Starting /dee2/code/volunteer_pipeline.sh SRR18694437 current disk space = 1525941334016 free memory = 1599173340 SRR18694437 SRAfilesize 3aeda43ea70b4dcd800e90d0d3088a79 SRR18694437.sra SRR18694437.sra file validated SRR18694437 is paired end SRR18694437 is conventional basespace SRR18694437 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694437_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.055 37.0 37.0 37.0 37.0 37.0 2 35.9235 37.0 37.0 37.0 37.0 37.0 3 36.245 37.0 37.0 37.0 37.0 37.0 4 36.4325 37.0 37.0 37.0 37.0 37.0 5 36.4965 37.0 37.0 37.0 37.0 37.0 6 36.4145 37.0 37.0 37.0 37.0 37.0 7 36.4665 37.0 37.0 37.0 37.0 37.0 8 36.4905 37.0 37.0 37.0 37.0 37.0 9 36.574 37.0 37.0 37.0 37.0 37.0 10-14 36.554500000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.557599999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.6018 37.0 37.0 37.0 37.0 37.0 25-29 36.5315 37.0 37.0 37.0 37.0 37.0 30-34 36.4653 37.0 37.0 37.0 37.0 37.0 35-39 36.6328 37.0 37.0 37.0 37.0 37.0 40-44 36.5745 37.0 37.0 37.0 37.0 37.0 45-49 36.4082 37.0 37.0 37.0 37.0 37.0 50-54 36.4556 37.0 37.0 37.0 37.0 37.0 55-59 36.5189 37.0 37.0 37.0 37.0 37.0 60-64 36.4885 37.0 37.0 37.0 37.0 37.0 65-69 36.251099999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.3821 37.0 37.0 37.0 37.0 37.0 75-79 36.4873 37.0 37.0 37.0 37.0 37.0 80-84 36.406 37.0 37.0 37.0 37.0 37.0 85-89 36.186899999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.3703 37.0 37.0 37.0 29.8 37.0 95-99 36.098 37.0 37.0 37.0 37.0 37.0 100-104 36.109899999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.1415 37.0 37.0 37.0 37.0 37.0 110-114 36.1437 37.0 37.0 37.0 37.0 37.0 115-119 36.4848 37.0 37.0 37.0 37.0 37.0 120-124 36.5275 37.0 37.0 37.0 37.0 37.0 125-129 36.52120000000001 37.0 37.0 37.0 37.0 37.0 130-134 36.4908 37.0 37.0 37.0 37.0 37.0 135-139 36.4106 37.0 37.0 37.0 37.0 37.0 140-144 36.25019999999999 37.0 37.0 37.0 37.0 37.0 145-149 36.1739 37.0 37.0 37.0 37.0 37.0 150-151 33.60025 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 1.0 26 1.0 27 2.0 28 4.0 29 8.0 30 10.0 31 13.0 32 22.0 33 75.0 34 113.0 35 375.0 36 3213.0 37 162.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.25 9.775 5.075 37.9 2 20.80823293172691 10.592369477911646 35.918674698795186 32.68072289156627 3 18.325 14.35 25.474999999999998 41.85 4 25.650000000000002 22.2 21.575 30.575000000000003 5 28.349999999999998 27.825 21.725 22.1 6 22.925 32.05 22.45 22.575 7 17.025000000000002 25.75 39.550000000000004 17.675 8 19.900000000000002 24.099999999999998 31.775 24.224999999999998 9 19.275000000000002 21.825 33.875 25.025 10-14 22.525000000000002 27.744999999999997 26.08 23.65 15-19 22.575 25.71 26.655 25.06 20-24 22.21 25.66 26.57 25.56 25-29 22.2 26.055 26.179999999999996 25.564999999999998 30-34 22.805 25.985000000000003 25.7 25.509999999999998 35-39 22.79 25.874999999999996 26.38 24.955 40-44 22.735 26.56 25.755 24.95 45-49 22.175 26.61 25.715 25.5 50-54 22.05 26.279999999999998 25.380000000000003 26.290000000000003 55-59 23.044999999999998 25.89 25.595000000000002 25.47 60-64 22.345000000000002 26.215 25.95 25.490000000000002 65-69 22.375 26.135 26.095000000000002 25.395 70-74 22.919999999999998 25.840000000000003 25.915 25.324999999999996 75-79 22.96 25.779999999999998 25.840000000000003 25.419999999999998 80-84 22.634999999999998 26.14 25.590000000000003 25.635 85-89 22.95 25.795 25.885 25.369999999999997 90-94 23.29 26.16 25.685000000000002 24.865000000000002 95-99 22.85 26.105 25.715 25.330000000000002 100-104 22.97 26.115 26.13 24.785 105-109 23.005 25.990000000000002 25.95 25.055 110-114 23.035 25.585 25.19 26.19 115-119 22.42 26.795 25.355 25.430000000000003 120-124 23.21 26.685 24.8 25.305 125-129 23.43 25.535000000000004 25.924999999999997 25.11 130-134 22.564999999999998 26.674999999999997 25.5 25.259999999999998 135-139 23.39 25.665 25.69 25.255 140-144 22.43 25.974999999999998 25.580000000000002 26.015 145-149 22.93 25.990000000000002 25.775 25.305 150-151 23.825 25.35 24.9 25.924999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 0.5 27 1.0 28 3.5 29 4.5 30 5.0 31 10.5 32 14.0 33 16.5 34 25.0 35 33.0 36 38.0 37 59.0 38 83.5 39 108.0 40 127.5 41 138.0 42 167.0 43 184.5 44 189.5 45 196.5 46 213.5 47 230.0 48 231.5 49 230.5 50 211.0 51 191.5 52 170.0 53 144.5 54 123.5 55 104.5 56 95.5 57 89.0 58 76.0 59 63.0 60 54.5 61 44.0 62 41.0 63 47.5 64 47.0 65 40.5 66 33.5 67 23.5 68 23.5 69 22.0 70 13.5 71 9.5 72 8.0 73 5.5 74 2.5 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.225 #Duplication Level Percentage of deduplicated Percentage of total 1 88.86370076508926 78.4 2 9.549447435534146 16.85 3 1.2184754888070275 3.225 4 0.25502975347123835 0.8999999999999999 5 0.0850099178237461 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.028336639274582034 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCTCCTTCTGAGATTTCCTCTTCACCCTCCGCAAAGTCACCATCATCA 10 0.25 No Hit CACGATCCAGTCTTCCTCCCCATCGGAGAAGTCCAAAGCGATTGTGATGC 5 0.125 No Hit GCTCACTGTTCACGGGTACATCCTCATACCCATCAATTGTGACAACCTTC 5 0.125 No Hit GCTGGTAGTCCCCGAGCAACCTCAGCCGATAGACCTCTCCACATATTGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2125 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 0.9625 0.0 0.0 0.0 0.0 106-107 1.0750000000000002 0.0 0.0 0.0 0.0 108-109 1.1749999999999998 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.55 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.4749999999999996 0.0 0.0 0.0 0.0 120-121 2.6375 0.0 0.0 0.0 0.0 122-123 2.7875 0.0 0.0 0.0 0.0 124-125 3.0 0.0 0.0 0.0 0.0 126-127 3.3125 0.0 0.0 0.0 0.0 128-129 3.6375 0.0 0.0 0.0 0.0 130-131 3.925 0.0 0.0 0.0 0.0 132-133 4.237500000000001 0.0 0.0 0.0 0.0 134-135 4.425 0.0 0.0 0.0 0.0 136-137 4.7375 0.0 0.0 0.0 0.0 138-139 4.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCATA 10 0.006830828 145.0 9 ACCAAGT 10 0.006830828 145.0 145 GCAAATA 10 0.006830828 145.0 1 GCCAACA 10 0.006830828 145.0 1 ATTTCAT 10 0.006830828 145.0 8 >>END_MODULE SRR18694437 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694437_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.149 37.0 37.0 37.0 25.0 37.0 2 34.789 37.0 37.0 37.0 25.0 37.0 3 34.887 37.0 37.0 37.0 25.0 37.0 4 34.9575 37.0 37.0 37.0 25.0 37.0 5 35.1065 37.0 37.0 37.0 25.0 37.0 6 35.13 37.0 37.0 37.0 25.0 37.0 7 35.2115 37.0 37.0 37.0 25.0 37.0 8 35.4885 37.0 37.0 37.0 37.0 37.0 9 35.3935 37.0 37.0 37.0 37.0 37.0 10-14 35.526799999999994 37.0 37.0 37.0 37.0 37.0 15-19 35.552800000000005 37.0 37.0 37.0 37.0 37.0 20-24 35.374700000000004 37.0 37.0 37.0 34.6 37.0 25-29 35.4832 37.0 37.0 37.0 32.2 37.0 30-34 35.7661 37.0 37.0 37.0 37.0 37.0 35-39 35.558499999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.2793 37.0 37.0 37.0 29.8 37.0 45-49 35.4174 37.0 37.0 37.0 32.2 37.0 50-54 34.9015 37.0 37.0 37.0 27.0 37.0 55-59 34.368700000000004 37.0 37.0 37.0 25.0 37.0 60-64 35.02929999999999 37.0 37.0 37.0 27.4 37.0 65-69 34.2281 37.0 34.6 37.0 27.4 37.0 70-74 33.0927 37.0 29.8 37.0 22.2 37.0 75-79 33.569 37.0 34.6 37.0 22.2 37.0 80-84 34.658300000000004 37.0 37.0 37.0 25.0 37.0 85-89 32.7085 37.0 32.2 37.0 19.4 37.0 90-94 34.1178 37.0 37.0 37.0 25.0 37.0 95-99 33.910999999999994 37.0 37.0 37.0 25.0 37.0 100-104 33.3774 37.0 37.0 37.0 25.0 37.0 105-109 34.1798 37.0 37.0 37.0 25.0 37.0 110-114 34.6143 37.0 37.0 37.0 25.0 37.0 115-119 34.4534 37.0 37.0 37.0 25.0 37.0 120-124 34.0201 37.0 37.0 37.0 25.0 37.0 125-129 33.98530000000001 37.0 37.0 37.0 25.0 37.0 130-134 33.7263 37.0 37.0 37.0 25.0 37.0 135-139 32.1185 37.0 25.0 37.0 13.8 37.0 140-144 31.636000000000003 37.0 25.0 37.0 11.0 37.0 145-149 31.3333 37.0 25.0 37.0 13.8 37.0 150-151 30.62675 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 2.0 17 7.0 18 4.0 19 1.0 20 4.0 21 1.0 22 4.0 23 2.0 24 5.0 25 5.0 26 4.0 27 12.0 28 21.0 29 44.0 30 83.0 31 168.0 32 281.0 33 574.0 34 1193.0 35 1369.0 36 215.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.699999999999996 21.725 8.4 29.175 2 29.625 23.95 28.775000000000002 17.65 3 22.5 24.6 29.575000000000003 23.325000000000003 4 25.35 30.675 21.6 22.375 5 28.349999999999998 32.9 19.575 19.175 6 24.775 35.025 19.875 20.325 7 22.525000000000002 20.025000000000002 35.375 22.075 8 22.95 22.85 25.35 28.849999999999998 9 23.275000000000002 22.275 28.025 26.424999999999997 10-14 25.655 26.25 23.73 24.365000000000002 15-19 25.56 25.34 24.709999999999997 24.39 20-24 25.64 25.835 24.715 23.810000000000002 25-29 25.490000000000002 26.05 24.825 23.635 30-34 25.290000000000003 25.83 25.36 23.52 35-39 25.025 25.495 25.715 23.765 40-44 25.21 25.979999999999997 24.865000000000002 23.945 45-49 25.21 25.945 25.240000000000002 23.605 50-54 24.14 25.785000000000004 25.955000000000002 24.12 55-59 25.15 25.915 25.165 23.77 60-64 25.47 25.615 25.47 23.445 65-69 25.755 26.07 25.590000000000003 22.585 70-74 25.365 26.44 24.945 23.25 75-79 27.525 24.495 25.580000000000002 22.400000000000002 80-84 25.624999999999996 25.85 25.650000000000002 22.875 85-89 23.44 28.645 24.97 22.945 90-94 25.605 26.029999999999998 25.55 22.814999999999998 95-99 26.590000000000003 26.224999999999998 24.375 22.81 100-104 25.46 25.89 25.285000000000004 23.365 105-109 25.39 26.555 24.86 23.195 110-114 26.36 25.595000000000002 25.335 22.71 115-119 26.365 26.455000000000002 25.245 21.935 120-124 25.41 25.869999999999997 26.08 22.64 125-129 25.900000000000002 26.16 25.205 22.735 130-134 26.775 25.319999999999997 26.179999999999996 21.725 135-139 25.75 26.68 25.5 22.07 140-144 26.345000000000002 25.965 25.240000000000002 22.45 145-149 26.26 26.174999999999997 25.695 21.87 150-151 24.75 26.075 27.975 21.2 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 2.0 27 2.0 28 3.5 29 5.0 30 8.0 31 10.0 32 10.0 33 18.0 34 24.5 35 32.0 36 45.5 37 58.5 38 75.0 39 89.5 40 107.0 41 132.0 42 160.5 43 188.0 44 210.5 45 224.5 46 217.5 47 198.5 48 189.0 49 189.0 50 188.0 51 180.5 52 158.5 53 137.0 54 128.0 55 113.5 56 101.5 57 93.0 58 81.0 59 74.0 60 66.5 61 64.0 62 60.5 63 54.5 64 50.0 65 46.0 66 50.0 67 42.0 68 31.5 69 21.5 70 13.5 71 13.5 72 7.0 73 5.0 74 4.5 75 1.5 76 1.5 77 1.0 78 0.0 79 0.5 80 1.0 81 0.5 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.075 #Duplication Level Percentage of deduplicated Percentage of total 1 89.6716250350828 79.875 2 8.896996912714004 15.85 3 1.1787819253438114 3.15 4 0.140331181588549 0.5 5 0.08419870895312938 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.028066236317709797 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAGAAGAGCGATGAAGCTGCTCCTACTGATGCTGGCGATGAAGATGGAGA 10 0.25 No Hit CGCATGCCAATAACATAGAAGTAGCAGACAGTGATGATGCAATTGAGGAG 5 0.125 No Hit GCCGGAGTCCGTCGACTGGAGGGAGAAGGGGGCCGTTGCCAAGGTCAAGG 5 0.125 No Hit GGTTCTTCCTTCGAAAACTGCCATTGCTCCTGTCAATCCAACATTTCTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.0499999999999998 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.3125 0.0 0.0 0.0 0.0 112-113 1.55 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.2750000000000004 0.0 0.0 0.0 0.0 118-119 2.425 0.0 0.0 0.0 0.0 120-121 2.5875 0.0 0.0 0.0 0.0 122-123 2.725 0.0 0.0 0.0 0.0 124-125 2.925 0.0 0.0 0.0 0.0 126-127 3.2375 0.0 0.0 0.0 0.0 128-129 3.5625 0.0 0.0 0.0 0.0 130-131 3.8499999999999996 0.0 0.0 0.0 0.0 132-133 4.1625 0.0 0.0 0.0 0.0 134-135 4.3375 0.0 0.0 0.0 0.0 136-137 4.6375 0.0 0.0 0.0 0.0 138-139 4.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTCTAC 10 0.006830828 145.0 6 CACGAAG 10 0.006830828 145.0 5 AACTCTA 10 0.006830828 145.0 5 AGGGAAC 10 0.006830828 145.0 1 TCACGAA 10 0.006830828 145.0 4 GGGAACT 10 0.006830828 145.0 2 GGAACTC 10 0.006830828 145.0 3 CTGTAAG 10 0.006830828 145.0 145 >>END_MODULE Read 556694 spots for SRR18694437.sra Written 556694 spots for SRR18694437.sra Read 556694 spots for SRR18694437.sra Written 556694 spots for SRR18694437.sra Read 556694 spots for SRR18694437.sra Written 556694 spots for SRR18694437.sra Read 556694 spots for SRR18694437.sra Written 556694 spots for SRR18694437.sra Read 556694 spots for SRR18694437.sra Written 556694 spots for SRR18694437.sra Read 556694 spots for SRR18694437.sra Written 556694 spots for SRR18694437.sra Read 556694 spots for SRR18694437.sra Written 556694 spots for SRR18694437.sra Read 556694 spots for SRR18694437.sra Written 556694 spots for SRR18694437.sra Read 556694 spots for SRR18694437.sra Written 556694 spots for SRR18694437.sra Read 556694 spots for SRR18694437.sra Written 556694 spots for SRR18694437.sra Read 556694 spots for SRR18694437.sra Written 556694 spots for SRR18694437.sra Read 556694 spots for SRR18694437.sra Written 556694 spots for SRR18694437.sra Read 556694 spots for SRR18694437.sra Written 556694 spots for SRR18694437.sra Read 556694 spots for SRR18694437.sra Written 556694 spots for SRR18694437.sra Read 556694 spots for SRR18694437.sra Written 556694 spots for SRR18694437.sra Read 556694 spots for SRR18694437.sra Written 556694 spots for SRR18694437.sra Read 556694 spots for SRR18694437.sra Written 556694 spots for SRR18694437.sra Read 556694 spots for SRR18694437.sra Written 556694 spots for SRR18694437.sra Read 556694 spots for SRR18694437.sra Written 556694 spots for SRR18694437.sra Read 556701 spots for SRR18694437.sra Written 556701 spots for SRR18694437.sra SRR ids: ['SRR18694437.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w17txrv0 SRR18694437.sra spots: 11133887 blocks: [[1, 556694], [556695, 1113388], [1113389, 1670082], [1670083, 2226776], [2226777, 2783470], [2783471, 3340164], [3340165, 3896858], [3896859, 4453552], [4453553, 5010246], [5010247, 5566940], [5566941, 6123634], [6123635, 6680328], [6680329, 7237022], [7237023, 7793716], [7793717, 8350410], [8350411, 8907104], [8907105, 9463798], [9463799, 10020492], [10020493, 10577186], [10577187, 11133887]] SRR18694437 file size 3762081 SRR18694437 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694437 SRR18694437_1.fastq SRR18694437_2.fastq Input file: SRR18694437_1.fastq Paired file: SRR18694437_2.fastq trimmed: SRR18694437-trimmed-pair1.fastq, SRR18694437-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:48:53 2024 >> started Tue Dec 10 06:49:05 2024 >> done (12.300s) 11133887 read pairs processed; of these: 94 ( 0.00%) short read pairs filtered out after trimming by size control 1720 ( 0.02%) empty read pairs filtered out after trimming by size control 11132073 (99.98%) read pairs available; of these: 909101 ( 8.17%) trimmed read pairs available after processing 10222972 (91.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 9 0.00% 20 10 0.00% 21 12 0.00% 22 16 0.00% 23 9 0.00% 24 15 0.00% 25 12 0.00% 26 9 0.00% 27 13 0.00% 28 25 0.00% 29 19 0.00% 30 28 0.00% 31 11 0.00% 32 19 0.00% 33 26 0.00% 34 36 0.00% 35 49 0.00% 36 20 0.00% 37 32 0.00% 38 26 0.00% 39 23 0.00% 40 33 0.00% 41 43 0.00% 42 31 0.00% 43 37 0.00% 44 38 0.00% 45 44 0.00% 46 32 0.00% 47 28 0.00% 48 38 0.00% 49 43 0.00% 50 48 0.00% 51 43 0.00% 52 67 0.00% 53 60 0.00% 54 67 0.00% 55 103 0.00% 56 91 0.00% 57 85 0.00% 58 113 0.00% 59 120 0.00% 60 114 0.00% 61 138 0.00% 62 130 0.00% 63 200 0.00% 64 183 0.00% 65 225 0.00% 66 215 0.00% 67 220 0.00% 68 303 0.00% 69 303 0.00% 70 388 0.00% 71 436 0.00% 72 402 0.00% 73 510 0.00% 74 596 0.01% 75 663 0.01% 76 761 0.01% 77 766 0.01% 78 878 0.01% 79 1057 0.01% 80 1037 0.01% 81 1200 0.01% 82 1323 0.01% 83 1507 0.01% 84 1675 0.02% 85 1859 0.02% 86 1988 0.02% 87 2098 0.02% 88 2361 0.02% 89 2577 0.02% 90 2706 0.02% 91 2970 0.03% 92 3110 0.03% 93 3654 0.03% 94 3786 0.03% 95 4072 0.04% 96 4344 0.04% 97 4691 0.04% 98 4834 0.04% 99 5040 0.05% 100 5361 0.05% 101 5463 0.05% 102 5979 0.05% 103 6324 0.06% 104 6853 0.06% 105 6927 0.06% 106 7318 0.07% 107 8035 0.07% 108 8102 0.07% 109 8541 0.08% 110 8860 0.08% 111 9383 0.08% 112 9657 0.09% 113 10179 0.09% 114 10806 0.10% 115 11037 0.10% 116 11578 0.10% 117 12119 0.11% 118 12304 0.11% 119 13183 0.12% 120 13115 0.12% 121 13843 0.12% 122 14039 0.13% 123 14897 0.13% 124 15342 0.14% 125 16233 0.15% 126 16442 0.15% 127 16814 0.15% 128 17213 0.15% 129 18091 0.16% 130 18303 0.16% 131 18733 0.17% 132 19273 0.17% 133 20069 0.18% 134 20660 0.19% 135 21438 0.19% 136 21802 0.20% 137 22215 0.20% 138 22764 0.20% 139 23696 0.21% 140 24001 0.22% 141 24360 0.22% 142 25562 0.23% 143 25776 0.23% 144 26538 0.24% 145 27354 0.25% 146 28023 0.25% 147 28616 0.26% 148 28972 0.26% 149 29711 0.27% 150 30288 0.27% 151 10222972 91.83% 11132073 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=5.37 fanout-score-rank=24 prefix-density=0.27 prefix-fanout=3.0 sequence=AAGATCTGCATGCCACCACG criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=1128.91 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=31.1 sequence=CAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGG criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=28 prefix-density=0.32 prefix-fanout=2.3 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=430.39 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=17.7 sequence=CGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGG SRR18694437 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:49:54 Started mapping on | Dec 10 06:49:54 Finished on | Dec 10 06:51:30 Mapping speed, Million of reads per hour | 417.45 Number of input reads | 11132073 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 10347044 Uniquely mapped reads % | 92.95% Average mapped length | 296.81 Number of splices: Total | 11610031 Number of splices: Annotated (sjdb) | 10965342 Number of splices: GT/AG | 11462258 Number of splices: GC/AG | 125008 Number of splices: AT/AC | 7276 Number of splices: Non-canonical | 15489 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.01% Deletion average length | 2.50 Insertion rate per base | 0.01% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 142702 % of reads mapped to multiple loci | 1.28% Number of reads mapped to too many loci | 22212 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.77% % of reads unmapped: other | 1.81% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 642327 642327 642327 N_multimapping 142702 142702 142702 N_noFeature 398386 10107421 468511 N_ambiguous 196201 1286 27298 UnstrandedReadsAssigned:9752457 PositiveStrandReadsAssigned:238337 NegativeStrandReadsAssigned:9851235 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694437 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694437-trimmed-pair1.fastq SRR18694437-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,132,073 reads, 9,985,225 reads pseudoaligned [quant] estimated average fragment length: 268.853 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52973 SRR18694437.ke.tsv 35125 SRR18694437.se.tsv 88098 total ==> SRR18694437.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 668.67 31.2506 7.29845 PNS24247 1044 776.147 40.22 8.0925 PNS24249 1928 1660.15 25.73 2.42035 PNS24246 1044 776.147 40.22 8.0925 PNS24248 1044 776.147 40.22 8.0925 PNS24244 1471 1203.15 58.3594 7.57489 PNS24243 293 89.2032 0 0 KQK14069 1603 1335.15 731.146 85.5183 KQK14071 474 229.585 4.97111 3.38138 ==> SRR18694437.se.tsv <== BRADI_1g14170v3 806 BRADI_1g53295v3 52 BRADI_1g59795v3 219 BRADI_1g07683v3 0 BRADI_1g00485v3 42 BRADI_1g20270v3 529 BRADI_1g74790v3 26 BRADI_1g09890v3 0 BRADI_1g77505v3 72 BRADI_1g48960v3 0 SRR18694437 completed mapping pipeline successfully