 23.0 29 35.0 30 73.0 31 168.0 32 248.0 33 530.0 34 1135.0 35 1486.0 36 237.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.65 21.9 7.449999999999999 28.000000000000004 2 31.8 23.025000000000002 26.8 18.375 3 23.75 25.525 27.150000000000002 23.575 4 27.05 30.5 20.625 21.825 5 28.449999999999996 33.75 17.7 20.1 6 24.15 34.2 19.375 22.275 7 23.200000000000003 19.05 34.525 23.225 8 21.4 22.05 27.05 29.5 9 22.75 22.575 27.625 27.05 10-14 26.435 25.31 23.830000000000002 24.425 15-19 26.22 24.93 24.635 24.215 20-24 25.45 25.285000000000004 24.33 24.935 25-29 26.590000000000003 24.765 24.19 24.455 30-34 26.450000000000003 24.14 24.585 24.825 35-39 26.169999999999998 25.16 23.974999999999998 24.695 40-44 26.224999999999998 23.945 24.75 25.080000000000002 45-49 25.535000000000004 24.825 24.705 24.935 50-54 24.959999999999997 24.4 25.89 24.75 55-59 26.695 25.130000000000003 23.755000000000003 24.42 60-64 26.35 24.44 24.445 24.765 65-69 25.885 25.509999999999998 24.055 24.55 70-74 26.125 23.71 24.834999999999997 25.330000000000002 75-79 26.72 24.035 24.79 24.455 80-84 26.105 25.055 24.605 24.235 85-89 23.925 26.840000000000003 24.91 24.325 90-94 26.424999999999997 24.505 24.89 24.18 95-99 25.895000000000003 25.455 24.474999999999998 24.175 100-104 26.150000000000002 24.975 24.104999999999997 24.77 105-109 26.534999999999997 25.44 24.185000000000002 23.84 110-114 26.384999999999998 24.959999999999997 24.125 24.529999999999998 115-119 27.29 24.45 24.4 23.86 120-124 26.68 25.69 24.59 23.04 125-129 26.715 24.595 24.85 23.84 130-134 27.224999999999998 25.245 24.62 22.91 135-139 27.005000000000003 25.46 24.525 23.01 140-144 27.955000000000002 25.405 24.085 22.555 145-149 27.77 24.81 24.525 22.895 150-151 25.8125 24.837500000000002 27.4125 21.9375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.0 25 1.0 26 1.0 27 2.0 28 3.5 29 5.0 30 9.5 31 14.0 32 14.0 33 16.5 34 30.0 35 39.0 36 39.5 37 51.5 38 71.5 39 89.0 40 107.0 41 130.0 42 144.0 43 160.0 44 191.0 45 200.5 46 180.0 47 159.0 48 154.5 49 162.5 50 160.0 51 147.0 52 123.5 53 103.0 54 101.0 55 93.0 56 97.5 57 103.5 58 95.0 59 97.5 60 95.5 61 86.5 62 90.5 63 89.5 64 70.5 65 61.5 66 64.5 67 62.0 68 56.0 69 48.0 70 45.0 71 37.0 72 21.0 73 14.0 74 11.0 75 12.5 76 14.0 77 7.5 78 3.0 79 1.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 1.0 99 1.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.9 #Duplication Level Percentage of deduplicated Percentage of total 1 87.83084004602992 76.325 2 10.040276179516686 17.45 3 1.668584579976985 4.35 4 0.28768699654775604 1.0 5 0.08630609896432681 0.375 6 0.028768699654775604 0.15 7 0.05753739930955121 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGGGAGCTCGAGGTGATCCACTCTCGTTGGGCGATGCTTGGCGCGCTCG 7 0.17500000000000002 No Hit GTTGATGATGCTTCTGGTCGCCTTGTCTCTGCTGATCCCCAAGCCAACAG 7 0.17500000000000002 No Hit CGGCGGCCTCCTCCCTACTCCTCCCTCTGCTCGCGTCCCCGCCATCCTTC 6 0.15 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit CAAGAGCCATCTCGTCTTCAACGACGACATCCAGGGTACTGCGTCAGTTG 5 0.125 No Hit ACGAGCTCAAGAGGCTGGATGATTTGTATACGGTTGCTGCACTTGGCCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.65 0.0 0.0 0.0 0.0 104-105 2.05 0.0 0.0 0.0 0.0 106-107 2.475 0.0 0.0 0.0 0.0 108-109 2.7 0.0 0.0 0.0 0.0 110-111 3.1500000000000004 0.0 0.0 0.0 0.0 112-113 3.425 0.0 0.0 0.0 0.0 114-115 3.875 0.0 0.0 0.0 0.0 116-117 4.325 0.0 0.0 0.0 0.0 118-119 4.675000000000001 0.0 0.0 0.0 0.0 120-121 5.25 0.0 0.0 0.0 0.0 122-123 5.7875 0.0 0.0 0.0 0.0 124-125 6.35 0.0 0.0 0.0 0.0 126-127 6.925000000000001 0.0 0.0 0.0 0.0 128-129 7.625 0.0 0.0 0.0 0.0 130-131 8.075 0.0 0.0 0.0 0.0 132-133 8.774999999999999 0.0 0.0 0.0 0.0 134-135 9.6 0.0 0.0 0.0 0.0 136-137 10.2125 0.0 0.0 0.0 0.0 138-139 10.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 680430 spots for SRR18694436.sra Written 680430 spots for SRR18694436.sra Read 680430 spots for SRR18694436.sra Written 680430 spots for SRR18694436.sra Read 680430 spots for SRR18694436.sra Written 680430 spots for SRR18694436.sra Read 680430 spots for SRR18694436.sra Written 680430 spots for SRR18694436.sra Read 680430 spots for SRR18694436.sra Written 680430 spots for SRR18694436.sra Read 680430 spots for SRR18694436.sra Written 680430 spots for SRR18694436.sra Read 680430 spots for SRR18694436.sra Written 680430 spots for SRR18694436.sra Read 680430 spots for SRR18694436.sra Written 680430 spots for SRR18694436.sra Read 680430 spots for SRR18694436.sra Written 680430 spots for SRR18694436.sra Read 680430 spots for SRR18694436.sra Written 680430 spots for SRR18694436.sra Read 680430 spots for SRR18694436.sra Written 680430 spots for SRR18694436.sra Read 680430 spots for SRR18694436.sra Written 680430 spots for SRR18694436.sra Read 680430 spots for SRR18694436.sra Written 680430 spots for SRR18694436.sra Read 680442 spots for SRR18694436.sra Written 680442 spots for SRR18694436.sra Read 680430 spots for SRR18694436.sra Written 680430 spots for SRR18694436.sra Read 680430 spots for SRR18694436.sra Written 680430 spots for SRR18694436.sra Read 680430 spots for SRR18694436.sra Written 680430 spots for SRR18694436.sra Read 680430 spots for SRR18694436.sra Written 680430 spots for SRR18694436.sra Read 680430 spots for SRR18694436.sra Written 680430 spots for SRR18694436.sra Read 680430 spots for SRR18694436.sra Written 680430 spots for SRR18694436.sra SRR ids: ['SRR18694436.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ja63q24d SRR18694436.sra spots: 13608612 blocks: [[1, 680430], [680431, 1360860], [1360861, 2041290], [2041291, 2721720], [2721721, 3402150], [3402151, 4082580], [4082581, 4763010], [4763011, 5443440], [5443441, 6123870], [6123871, 6804300], [6804301, 7484730], [7484731, 8165160], [8165161, 8845590], [8845591, 9526020], [9526021, 10206450], [10206451, 10886880], [10886881, 11567310], [11567311, 12247740], [12247741, 12928170], [12928171, 13608612]] SRR18694436 file size 4603101 SRR18694436 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694436 SRR18694436_1.fastq SRR18694436_2.fastq Input file: SRR18694436_1.fastq Paired file: SRR18694436_2.fastq trimmed: SRR18694436-trimmed-pair1.fastq, SRR18694436-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:47:32 2024 >> started Tue Dec 10 06:47:49 2024 >> done (16.856s) 13608612 read pairs processed; of these: 184 ( 0.00%) short read pairs filtered out after trimming by size control 1544 ( 0.01%) empty read pairs filtered out after trimming by size control 13606884 (99.99%) read pairs available; of these: 2076026 (15.26%) trimmed read pairs available after processing 11530858 (84.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 15 0.00% 20 15 0.00% 21 20 0.00% 22 22 0.00% 23 20 0.00% 24 23 0.00% 25 32 0.00% 26 27 0.00% 27 33 0.00% 28 40 0.00% 29 29 0.00% 30 34 0.00% 31 35 0.00% 32 34 0.00% 33 34 0.00% 34 41 0.00% 35 52 0.00% 36 43 0.00% 37 44 0.00% 38 51 0.00% 39 40 0.00% 40 43 0.00% 41 57 0.00% 42 66 0.00% 43 58 0.00% 44 49 0.00% 45 64 0.00% 46 58 0.00% 47 72 0.00% 48 90 0.00% 49 81 0.00% 50 127 0.00% 51 100 0.00% 52 134 0.00% 53 126 0.00% 54 133 0.00% 55 173 0.00% 56 124 0.00% 57 195 0.00% 58 199 0.00% 59 233 0.00% 60 315 0.00% 61 369 0.00% 62 389 0.00% 63 411 0.00% 64 408 0.00% 65 486 0.00% 66 589 0.00% 67 708 0.01% 68 731 0.01% 69 848 0.01% 70 931 0.01% 71 1077 0.01% 72 1311 0.01% 73 1431 0.01% 74 1604 0.01% 75 1786 0.01% 76 2011 0.01% 77 2135 0.02% 78 2534 0.02% 79 2832 0.02% 80 3160 0.02% 81 3502 0.03% 82 4032 0.03% 83 4302 0.03% 84 4695 0.03% 85 5218 0.04% 86 5688 0.04% 87 5990 0.04% 88 6546 0.05% 89 7073 0.05% 90 7806 0.06% 91 8631 0.06% 92 9165 0.07% 93 9691 0.07% 94 10451 0.08% 95 11283 0.08% 96 11706 0.09% 97 12858 0.09% 98 12874 0.09% 99 13790 0.10% 100 14507 0.11% 101 15732 0.12% 102 16622 0.12% 103 17194 0.13% 104 18509 0.14% 105 19032 0.14% 106 20002 0.15% 107 20313 0.15% 108 20838 0.15% 109 21803 0.16% 110 22889 0.17% 111 24128 0.18% 112 25384 0.19% 113 26289 0.19% 114 27750 0.20% 115 28801 0.21% 116 29564 0.22% 117 30471 0.22% 118 30993 0.23% 119 31461 0.23% 120 32896 0.24% 121 33131 0.24% 122 34519 0.25% 123 36414 0.27% 124 37868 0.28% 125 38012 0.28% 126 39035 0.29% 127 39285 0.29% 128 40332 0.30% 129 41766 0.31% 130 41566 0.31% 131 42670 0.31% 132 43879 0.32% 133 45325 0.33% 134 46117 0.34% 135 47111 0.35% 136 48073 0.35% 137 48286 0.35% 138 48042 0.35% 139 49511 0.36% 140 49647 0.36% 141 50675 0.37% 142 51707 0.38% 143 52547 0.39% 144 53301 0.39% 145 55111 0.41% 146 54705 0.40% 147 56585 0.42% 148 57309 0.42% 149 56579 0.42% 150 57492 0.42% 151 11530858 84.74% 13606884 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=21 prefix-density=0.66 prefix-fanout=2.1 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=100.53 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=12.8 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAG criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=31 prefix-density=0.58 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.38 sequence-density-rank=7 fanout-score=8.40 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=5.0 sequence=AAGAAGGAGTACCC SRR18694436 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:48:47 Started mapping on | Dec 10 06:48:47 Finished on | Dec 10 06:50:11 Mapping speed, Million of reads per hour | 583.15 Number of input reads | 13606884 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12783094 Uniquely mapped reads % | 93.95% Average mapped length | 292.85 Number of splices: Total | 12679263 Number of splices: Annotated (sjdb) | 11857680 Number of splices: GT/AG | 12497153 Number of splices: GC/AG | 153115 Number of splices: AT/AC | 4880 Number of splices: Non-canonical | 24115 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.01% Deletion average length | 2.43 Insertion rate per base | 0.01% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 171164 % of reads mapped to multiple loci | 1.26% Number of reads mapped to too many loci | 18204 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.66% % of reads unmapped: other | 1.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 652626 652626 652626 N_multimapping 171164 171164 171164 N_noFeature 645060 12418764 756141 N_ambiguous 303753 1725 50885 UnstrandedReadsAssigned:11834281 PositiveStrandReadsAssigned:362605 NegativeStrandReadsAssigned:11976068 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694436 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694436-trimmed-pair1.fastq SRR18694436-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,606,884 reads, 12,135,979 reads pseudoaligned [quant] estimated average fragment length: 243.303 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52973 SRR18694436.ke.tsv 35125 SRR18694436.se.tsv 88098 total ==> SRR18694436.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 694.129 0 0 PNS24247 1044 801.697 51.3724 7.60585 PNS24249 1928 1685.7 40.0884 2.82272 PNS24246 1044 801.697 51.3724 7.60585 PNS24248 1044 801.697 51.3724 7.60585 PNS24244 1471 1228.7 92.7945 8.96409 PNS24243 293 103.67 0 0 KQK14069 1603 1360.7 1072.17 93.5254 KQK14071 474 250.723 46.1202 21.8336 ==> SRR18694436.se.tsv <== BRADI_1g14170v3 1382 BRADI_1g53295v3 15 BRADI_1g59795v3 943 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 221 BRADI_1g74790v3 121 BRADI_1g09890v3 0 BRADI_1g77505v3 124 BRADI_1g48960v3 0 SRR18694436 completed mapping pipeline successfully