Starting /dee2/code/volunteer_pipeline.sh SRR18694438 current disk space = 1525902716928 free memory = 1547350976 SRR18694438 SRAfilesize ab5bc5a9c150c555f9a10ce157ef5475 SRR18694438.sra SRR18694438.sra file validated SRR18694438 is paired end SRR18694438 is conventional basespace SRR18694438 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694438_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.019 37.0 37.0 37.0 37.0 37.0 2 35.974 37.0 37.0 37.0 37.0 37.0 3 36.448 37.0 37.0 37.0 37.0 37.0 4 36.54 37.0 37.0 37.0 37.0 37.0 5 36.5395 37.0 37.0 37.0 37.0 37.0 6 36.5735 37.0 37.0 37.0 37.0 37.0 7 36.5355 37.0 37.0 37.0 37.0 37.0 8 36.6355 37.0 37.0 37.0 37.0 37.0 9 36.5655 37.0 37.0 37.0 37.0 37.0 10-14 36.6243 37.0 37.0 37.0 37.0 37.0 15-19 36.56700000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.6237 37.0 37.0 37.0 37.0 37.0 25-29 36.540299999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.538599999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.6575 37.0 37.0 37.0 37.0 37.0 40-44 36.6029 37.0 37.0 37.0 37.0 37.0 45-49 36.4037 37.0 37.0 37.0 37.0 37.0 50-54 36.4822 37.0 37.0 37.0 37.0 37.0 55-59 36.5456 37.0 37.0 37.0 37.0 37.0 60-64 36.4797 37.0 37.0 37.0 37.0 37.0 65-69 36.283500000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.429899999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.4549 37.0 37.0 37.0 37.0 37.0 80-84 36.38099999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.1391 37.0 37.0 37.0 37.0 37.0 90-94 35.406099999999995 37.0 37.0 37.0 29.8 37.0 95-99 36.0911 37.0 37.0 37.0 37.0 37.0 100-104 36.10940000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.10830000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.1707 37.0 37.0 37.0 37.0 37.0 115-119 36.4752 37.0 37.0 37.0 37.0 37.0 120-124 36.5552 37.0 37.0 37.0 37.0 37.0 125-129 36.5381 37.0 37.0 37.0 37.0 37.0 130-134 36.5244 37.0 37.0 37.0 37.0 37.0 135-139 36.4153 37.0 37.0 37.0 37.0 37.0 140-144 36.2458 37.0 37.0 37.0 37.0 37.0 145-149 36.2221 37.0 37.0 37.0 37.0 37.0 150-151 33.52475 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 0.0 26 2.0 27 2.0 28 4.0 29 5.0 30 5.0 31 13.0 32 33.0 33 70.0 34 119.0 35 356.0 36 3231.0 37 158.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.225 10.725 5.375 38.675 2 20.718232044198896 9.743847312908088 37.594173782019084 31.943746860873933 3 19.7 14.000000000000002 24.349999999999998 41.949999999999996 4 26.25 18.8 22.475 32.475 5 28.449999999999996 25.900000000000002 23.5 22.15 6 24.7 28.625 22.675 24.0 7 19.400000000000002 24.975 38.75 16.875 8 18.75 25.525 30.275000000000002 25.45 9 19.575 21.475 35.25 23.7 10-14 22.095000000000002 26.740000000000002 26.325 24.84 15-19 23.32 25.619999999999997 25.869999999999997 25.19 20-24 22.335 25.669999999999998 26.43 25.564999999999998 25-29 22.875 25.27 26.150000000000002 25.705 30-34 23.119999999999997 25.569999999999997 25.169999999999998 26.14 35-39 23.435 25.790000000000003 25.324999999999996 25.45 40-44 22.785 25.81 25.729999999999997 25.674999999999997 45-49 23.26 25.540000000000003 25.15 26.05 50-54 22.865 25.629999999999995 25.445 26.06 55-59 22.645 25.145 26.32 25.89 60-64 23.06 25.665 25.645 25.629999999999995 65-69 22.86 25.64 25.929999999999996 25.569999999999997 70-74 22.884999999999998 26.105 24.875 26.135 75-79 23.380000000000003 25.564999999999998 25.355 25.7 80-84 23.13 24.895 26.064999999999998 25.91 85-89 23.45 24.925 25.779999999999998 25.845000000000002 90-94 23.615 25.45 25.645 25.290000000000003 95-99 23.175 25.135 25.86 25.83 100-104 23.615 25.169999999999998 25.66 25.555 105-109 24.065 25.380000000000003 24.59 25.965 110-114 23.674999999999997 25.465 25.275 25.585 115-119 23.485 25.715 25.55 25.25 120-124 24.044999999999998 24.955 25.095 25.905 125-129 23.41 25.535000000000004 25.0 26.055 130-134 24.16 25.525 25.16 25.155 135-139 23.669999999999998 25.25 25.35 25.729999999999997 140-144 24.404999999999998 25.255 24.54 25.8 145-149 23.565 25.445 25.295 25.695 150-151 24.55 24.85 24.962500000000002 25.637500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 1.5 24 1.0 25 1.0 26 1.5 27 3.0 28 5.5 29 7.0 30 6.5 31 10.5 32 13.0 33 14.0 34 21.5 35 39.0 36 47.0 37 55.0 38 83.5 39 103.5 40 112.0 41 143.5 42 177.5 43 179.0 44 183.0 45 206.5 46 222.5 47 208.5 48 190.5 49 175.0 50 156.0 51 159.0 52 151.5 53 125.5 54 110.0 55 102.0 56 96.0 57 90.0 58 82.0 59 73.5 60 81.0 61 82.0 62 65.5 63 60.0 64 56.5 65 55.5 66 49.0 67 44.0 68 38.5 69 32.5 70 25.0 71 13.5 72 15.0 73 10.0 74 3.0 75 2.5 76 1.5 77 0.5 78 0.5 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.8 #Duplication Level Percentage of deduplicated Percentage of total 1 87.12557603686636 75.625 2 11.031105990783411 19.15 3 1.4688940092165899 3.8249999999999997 4 0.28801843317972353 1.0 5 0.0576036866359447 0.25 6 0.02880184331797235 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGATGCTGTTGCCGAAGTAGTTGAGGGTGTTGCCATCCAGGAGAAGAGCG 6 0.15 No Hit CTTGGCGATGACGCAGATCATGATGGCCACGCTGCTGTTCATAATCCCGA 5 0.125 No Hit GTTCCATCAAGGTAGCTCAGGGACTGCTTGGACGCGAACCACAGCTGCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.7250000000000001 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 0.9125 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.7375 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.175 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.9875 0.0 0.0 0.0 0.0 122-123 3.4000000000000004 0.0 0.0 0.0 0.0 124-125 3.5999999999999996 0.0 0.0 0.0 0.0 126-127 3.875 0.0 0.0 0.0 0.0 128-129 4.2125 0.0 0.0 0.0 0.0 130-131 4.775 0.0 0.0 0.0 0.0 132-133 5.2 0.0 0.0 0.0 0.0 134-135 5.625 0.0 0.0 0.0 0.0 136-137 6.1 0.0 0.0 0.0 0.0 138-139 6.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGTCCA 10 0.006830828 145.0 9 AGCACAC 35 0.0033124194 62.14286 145 >>END_MODULE SRR18694438 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694438_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.878 37.0 37.0 37.0 25.0 37.0 2 34.8335 37.0 37.0 37.0 25.0 37.0 3 34.9705 37.0 37.0 37.0 25.0 37.0 4 34.9875 37.0 37.0 37.0 25.0 37.0 5 34.961 37.0 37.0 37.0 25.0 37.0 6 34.979 37.0 37.0 37.0 25.0 37.0 7 35.1145 37.0 37.0 37.0 25.0 37.0 8 35.2575 37.0 37.0 37.0 25.0 37.0 9 35.4735 37.0 37.0 37.0 37.0 37.0 10-14 35.3661 37.0 37.0 37.0 32.2 37.0 15-19 35.4164 37.0 37.0 37.0 37.0 37.0 20-24 35.278200000000005 37.0 37.0 37.0 32.2 37.0 25-29 35.327 37.0 37.0 37.0 29.8 37.0 30-34 35.6532 37.0 37.0 37.0 37.0 37.0 35-39 35.4471 37.0 37.0 37.0 34.6 37.0 40-44 35.204699999999995 37.0 37.0 37.0 29.8 37.0 45-49 35.3732 37.0 37.0 37.0 29.8 37.0 50-54 34.7423 37.0 37.0 37.0 29.4 37.0 55-59 34.2782 37.0 37.0 37.0 25.0 37.0 60-64 34.9467 37.0 37.0 37.0 27.4 37.0 65-69 34.1231 37.0 34.6 37.0 27.4 37.0 70-74 32.992 37.0 29.8 37.0 22.2 37.0 75-79 33.4985 37.0 34.6 37.0 22.2 37.0 80-84 34.4563 37.0 37.0 37.0 25.0 37.0 85-89 32.547200000000004 37.0 32.2 37.0 19.4 37.0 90-94 33.8986 37.0 37.0 37.0 25.0 37.0 95-99 33.8609 37.0 37.0 37.0 25.0 37.0 100-104 33.321099999999994 37.0 37.0 37.0 25.0 37.0 105-109 34.1373 37.0 37.0 37.0 25.0 37.0 110-114 34.3618 37.0 37.0 37.0 25.0 37.0 115-119 34.3581 37.0 37.0 37.0 25.0 37.0 120-124 33.965500000000006 37.0 37.0 37.0 25.0 37.0 125-129 33.8504 37.0 37.0 37.0 25.0 37.0 130-134 33.6217 37.0 34.6 37.0 25.0 37.0 135-139 32.036500000000004 37.0 27.4 37.0 13.8 37.0 140-144 31.597 37.0 25.0 37.0 11.0 37.0 145-149 31.0572 37.0 25.0 37.0 11.0 37.0 150-151 30.8095 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 4.0 17 4.0 18 1.0 19 1.0 20 1.0 21 2.0 22 10.0 23 8.0 24 4.0 25 7.0 26 9.0 27 26.0 28 24.0 29 58.0 30 92.0 31 177.0 32 280.0 33 591.0 34 1206.0 35 1302.0 36 193.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.449999999999996 21.75 8.125 28.675 2 29.225 24.075 26.525 20.175 3 23.575 25.0 29.175 22.25 4 27.950000000000003 29.549999999999997 19.175 23.325000000000003 5 28.349999999999998 33.050000000000004 18.825 19.775000000000002 6 23.175 36.975 18.975 20.875 7 24.55 20.075000000000003 32.85 22.525000000000002 8 23.075000000000003 22.875 26.05 28.000000000000004 9 22.7 22.025 28.95 26.325 10-14 25.715 25.624999999999996 23.535 25.124999999999996 15-19 25.6 24.905 24.64 24.855 20-24 25.624999999999996 26.0 24.455 23.919999999999998 25-29 26.06 25.695 24.474999999999998 23.77 30-34 25.72 25.465 24.740000000000002 24.075 35-39 26.1 25.235000000000003 24.46 24.205 40-44 26.13 24.94 24.975 23.955000000000002 45-49 25.845000000000002 25.785000000000004 24.08 24.29 50-54 24.935 25.15 26.44 23.474999999999998 55-59 25.0 25.215 25.385 24.4 60-64 25.845000000000002 25.345000000000002 24.785 24.025 65-69 26.224999999999998 24.895 24.805 24.075 70-74 26.045 24.725 24.93 24.3 75-79 26.924999999999997 24.14 24.815 24.12 80-84 26.11 25.729999999999997 25.074999999999996 23.085 85-89 23.62 27.61 24.63 24.14 90-94 25.305 25.319999999999997 25.245 24.13 95-99 26.19 25.790000000000003 24.325 23.695 100-104 25.985000000000003 25.564999999999998 24.46 23.990000000000002 105-109 25.665 25.305 25.130000000000003 23.9 110-114 25.825 26.290000000000003 24.77 23.115 115-119 26.224999999999998 25.805 24.635 23.335 120-124 26.290000000000003 25.590000000000003 25.165 22.955000000000002 125-129 26.71 26.169999999999998 24.745 22.375 130-134 26.790000000000003 25.369999999999997 24.95 22.89 135-139 26.38 25.779999999999998 24.72 23.119999999999997 140-144 26.565 26.775 24.29 22.37 145-149 26.025 26.450000000000003 24.275 23.25 150-151 24.95 26.1 26.9125 22.037499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 2.5 28 7.5 29 8.0 30 9.5 31 11.5 32 10.0 33 13.5 34 20.0 35 25.5 36 41.5 37 61.5 38 79.0 39 100.5 40 116.0 41 128.5 42 153.5 43 182.5 44 192.5 45 186.5 46 176.5 47 187.0 48 189.5 49 172.0 50 162.0 51 148.5 52 128.0 53 117.0 54 116.0 55 109.0 56 92.0 57 96.5 58 102.0 59 95.0 60 87.5 61 91.5 62 100.0 63 83.0 64 68.0 65 63.0 66 56.5 67 51.0 68 42.5 69 27.5 70 19.5 71 14.5 72 11.5 73 9.5 74 5.5 75 5.0 76 4.5 77 1.0 78 0.5 79 1.5 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 1.0 99 1.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.875 #Duplication Level Percentage of deduplicated Percentage of total 1 88.62019914651493 77.875 2 9.644381223328592 16.950000000000003 3 1.3086770981507825 3.45 4 0.25604551920341395 0.8999999999999999 5 0.11379800853485066 0.5 6 0.028449502133712664 0.15 7 0.028449502133712664 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CACACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAG 5 0.125 No Hit ACCACGACCAGCGCCGGGGCGCCCTCGAGGAACCCGAGGCCGGACGACAG 5 0.125 No Hit CTGCACTTTCCTCATCTCCCCGAAAGCAGGAGCTAGAGGAGGAGCTTGCA 5 0.125 No Hit CCAGAGCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.7250000000000001 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 0.9125 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.0999999999999996 0.0 0.0 0.0 0.0 118-119 2.475 0.0 0.0 0.0 0.0 120-121 2.9124999999999996 0.0 0.0 0.0 0.0 122-123 3.3 0.0 0.0 0.0 0.0 124-125 3.4749999999999996 0.0 0.0 0.0 0.0 126-127 3.7249999999999996 0.0 0.0 0.0 0.0 128-129 4.0625 0.0 0.0 0.0 0.0 130-131 4.65 0.0 0.0 0.0 0.0 132-133 5.0875 0.0 0.0 0.0 0.0 134-135 5.487500000000001 0.0 0.0 0.0 0.0 136-137 5.95 0.0 0.0 0.0 0.0 138-139 6.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATATTG 10 0.006830828 145.0 3 AGCGTCG 35 0.0033124194 62.14286 145 >>END_MODULE Read 829035 spots for SRR18694438.sra Written 829035 spots for SRR18694438.sra Read 829035 spots for SRR18694438.sra Written 829035 spots for SRR18694438.sra Read 829035 spots for SRR18694438.sra Written 829035 spots for SRR18694438.sra Read 829035 spots for SRR18694438.sra Written 829035 spots for SRR18694438.sra Read 829035 spots for SRR18694438.sra Written 829035 spots for SRR18694438.sra Read 829035 spots for SRR18694438.sra Written 829035 spots for SRR18694438.sra Read 829035 spots for SRR18694438.sra Written 829035 spots for SRR18694438.sra Read 829035 spots for SRR18694438.sra Written 829035 spots for SRR18694438.sra Read 829035 spots for SRR18694438.sra Written 829035 spots for SRR18694438.sra Read 829036 spots for SRR18694438.sra Written 829036 spots for SRR18694438.sra Read 829035 spots for SRR18694438.sra Written 829035 spots for SRR18694438.sra Read 829035 spots for SRR18694438.sra Written 829035 spots for SRR18694438.sra Read 829035 spots for SRR18694438.sra Written 829035 spots for SRR18694438.sra Read 829035 spots for SRR18694438.sra Written 829035 spots for SRR18694438.sra Read 829035 spots for SRR18694438.sra Written 829035 spots for SRR18694438.sra Read 829035 spots for SRR18694438.sra Written 829035 spots for SRR18694438.sra Read 829035 spots for SRR18694438.sra Written 829035 spots for SRR18694438.sra Read 829035 spots for SRR18694438.sra Written 829035 spots for SRR18694438.sra Read 829035 spots for SRR18694438.sra Written 829035 spots for SRR18694438.sra Read 829035 spots for SRR18694438.sra Written 829035 spots for SRR18694438.sra SRR ids: ['SRR18694438.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ipanlyv SRR18694438.sra spots: 16580701 blocks: [[1, 829035], [829036, 1658070], [1658071, 2487105], [2487106, 3316140], [3316141, 4145175], [4145176, 4974210], [4974211, 5803245], [5803246, 6632280], [6632281, 7461315], [7461316, 8290350], [8290351, 9119385], [9119386, 9948420], [9948421, 10777455], [10777456, 11606490], [11606491, 12435525], [12435526, 13264560], [13264561, 14093595], [14093596, 14922630], [14922631, 15751665], [15751666, 16580701]] SRR18694438 file size 5613147 SRR18694438 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694438 SRR18694438_1.fastq SRR18694438_2.fastq Input file: SRR18694438_1.fastq Paired file: SRR18694438_2.fastq trimmed: SRR18694438-trimmed-pair1.fastq, SRR18694438-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:50:38 2024 >> started Tue Dec 10 06:50:58 2024 >> done (19.805s) 16580701 read pairs processed; of these: 152 ( 0.00%) short read pairs filtered out after trimming by size control 3402 ( 0.02%) empty read pairs filtered out after trimming by size control 16577147 (99.98%) read pairs available; of these: 1669578 (10.07%) trimmed read pairs available after processing 14907569 (89.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 17 0.00% 20 17 0.00% 21 11 0.00% 22 27 0.00% 23 19 0.00% 24 29 0.00% 25 19 0.00% 26 26 0.00% 27 28 0.00% 28 26 0.00% 29 38 0.00% 30 30 0.00% 31 38 0.00% 32 31 0.00% 33 30 0.00% 34 41 0.00% 35 40 0.00% 36 44 0.00% 37 54 0.00% 38 69 0.00% 39 60 0.00% 40 49 0.00% 41 57 0.00% 42 58 0.00% 43 47 0.00% 44 52 0.00% 45 54 0.00% 46 60 0.00% 47 61 0.00% 48 94 0.00% 49 105 0.00% 50 108 0.00% 51 109 0.00% 52 112 0.00% 53 109 0.00% 54 105 0.00% 55 101 0.00% 56 151 0.00% 57 164 0.00% 58 175 0.00% 59 218 0.00% 60 219 0.00% 61 257 0.00% 62 338 0.00% 63 355 0.00% 64 388 0.00% 65 392 0.00% 66 397 0.00% 67 485 0.00% 68 581 0.00% 69 679 0.00% 70 702 0.00% 71 823 0.00% 72 993 0.01% 73 1107 0.01% 74 1137 0.01% 75 1425 0.01% 76 1491 0.01% 77 1665 0.01% 78 1873 0.01% 79 2019 0.01% 80 2172 0.01% 81 2553 0.02% 82 2790 0.02% 83 3221 0.02% 84 3343 0.02% 85 3759 0.02% 86 4051 0.02% 87 4449 0.03% 88 4601 0.03% 89 4898 0.03% 90 5513 0.03% 91 5776 0.03% 92 6363 0.04% 93 6932 0.04% 94 7104 0.04% 95 7690 0.05% 96 8213 0.05% 97 8829 0.05% 98 9183 0.06% 99 9649 0.06% 100 10262 0.06% 101 10800 0.07% 102 11282 0.07% 103 12021 0.07% 104 12722 0.08% 105 13139 0.08% 106 13785 0.08% 107 14747 0.09% 108 15249 0.09% 109 16024 0.10% 110 16330 0.10% 111 17096 0.10% 112 18070 0.11% 113 18713 0.11% 114 19696 0.12% 115 20956 0.13% 116 21292 0.13% 117 22411 0.14% 118 23048 0.14% 119 23725 0.14% 120 24716 0.15% 121 25257 0.15% 122 25838 0.16% 123 26854 0.16% 124 28673 0.17% 125 29347 0.18% 126 30063 0.18% 127 31049 0.19% 128 31740 0.19% 129 33144 0.20% 130 33705 0.20% 131 34844 0.21% 132 36014 0.22% 133 37111 0.22% 134 37901 0.23% 135 38255 0.23% 136 40046 0.24% 137 40380 0.24% 138 41373 0.25% 139 42765 0.26% 140 43500 0.26% 141 44413 0.27% 142 45445 0.27% 143 46236 0.28% 144 47770 0.29% 145 49068 0.30% 146 49885 0.30% 147 51261 0.31% 148 52790 0.32% 149 53255 0.32% 150 54405 0.33% 151 14907569 89.93% 16577147 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=12 prefix-density=0.91 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=29 fanout-score=14.13 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=2.2 sequence=GCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTTTTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGTGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGATCAGGTGCTACCCTCTTCTTTGACACAAGCTTGCAATTGCAGCC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=28 prefix-density=0.46 prefix-fanout=2.1 sequence=GGCAGGTACTGGACAATGTGGAAGCTGCCCATGTTCGGGTGCACCGACGCCAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=45.02 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=5.3 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR18694438 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:51:47 Started mapping on | Dec 10 06:51:47 Finished on | Dec 10 06:53:39 Mapping speed, Million of reads per hour | 532.84 Number of input reads | 16577147 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15445490 Uniquely mapped reads % | 93.17% Average mapped length | 295.76 Number of splices: Total | 16305041 Number of splices: Annotated (sjdb) | 15277193 Number of splices: GT/AG | 16073058 Number of splices: GC/AG | 199606 Number of splices: AT/AC | 6082 Number of splices: Non-canonical | 26295 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.01% Deletion average length | 2.38 Insertion rate per base | 0.01% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 246789 % of reads mapped to multiple loci | 1.49% Number of reads mapped to too many loci | 28563 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.40% % of reads unmapped: other | 1.77% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 884868 884868 884868 N_multimapping 246789 246789 246789 N_noFeature 797664 14972611 917108 N_ambiguous 418189 1998 65413 UnstrandedReadsAssigned:14229637 PositiveStrandReadsAssigned:470881 NegativeStrandReadsAssigned:14462969 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694438 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694438-trimmed-pair1.fastq SRR18694438-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,577,147 reads, 14,707,493 reads pseudoaligned [quant] estimated average fragment length: 257.292 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52973 SRR18694438.ke.tsv 35125 SRR18694438.se.tsv 88098 total ==> SRR18694438.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 680.094 0 0 PNS24247 1044 787.708 50.6839 6.17074 PNS24249 1928 1671.71 22.135 1.26985 PNS24246 1044 787.708 50.6839 6.17074 PNS24248 1044 787.708 50.6839 6.17074 PNS24244 1471 1214.71 81.8133 6.45929 PNS24243 293 93.9933 0 0 KQK14069 1603 1346.71 1899.43 135.264 KQK14071 474 238.894 27.5705 11.0681 ==> SRR18694438.se.tsv <== BRADI_1g14170v3 2179 BRADI_1g53295v3 43 BRADI_1g59795v3 907 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 290 BRADI_1g74790v3 89 BRADI_1g09890v3 0 BRADI_1g77505v3 190 BRADI_1g48960v3 0 SRR18694438 completed mapping pipeline successfully