Starting /dee2/code/volunteer_pipeline.sh SRR18694440 current disk space = 1525916508160 free memory = 1599178964 SRR18694440 SRAfilesize 6cca1f1acd82d9beeb905465c6bd13c0 SRR18694440.sra SRR18694440.sra file validated SRR18694440 is paired end SRR18694440 is conventional basespace SRR18694440 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694440_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.116 37.0 37.0 37.0 37.0 37.0 2 35.98525 37.0 37.0 37.0 37.0 37.0 3 36.4185 37.0 37.0 37.0 37.0 37.0 4 36.4945 37.0 37.0 37.0 37.0 37.0 5 36.4955 37.0 37.0 37.0 37.0 37.0 6 36.4305 37.0 37.0 37.0 37.0 37.0 7 36.461 37.0 37.0 37.0 37.0 37.0 8 36.5275 37.0 37.0 37.0 37.0 37.0 9 36.6435 37.0 37.0 37.0 37.0 37.0 10-14 36.5599 37.0 37.0 37.0 37.0 37.0 15-19 36.5831 37.0 37.0 37.0 37.0 37.0 20-24 36.617200000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.486200000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.505700000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.6404 37.0 37.0 37.0 37.0 37.0 40-44 36.5653 37.0 37.0 37.0 37.0 37.0 45-49 36.408100000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.479 37.0 37.0 37.0 37.0 37.0 55-59 36.471599999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.48459999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.315200000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.337799999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.4594 37.0 37.0 37.0 37.0 37.0 80-84 36.3601 37.0 37.0 37.0 37.0 37.0 85-89 36.1386 37.0 37.0 37.0 37.0 37.0 90-94 35.362899999999996 37.0 37.0 37.0 29.8 37.0 95-99 36.14489999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.1235 37.0 37.0 37.0 37.0 37.0 105-109 36.1389 37.0 37.0 37.0 37.0 37.0 110-114 36.1536 37.0 37.0 37.0 37.0 37.0 115-119 36.4431 37.0 37.0 37.0 37.0 37.0 120-124 36.5305 37.0 37.0 37.0 37.0 37.0 125-129 36.4898 37.0 37.0 37.0 37.0 37.0 130-134 36.4942 37.0 37.0 37.0 37.0 37.0 135-139 36.4122 37.0 37.0 37.0 37.0 37.0 140-144 36.24640000000001 37.0 37.0 37.0 37.0 37.0 145-149 36.2307 37.0 37.0 37.0 37.0 37.0 150-151 33.54925 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 2.0 25 3.0 26 3.0 27 2.0 28 3.0 29 3.0 30 12.0 31 17.0 32 28.0 33 46.0 34 126.0 35 364.0 36 3211.0 37 177.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.824999999999996 9.049999999999999 5.575 33.550000000000004 2 22.22222222222222 9.556057185854025 33.08251818409832 35.13920240782543 3 18.9 16.525000000000002 26.3 38.275 4 26.400000000000002 21.325 22.175 30.099999999999998 5 27.875 26.5 21.675 23.95 6 23.075000000000003 32.65 21.55 22.725 7 19.05 25.650000000000002 38.05 17.25 8 20.849999999999998 23.075000000000003 28.575 27.500000000000004 9 18.85 22.175 33.800000000000004 25.174999999999997 10-14 23.805 26.450000000000003 25.180000000000003 24.565 15-19 23.965 25.445 25.415 25.174999999999997 20-24 23.275000000000002 25.779999999999998 25.290000000000003 25.655 25-29 23.23 26.19 25.0 25.580000000000002 30-34 23.005 25.814999999999998 25.695 25.485000000000003 35-39 22.915 25.205 25.974999999999998 25.905 40-44 23.29 25.955000000000002 25.0 25.755 45-49 23.200000000000003 25.745 25.509999999999998 25.545 50-54 23.605 24.65 25.395 26.35 55-59 23.62 25.474999999999998 24.645 26.26 60-64 23.365 25.27 25.595000000000002 25.77 65-69 23.65 25.345000000000002 25.245 25.759999999999998 70-74 23.669999999999998 25.935000000000002 25.230000000000004 25.165 75-79 23.21 25.41 25.555 25.825 80-84 23.72 25.085 25.605 25.590000000000003 85-89 23.5 25.415 25.2 25.885 90-94 22.62 25.61 25.474999999999998 26.295 95-99 23.36 24.67 25.505 26.465 100-104 23.635 25.095 25.305 25.965 105-109 23.465 25.435000000000002 25.045 26.055 110-114 23.965 25.445 24.915000000000003 25.674999999999997 115-119 24.22 25.715 24.474999999999998 25.590000000000003 120-124 23.599999999999998 24.89 25.669999999999998 25.840000000000003 125-129 23.785 25.674999999999997 24.37 26.169999999999998 130-134 24.19 25.740000000000002 23.775 26.295 135-139 24.205 25.314999999999998 25.085 25.395 140-144 24.485 25.835 23.915 25.765 145-149 24.055 25.66 24.154999999999998 26.13 150-151 23.9375 25.637500000000003 24.5375 25.887500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 1.0 28 2.0 29 2.0 30 3.0 31 9.0 32 15.0 33 15.5 34 23.0 35 35.5 36 42.5 37 48.5 38 70.0 39 89.0 40 110.0 41 140.5 42 167.0 43 181.0 44 191.5 45 199.5 46 203.5 47 219.0 48 206.5 49 188.5 50 169.0 51 153.0 52 153.5 53 137.0 54 116.0 55 108.5 56 99.0 57 89.0 58 84.0 59 87.0 60 79.0 61 59.0 62 53.0 63 57.0 64 59.5 65 51.0 66 47.0 67 46.5 68 43.5 69 34.0 70 26.0 71 22.5 72 18.5 73 14.0 74 9.5 75 5.5 76 3.5 77 3.0 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.775 #Duplication Level Percentage of deduplicated Percentage of total 1 84.6016114592659 70.875 2 12.384362876753208 20.75 3 2.4171888988361685 6.075 4 0.35810205908683973 1.2 5 0.17905102954341987 0.75 6 0.029841838257236648 0.15 7 0.0 0.0 8 0.029841838257236648 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCACCTGCAAGACTTGAAGGTAAGAAACCAGATTCCCCAAACCTGTTTCC 8 0.2 No Hit GTTCTGGTTGATGGTGTCAATGTCGAGTCCCTTCAGCTTCACGACAGACT 6 0.15 No Hit GTTCGTCTCATATTGTCAAGGCTGATGATGGAGCTGTCGCGGTCGAGGTG 5 0.125 No Hit CTTCTCAACTTCTGTGTCCACAGGTCTACTCTCAACTTCAGCTCTCAAAG 5 0.125 No Hit GCCTCATTTCTTGGTGAGCTGCTGCTCTAGTTGGATGTCAAGGCTAGTGA 5 0.125 No Hit GCCTCGGCAGCCTCACGGAGACCCTTCACAAGCCCATCATGAGCACTCGA 5 0.125 No Hit GTGCCCGCCTGAATACGGATCTGTTCTGCTACAACATTACAATTTGATGG 5 0.125 No Hit GGGCACTCCAAGGCAGTCCGGACCAGCAATGACACCATGGTGGTACATCG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.8624999999999998 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.3625 0.0 0.0 0.0 0.0 116-117 2.575 0.0 0.0 0.0 0.0 118-119 3.05 0.0 0.0 0.0 0.0 120-121 3.45 0.0 0.0 0.0 0.0 122-123 3.675 0.0 0.0 0.0 0.0 124-125 3.9375 0.0 0.0 0.0 0.0 126-127 4.25 0.0 0.0 0.0 0.0 128-129 4.675 0.0 0.0 0.0 0.0 130-131 5.375 0.0 0.0 0.0 0.0 132-133 5.725 0.0 0.0 0.0 0.0 134-135 6.275 0.0 0.0 0.0 0.0 136-137 7.075 0.0 0.0 0.0 0.0 138-139 7.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGACG 10 0.006830828 145.0 2 ACCGCCT 10 0.006830828 145.0 1 CCTTGGA 20 0.00593511 29.0 10-14 >>END_MODULE SRR18694440 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694440_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.325 37.0 37.0 37.0 25.0 37.0 2 35.0285 37.0 37.0 37.0 25.0 37.0 3 35.1395 37.0 37.0 37.0 25.0 37.0 4 35.222 37.0 37.0 37.0 25.0 37.0 5 35.0725 37.0 37.0 37.0 25.0 37.0 6 35.2065 37.0 37.0 37.0 25.0 37.0 7 35.1585 37.0 37.0 37.0 25.0 37.0 8 35.408 37.0 37.0 37.0 37.0 37.0 9 35.337 37.0 37.0 37.0 37.0 37.0 10-14 35.3981 37.0 37.0 37.0 37.0 37.0 15-19 35.544500000000006 37.0 37.0 37.0 37.0 37.0 20-24 35.2748 37.0 37.0 37.0 34.6 37.0 25-29 35.463100000000004 37.0 37.0 37.0 32.2 37.0 30-34 35.6337 37.0 37.0 37.0 37.0 37.0 35-39 35.5012 37.0 37.0 37.0 37.0 37.0 40-44 35.2167 37.0 37.0 37.0 29.8 37.0 45-49 35.3845 37.0 37.0 37.0 37.0 37.0 50-54 34.8075 37.0 37.0 37.0 27.0 37.0 55-59 34.3432 37.0 37.0 37.0 25.0 37.0 60-64 34.9362 37.0 37.0 37.0 27.4 37.0 65-69 34.173700000000004 37.0 34.6 37.0 27.4 37.0 70-74 32.9353 37.0 29.8 37.0 22.2 37.0 75-79 33.393299999999996 37.0 34.6 37.0 22.2 37.0 80-84 34.36129999999999 37.0 37.0 37.0 25.0 37.0 85-89 32.5873 37.0 32.2 37.0 19.4 37.0 90-94 33.961 37.0 37.0 37.0 25.0 37.0 95-99 33.9087 37.0 37.0 37.0 25.0 37.0 100-104 33.5265 37.0 37.0 37.0 25.0 37.0 105-109 34.1476 37.0 37.0 37.0 25.0 37.0 110-114 34.432100000000005 37.0 37.0 37.0 25.0 37.0 115-119 34.4177 37.0 37.0 37.0 25.0 37.0 120-124 33.975100000000005 37.0 37.0 37.0 25.0 37.0 125-129 33.8635 37.0 37.0 37.0 25.0 37.0 130-134 33.5727 37.0 34.6 37.0 25.0 37.0 135-139 32.0061 37.0 25.0 37.0 13.8 37.0 140-144 31.5154 37.0 25.0 37.0 11.0 37.0 145-149 31.124599999999997 37.0 25.0 37.0 11.0 37.0 150-151 30.658250000000002 37.0 25.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 5.0 17 4.0 18 6.0 19 3.0 20 5.0 21 2.0 22 11.0 23 7.0 24 9.0 25 9.0 26 16.0 27 16.0 28 19.0 29 63.0 30 92.0 31 157.0 32 250.0 33 512.0 34 1172.0 35 1430.0 36 211.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.824999999999996 20.724999999999998 7.875 25.575 2 31.324999999999996 22.400000000000002 26.400000000000002 19.875 3 21.75 24.4 29.799999999999997 24.05 4 28.349999999999998 28.349999999999998 20.175 23.125 5 26.55 32.800000000000004 19.775000000000002 20.875 6 25.05 33.324999999999996 19.325 22.3 7 24.4 18.625 35.099999999999994 21.875 8 22.525000000000002 22.45 24.975 30.049999999999997 9 23.7 20.5 26.875 28.925 10-14 26.63 25.419999999999998 23.369999999999997 24.58 15-19 26.505000000000003 25.085 24.435000000000002 23.974999999999998 20-24 25.674999999999997 25.575 24.205 24.545 25-29 26.235000000000003 24.709999999999997 24.035 25.019999999999996 30-34 25.06 24.72 25.240000000000002 24.98 35-39 26.05 25.264999999999997 23.955000000000002 24.73 40-44 25.735000000000003 25.040000000000003 24.834999999999997 24.39 45-49 25.615 25.264999999999997 24.735 24.385 50-54 24.52 25.605 25.965 23.91 55-59 25.44 25.56 24.075 24.925 60-64 26.205000000000002 25.09 24.48 24.224999999999998 65-69 25.555 25.285000000000004 24.465 24.695 70-74 26.88 24.52 25.230000000000004 23.369999999999997 75-79 27.3 23.505000000000003 25.535000000000004 23.66 80-84 25.71 25.41 24.404999999999998 24.474999999999998 85-89 23.655 27.96 24.365000000000002 24.02 90-94 26.66 25.05 24.365000000000002 23.925 95-99 26.325 25.77 23.974999999999998 23.93 100-104 26.424999999999997 25.045 24.855 23.674999999999997 105-109 25.759999999999998 25.180000000000003 24.915000000000003 24.145 110-114 26.565 25.795 23.705000000000002 23.935000000000002 115-119 26.779999999999998 25.874999999999996 24.115000000000002 23.23 120-124 26.245 25.474999999999998 25.11 23.169999999999998 125-129 26.889999999999997 25.285000000000004 25.145 22.68 130-134 26.884999999999998 24.865000000000002 25.405 22.845 135-139 27.0 25.605 24.725 22.67 140-144 27.529999999999998 26.245 23.385 22.84 145-149 27.134999999999998 26.290000000000003 24.240000000000002 22.335 150-151 25.912499999999998 25.8 26.3625 21.925 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 1.5 26 0.5 27 0.5 28 3.5 29 6.5 30 7.0 31 8.5 32 12.5 33 18.0 34 20.5 35 30.5 36 43.0 37 47.5 38 70.0 39 84.0 40 90.5 41 124.0 42 148.0 43 180.0 44 190.0 45 174.0 46 176.5 47 191.0 48 200.0 49 176.0 50 151.5 51 142.5 52 144.5 53 142.5 54 123.0 55 105.5 56 101.0 57 108.5 58 109.0 59 100.0 60 80.5 61 78.0 62 89.5 63 76.0 64 59.5 65 48.5 66 51.5 67 57.0 68 52.5 69 39.5 70 32.0 71 27.0 72 18.0 73 14.5 74 9.0 75 5.5 76 4.5 77 3.5 78 2.0 79 0.5 80 1.5 81 1.5 82 0.5 83 1.5 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 1.0 93 1.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 86.29173989455184 73.65 2 11.189220855301699 19.1 3 1.9917984768599881 5.1 4 0.29291154071470415 1.0 5 0.11716461628588166 0.5 6 0.05858230814294083 0.3 7 0.05858230814294083 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 7 0.17500000000000002 No Hit AACCAGTTCACGGGTCCAATCCCTGATCTGAGCAAATCACAGCTGGAGTC 7 0.17500000000000002 No Hit GAGTGGAAGGGCCTGGGACAACCTCCTGCAGAACAAGACTGCATTCACCA 6 0.15 No Hit GCTGTGGCCATCCCTGCTGAGAAGCTCCTTTCTGGGGAGAAGATCGAGGA 6 0.15 No Hit GCAATATCTAATTCAGATGTAAAGAGCGGTGATGGTGACCACCAAGTAAT 5 0.125 No Hit CGAAAACCCTAACGCCGCCGCTCTCCAAGCCCTCAAGGCTCCAGATCCCT 5 0.125 No Hit CACACCAATTTTGCGTCTCCGATAAGCAACTCTTGGTCTTTGGACTTGCG 5 0.125 No Hit GACACACATGATGACGAGGCTGCCCTCCCGCGCCGGCTCTCCCGGTCCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.3875 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.8375 0.0 0.0 0.0 0.0 110-111 1.975 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.3375000000000004 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 3.0250000000000004 0.0 0.0 0.0 0.0 120-121 3.425 0.0 0.0 0.0 0.0 122-123 3.6500000000000004 0.0 0.0 0.0 0.0 124-125 3.9125 0.0 0.0 0.0 0.0 126-127 4.199999999999999 0.0 0.0 0.0 0.0 128-129 4.625 0.0 0.0 0.0 0.0 130-131 5.3 0.0 0.0 0.0 0.0 132-133 5.65 0.0 0.0 0.0 0.0 134-135 6.175 0.0 0.0 0.0 0.0 136-137 6.9625 0.0 0.0 0.0 0.0 138-139 7.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATACTT 10 0.006830828 145.0 7 TGATTGC 10 0.006830828 145.0 8 GATTGCA 10 0.006830828 145.0 9 TTGGGAC 10 0.006830828 145.0 2 ATGCCAA 10 0.006830828 145.0 6 TTGATTG 10 0.006830828 145.0 7 GTCCAAC 10 0.006830828 145.0 6 ATACTTG 10 0.006830828 145.0 8 >>END_MODULE Read 767117 spots for SRR18694440.sra Written 767117 spots for SRR18694440.sra Read 767117 spots for SRR18694440.sra Written 767117 spots for SRR18694440.sra Read 767117 spots for SRR18694440.sra Written 767117 spots for SRR18694440.sra Read 767117 spots for SRR18694440.sra Written 767117 spots for SRR18694440.sra Read 767117 spots for SRR18694440.sra Written 767117 spots for SRR18694440.sra Read 767117 spots for SRR18694440.sra Written 767117 spots for SRR18694440.sra Read 767117 spots for SRR18694440.sra Written 767117 spots for SRR18694440.sra Read 767117 spots for SRR18694440.sra Written 767117 spots for SRR18694440.sra Read 767117 spots for SRR18694440.sra Written 767117 spots for SRR18694440.sra Read 767117 spots for SRR18694440.sra Written 767117 spots for SRR18694440.sra Read 767117 spots for SRR18694440.sra Written 767117 spots for SRR18694440.sra Read 767117 spots for SRR18694440.sra Written 767117 spots for SRR18694440.sra Read 767117 spots for SRR18694440.sra Written 767117 spots for SRR18694440.sra Read 767117 spots for SRR18694440.sra Written 767117 spots for SRR18694440.sra Read 767117 spots for SRR18694440.sra Written 767117 spots for SRR18694440.sra Read 767130 spots for SRR18694440.sra Written 767130 spots for SRR18694440.sra Read 767117 spots for SRR18694440.sra Written 767117 spots for SRR18694440.sra Read 767117 spots for SRR18694440.sra Written 767117 spots for SRR18694440.sra Read 767117 spots for SRR18694440.sra Written 767117 spots for SRR18694440.sra Read 767117 spots for SRR18694440.sra Written 767117 spots for SRR18694440.sra SRR ids: ['SRR18694440.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rf_q2bfz SRR18694440.sra spots: 15342353 blocks: [[1, 767117], [767118, 1534234], [1534235, 2301351], [2301352, 3068468], [3068469, 3835585], [3835586, 4602702], [4602703, 5369819], [5369820, 6136936], [6136937, 6904053], [6904054, 7671170], [7671171, 8438287], [8438288, 9205404], [9205405, 9972521], [9972522, 10739638], [10739639, 11506755], [11506756, 12273872], [12273873, 13040989], [13040990, 13808106], [13808107, 14575223], [14575224, 15342353]] SRR18694440 file size 5192302 SRR18694440 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694440 SRR18694440_1.fastq SRR18694440_2.fastq Input file: SRR18694440_1.fastq Paired file: SRR18694440_2.fastq trimmed: SRR18694440-trimmed-pair1.fastq, SRR18694440-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:51:38 2024 >> started Tue Dec 10 06:51:55 2024 >> done (17.334s) 15342353 read pairs processed; of these: 126 ( 0.00%) short read pairs filtered out after trimming by size control 6298 ( 0.04%) empty read pairs filtered out after trimming by size control 15335929 (99.96%) read pairs available; of these: 1818326 (11.86%) trimmed read pairs available after processing 13517603 (88.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 21 0.00% 20 20 0.00% 21 15 0.00% 22 16 0.00% 23 29 0.00% 24 32 0.00% 25 34 0.00% 26 33 0.00% 27 33 0.00% 28 27 0.00% 29 39 0.00% 30 45 0.00% 31 37 0.00% 32 44 0.00% 33 50 0.00% 34 44 0.00% 35 55 0.00% 36 41 0.00% 37 40 0.00% 38 59 0.00% 39 59 0.00% 40 48 0.00% 41 63 0.00% 42 83 0.00% 43 59 0.00% 44 55 0.00% 45 81 0.00% 46 57 0.00% 47 54 0.00% 48 79 0.00% 49 69 0.00% 50 97 0.00% 51 112 0.00% 52 140 0.00% 53 153 0.00% 54 139 0.00% 55 161 0.00% 56 162 0.00% 57 156 0.00% 58 193 0.00% 59 255 0.00% 60 284 0.00% 61 318 0.00% 62 358 0.00% 63 377 0.00% 64 406 0.00% 65 455 0.00% 66 510 0.00% 67 517 0.00% 68 686 0.00% 69 708 0.00% 70 959 0.01% 71 949 0.01% 72 1208 0.01% 73 1330 0.01% 74 1488 0.01% 75 1644 0.01% 76 1782 0.01% 77 1947 0.01% 78 2084 0.01% 79 2319 0.02% 80 2688 0.02% 81 2965 0.02% 82 3491 0.02% 83 3816 0.02% 84 4273 0.03% 85 4364 0.03% 86 4807 0.03% 87 5276 0.03% 88 5655 0.04% 89 6113 0.04% 90 6711 0.04% 91 7248 0.05% 92 7956 0.05% 93 8476 0.06% 94 8964 0.06% 95 9851 0.06% 96 10018 0.07% 97 10524 0.07% 98 11163 0.07% 99 11867 0.08% 100 12692 0.08% 101 13096 0.09% 102 14125 0.09% 103 14705 0.10% 104 15702 0.10% 105 16262 0.11% 106 16758 0.11% 107 17253 0.11% 108 17921 0.12% 109 18398 0.12% 110 18781 0.12% 111 20156 0.13% 112 21248 0.14% 113 22063 0.14% 114 23556 0.15% 115 23961 0.16% 116 25247 0.16% 117 25324 0.17% 118 25833 0.17% 119 27120 0.18% 120 27823 0.18% 121 28716 0.19% 122 29649 0.19% 123 31190 0.20% 124 31750 0.21% 125 33086 0.22% 126 33829 0.22% 127 34201 0.22% 128 34562 0.23% 129 35466 0.23% 130 36250 0.24% 131 36702 0.24% 132 38057 0.25% 133 39261 0.26% 134 40053 0.26% 135 41787 0.27% 136 42622 0.28% 137 43147 0.28% 138 43220 0.28% 139 43545 0.28% 140 44688 0.29% 141 45109 0.29% 142 46688 0.30% 143 47345 0.31% 144 49099 0.32% 145 50141 0.33% 146 50647 0.33% 147 52011 0.34% 148 52576 0.34% 149 51999 0.34% 150 53349 0.35% 151 13517603 88.14% 15335929 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=31 prefix-density=0.24 prefix-fanout=2.4 sequence=GCCAAAGATGTATA criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=174.89 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=19.6 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=37 prefix-density=0.62 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=973.38 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=21.1 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR18694440 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:52:45 Started mapping on | Dec 10 06:52:45 Finished on | Dec 10 06:54:31 Mapping speed, Million of reads per hour | 520.84 Number of input reads | 15335929 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14013066 Uniquely mapped reads % | 91.37% Average mapped length | 294.64 Number of splices: Total | 14776458 Number of splices: Annotated (sjdb) | 13868596 Number of splices: GT/AG | 14580494 Number of splices: GC/AG | 162247 Number of splices: AT/AC | 9233 Number of splices: Non-canonical | 24484 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 2.65 Insertion rate per base | 0.01% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 190434 % of reads mapped to multiple loci | 1.24% Number of reads mapped to too many loci | 52559 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.10% % of reads unmapped: other | 2.94% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1132429 1132429 1132429 N_multimapping 190434 190434 190434 N_noFeature 595705 13673864 713483 N_ambiguous 258429 1786 37749 UnstrandedReadsAssigned:13158932 PositiveStrandReadsAssigned:337416 NegativeStrandReadsAssigned:13261834 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694440 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694440-trimmed-pair1.fastq SRR18694440-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,335,929 reads, 13,503,288 reads pseudoaligned [quant] estimated average fragment length: 255.494 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52973 SRR18694440.ke.tsv 35125 SRR18694440.se.tsv 88098 total ==> SRR18694440.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 681.974 0 0 PNS24247 1044 789.506 56.3312 8.02845 PNS24249 1928 1673.51 68.2096 4.58623 PNS24246 1044 789.506 56.3312 8.02845 PNS24248 1044 789.506 56.3312 8.02845 PNS24244 1471 1216.51 53.7968 4.97599 PNS24243 293 96.8869 1 1.16138 KQK14069 1603 1348.51 1723.08 143.777 KQK14071 474 240.867 25.8173 12.0607 ==> SRR18694440.se.tsv <== BRADI_1g14170v3 1873 BRADI_1g53295v3 49 BRADI_1g59795v3 284 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 574 BRADI_1g74790v3 47 BRADI_1g09890v3 0 BRADI_1g77505v3 103 BRADI_1g48960v3 0 SRR18694440 completed mapping pipeline successfully