Starting /dee2/code/volunteer_pipeline.sh SRR18694441 current disk space = 1525899866112 free memory = 1552993512 SRR18694441 SRAfilesize fb3519903154614827782e9e72f9dc24 SRR18694441.sra SRR18694441.sra file validated SRR18694441 is paired end SRR18694441 is conventional basespace SRR18694441 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694441_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.136 37.0 37.0 37.0 37.0 37.0 2 36.00675 37.0 37.0 37.0 37.0 37.0 3 36.444 37.0 37.0 37.0 37.0 37.0 4 36.599 37.0 37.0 37.0 37.0 37.0 5 36.5915 37.0 37.0 37.0 37.0 37.0 6 36.621 37.0 37.0 37.0 37.0 37.0 7 36.5725 37.0 37.0 37.0 37.0 37.0 8 36.604 37.0 37.0 37.0 37.0 37.0 9 36.651 37.0 37.0 37.0 37.0 37.0 10-14 36.63879999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.64979999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.617000000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.5831 37.0 37.0 37.0 37.0 37.0 30-34 36.5135 37.0 37.0 37.0 37.0 37.0 35-39 36.702099999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.6414 37.0 37.0 37.0 37.0 37.0 45-49 36.450900000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.5604 37.0 37.0 37.0 37.0 37.0 55-59 36.54350000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.519099999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.3518 37.0 37.0 37.0 37.0 37.0 70-74 36.405 37.0 37.0 37.0 37.0 37.0 75-79 36.4858 37.0 37.0 37.0 37.0 37.0 80-84 36.4298 37.0 37.0 37.0 37.0 37.0 85-89 36.2599 37.0 37.0 37.0 37.0 37.0 90-94 35.432599999999994 37.0 37.0 37.0 29.8 37.0 95-99 36.1317 37.0 37.0 37.0 37.0 37.0 100-104 36.1564 37.0 37.0 37.0 37.0 37.0 105-109 36.1833 37.0 37.0 37.0 37.0 37.0 110-114 36.1728 37.0 37.0 37.0 37.0 37.0 115-119 36.4827 37.0 37.0 37.0 37.0 37.0 120-124 36.5675 37.0 37.0 37.0 37.0 37.0 125-129 36.5416 37.0 37.0 37.0 37.0 37.0 130-134 36.50279999999999 37.0 37.0 37.0 37.0 37.0 135-139 36.3922 37.0 37.0 37.0 37.0 37.0 140-144 36.23350000000001 37.0 37.0 37.0 37.0 37.0 145-149 36.177800000000005 37.0 37.0 37.0 37.0 37.0 150-151 33.78975 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 1.0 26 0.0 27 3.0 28 3.0 29 1.0 30 9.0 31 14.0 32 25.0 33 60.0 34 127.0 35 335.0 36 3233.0 37 188.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.3 9.65 4.95 36.1 2 20.863670600050213 10.369068541300527 37.15792116495104 31.609339693698217 3 18.7 13.950000000000001 25.724999999999998 41.625 4 26.025 21.925 21.349999999999998 30.7 5 26.724999999999998 27.575 23.425 22.275 6 23.525 29.925 21.8 24.75 7 18.6 25.674999999999997 37.425000000000004 18.3 8 20.45 24.3 31.55 23.7 9 20.175 21.0 33.650000000000006 25.174999999999997 10-14 22.830000000000002 26.950000000000003 26.555 23.665 15-19 22.715 25.115 26.105 26.064999999999998 20-24 22.985 25.374999999999996 25.915 25.724999999999998 25-29 23.0 25.415 25.715 25.869999999999997 30-34 22.8 25.75 25.540000000000003 25.91 35-39 23.235 25.46 25.855 25.45 40-44 22.795 25.759999999999998 25.36 26.085 45-49 22.575 26.0 25.665 25.759999999999998 50-54 22.939999999999998 25.665 25.740000000000002 25.655 55-59 23.195 25.869999999999997 24.87 26.064999999999998 60-64 23.169999999999998 25.430000000000003 25.430000000000003 25.97 65-69 22.32 25.53 25.645 26.505000000000003 70-74 23.3 25.81 25.485000000000003 25.405 75-79 22.99 25.3 25.805 25.905 80-84 23.05 25.995 25.46 25.495 85-89 23.400000000000002 25.795 25.15 25.655 90-94 23.825 25.21 25.295 25.669999999999998 95-99 23.535 25.674999999999997 25.215 25.575 100-104 24.0 25.64 24.935 25.424999999999997 105-109 23.72 25.679999999999996 25.064999999999998 25.535000000000004 110-114 23.1 25.705 25.490000000000002 25.705 115-119 24.099999999999998 25.455 25.695 24.75 120-124 23.49 25.46 24.595 26.455000000000002 125-129 23.06 25.365 25.405 26.169999999999998 130-134 23.79 25.835 25.28 25.095 135-139 23.735 25.085 25.245 25.935000000000002 140-144 23.885 25.1 25.305 25.71 145-149 24.5 25.31 25.305 24.884999999999998 150-151 23.025000000000002 26.087500000000002 24.462500000000002 26.424999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 2.0 27 1.0 28 2.0 29 4.0 30 5.0 31 8.5 32 11.5 33 18.0 34 24.5 35 29.5 36 42.0 37 61.5 38 83.0 39 111.5 40 124.5 41 132.5 42 143.0 43 167.5 44 192.0 45 204.0 46 197.5 47 204.5 48 218.5 49 209.0 50 192.5 51 170.5 52 157.0 53 150.5 54 139.0 55 109.0 56 94.0 57 77.5 58 71.0 59 73.0 60 62.0 61 59.0 62 60.5 63 51.0 64 47.5 65 48.5 66 40.5 67 37.0 68 37.5 69 33.0 70 25.5 71 19.0 72 16.0 73 11.0 74 6.5 75 5.5 76 2.5 77 1.0 78 2.0 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.42500000000000004 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.725 #Duplication Level Percentage of deduplicated Percentage of total 1 87.37388296339003 75.775 2 10.579417699625253 18.35 3 1.614298068607668 4.2 4 0.28826751225136926 1.0 5 0.08648025367541078 0.375 6 0.057653502450273855 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAACAACCGTATCAGCAGAAATAAACCTTGCCCGGGACAAATAGCTTC 6 0.15 No Hit GCCACAACAATTTTCCCATCCTTATTTGCTTCCTCGATCTTCTGGTCCCA 6 0.15 No Hit GCCCAGATGGCCGGGTGTGGGTCGCGCGCTTTAGCGCCATCCATTTTCGG 5 0.125 No Hit CTTTGAAACAGATGTCTTCATGCGAAGCATTTTCGTCTCCATCTCTCAAT 5 0.125 No Hit CGACCATGGAGCTGATGAAGAGAGGAAGCACACGGAGCACAATCTTCGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.47500000000000003 0.0 0.0 0.0 0.0 90-91 0.65 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.2125 0.0 0.0 0.0 0.0 100-101 1.3 0.0 0.0 0.0 0.0 102-103 1.4125 0.0 0.0 0.0 0.0 104-105 1.6124999999999998 0.0 0.0 0.0 0.0 106-107 1.9125 0.0 0.0 0.0 0.0 108-109 2.1624999999999996 0.0 0.0 0.0 0.0 110-111 2.75 0.0 0.0 0.0 0.0 112-113 3.0875 0.0 0.0 0.0 0.0 114-115 3.3875 0.0 0.0 0.0 0.0 116-117 3.8125 0.0 0.0 0.0 0.0 118-119 4.1 0.0 0.0 0.0 0.0 120-121 4.4 0.0 0.0 0.0 0.0 122-123 4.6875 0.0 0.0 0.0 0.0 124-125 5.1625 0.0 0.0 0.0 0.0 126-127 5.75 0.0 0.0 0.0 0.0 128-129 6.3125 0.0 0.0 0.0 0.0 130-131 6.65 0.0 0.0 0.0 0.0 132-133 6.9375 0.0 0.0 0.0 0.0 134-135 7.512499999999999 0.0 0.0 0.0 0.0 136-137 8.2 0.0 0.0 0.0 0.0 138-139 8.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18694441 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694441_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.979 37.0 37.0 37.0 25.0 37.0 2 35.0055 37.0 37.0 37.0 25.0 37.0 3 34.9935 37.0 37.0 37.0 25.0 37.0 4 35.0575 37.0 37.0 37.0 25.0 37.0 5 35.1 37.0 37.0 37.0 25.0 37.0 6 35.243 37.0 37.0 37.0 25.0 37.0 7 35.1885 37.0 37.0 37.0 25.0 37.0 8 35.4825 37.0 37.0 37.0 37.0 37.0 9 35.4235 37.0 37.0 37.0 37.0 37.0 10-14 35.5209 37.0 37.0 37.0 37.0 37.0 15-19 35.5697 37.0 37.0 37.0 34.6 37.0 20-24 35.3189 37.0 37.0 37.0 32.2 37.0 25-29 35.5294 37.0 37.0 37.0 32.2 37.0 30-34 35.68509999999999 37.0 37.0 37.0 37.0 37.0 35-39 35.570299999999996 37.0 37.0 37.0 34.6 37.0 40-44 35.331900000000005 37.0 37.0 37.0 29.8 37.0 45-49 35.4269 37.0 37.0 37.0 32.2 37.0 50-54 34.952 37.0 37.0 37.0 29.8 37.0 55-59 34.3299 37.0 37.0 37.0 25.0 37.0 60-64 34.9948 37.0 37.0 37.0 27.4 37.0 65-69 34.23780000000001 37.0 34.6 37.0 27.4 37.0 70-74 33.068 37.0 29.8 37.0 25.0 37.0 75-79 33.6726 37.0 34.6 37.0 22.2 37.0 80-84 34.645399999999995 37.0 37.0 37.0 25.0 37.0 85-89 32.684900000000006 37.0 32.2 37.0 19.4 37.0 90-94 34.1671 37.0 37.0 37.0 25.0 37.0 95-99 33.9195 37.0 37.0 37.0 25.0 37.0 100-104 33.455400000000004 37.0 37.0 37.0 25.0 37.0 105-109 34.2695 37.0 37.0 37.0 25.0 37.0 110-114 34.6289 37.0 37.0 37.0 25.0 37.0 115-119 34.445299999999996 37.0 37.0 37.0 25.0 37.0 120-124 34.174800000000005 37.0 37.0 37.0 25.0 37.0 125-129 33.9473 37.0 37.0 37.0 25.0 37.0 130-134 33.68 37.0 34.6 37.0 25.0 37.0 135-139 32.1078 37.0 25.0 37.0 13.8 37.0 140-144 31.516399999999997 37.0 25.0 37.0 11.0 37.0 145-149 31.040499999999998 37.0 25.0 37.0 11.0 37.0 150-151 30.737750000000002 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 1.0 18 7.0 19 3.0 20 2.0 21 2.0 22 5.0 23 5.0 24 4.0 25 11.0 26 9.0 27 16.0 28 24.0 29 37.0 30 72.0 31 154.0 32 275.0 33 586.0 34 1199.0 35 1380.0 36 206.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.175000000000004 20.9 8.275 27.650000000000002 2 31.924999999999997 22.85 27.200000000000003 18.025 3 23.05 24.95 28.775000000000002 23.225 4 26.724999999999998 29.9 20.225 23.150000000000002 5 27.55 32.7 20.349999999999998 19.400000000000002 6 23.525 36.125 18.875 21.475 7 23.35 21.349999999999998 34.375 20.925 8 24.349999999999998 22.675 24.8 28.175 9 24.0 22.025 27.675 26.3 10-14 26.040000000000003 26.405 23.435 24.12 15-19 25.735000000000003 25.385 24.64 24.240000000000002 20-24 25.72 24.93 24.595 24.755 25-29 25.679999999999996 25.745 24.310000000000002 24.265 30-34 25.430000000000003 24.69 25.174999999999997 24.705 35-39 25.580000000000002 25.045 25.56 23.815 40-44 25.25 25.290000000000003 24.935 24.525 45-49 25.385 26.205000000000002 23.87 24.54 50-54 24.19 25.019999999999996 26.63 24.16 55-59 25.674999999999997 25.915 24.375 24.035 60-64 26.009999999999998 24.735 25.105 24.15 65-69 26.55 25.405 24.104999999999997 23.94 70-74 25.905 25.290000000000003 25.290000000000003 23.515 75-79 27.41 23.86 25.069999999999997 23.66 80-84 25.235000000000003 25.619999999999997 25.119999999999997 24.025 85-89 24.0 28.285 24.355 23.36 90-94 26.105 25.580000000000002 24.705 23.61 95-99 25.865 25.929999999999996 24.785 23.419999999999998 100-104 26.31 25.345000000000002 24.85 23.494999999999997 105-109 26.35 25.715 24.884999999999998 23.05 110-114 26.41 25.895000000000003 24.185000000000002 23.51 115-119 26.645000000000003 25.585 25.16 22.61 120-124 26.355 25.66 24.89 23.095 125-129 26.71 25.47 24.955 22.865 130-134 26.900000000000002 25.945 24.945 22.21 135-139 26.395000000000003 26.61 24.759999999999998 22.235 140-144 27.51 25.064999999999998 25.495 21.93 145-149 28.455000000000002 25.655 23.919999999999998 21.97 150-151 26.224999999999998 25.087500000000002 27.9125 20.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 2.0 27 2.5 28 2.5 29 5.5 30 6.5 31 8.0 32 11.5 33 13.0 34 22.5 35 31.0 36 48.0 37 67.5 38 81.5 39 100.0 40 116.0 41 129.5 42 141.0 43 157.0 44 185.0 45 197.5 46 208.0 47 205.5 48 169.5 49 157.5 50 166.5 51 171.5 52 152.5 53 126.5 54 122.0 55 116.5 56 102.0 57 94.5 58 99.5 59 93.0 60 75.0 61 68.5 62 68.5 63 65.0 64 60.5 65 55.0 66 54.0 67 50.0 68 37.5 69 27.0 70 25.5 71 27.5 72 20.0 73 17.0 74 12.5 75 6.0 76 4.5 77 3.5 78 1.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.775 #Duplication Level Percentage of deduplicated Percentage of total 1 88.43634292224436 77.625 2 9.68385075477072 17.0 3 1.5380233551694675 4.05 4 0.25633722586157787 0.8999999999999999 5 0.02848191398461977 0.125 6 0.05696382796923954 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCACAATGGGAGGCTGTGTGGGCAAGGATCGTGGTATTGTGGAAGATA 6 0.15 No Hit GTGCACAAATCTAAATTTGCTCAGTTTATCATGTTTTATGCCTGCTCACT 6 0.15 No Hit GGAACAGGTTCTATTGACGCACTCTCTCAAACAAATAGTCTGAAATTCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 0.9875 0.0 0.0 0.0 0.0 98-99 1.1375 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.5499999999999998 0.0 0.0 0.0 0.0 106-107 1.8625 0.0 0.0 0.0 0.0 108-109 2.125 0.0 0.0 0.0 0.0 110-111 2.725 0.0 0.0 0.0 0.0 112-113 3.0625 0.0 0.0 0.0 0.0 114-115 3.3625 0.0 0.0 0.0 0.0 116-117 3.7625 0.0 0.0 0.0 0.0 118-119 4.05 0.0 0.0 0.0 0.0 120-121 4.35 0.0 0.0 0.0 0.0 122-123 4.637499999999999 0.0 0.0 0.0 0.0 124-125 5.1125 0.0 0.0 0.0 0.0 126-127 5.699999999999999 0.0 0.0 0.0 0.0 128-129 6.2625 0.0 0.0 0.0 0.0 130-131 6.6 0.0 0.0 0.0 0.0 132-133 6.8875 0.0 0.0 0.0 0.0 134-135 7.4625 0.0 0.0 0.0 0.0 136-137 8.1375 0.0 0.0 0.0 0.0 138-139 8.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACCGC 10 0.006830828 145.0 8 ATCATGG 10 0.006830828 145.0 7 >>END_MODULE Read 390523 spots for SRR18694441.sra Written 390523 spots for SRR18694441.sra Read 390523 spots for SRR18694441.sra Written 390523 spots for SRR18694441.sra Read 390523 spots for SRR18694441.sra Written 390523 spots for SRR18694441.sra Read 390523 spots for SRR18694441.sra Written 390523 spots for SRR18694441.sra Read 390523 spots for SRR18694441.sra Written 390523 spots for SRR18694441.sra Read 390523 spots for SRR18694441.sra Written 390523 spots for SRR18694441.sra Read 390523 spots for SRR18694441.sra Written 390523 spots for SRR18694441.sra Read 390523 spots for SRR18694441.sra Written 390523 spots for SRR18694441.sra Read 390523 spots for SRR18694441.sra Written 390523 spots for SRR18694441.sra Read 390527 spots for SRR18694441.sra Written 390527 spots for SRR18694441.sra Read 390523 spots for SRR18694441.sra Read 390523 spots for SRR18694441.sra Written 390523 spots for SRR18694441.sra Written 390523 spots for SRR18694441.sra Read 390523 spots for SRR18694441.sra Written 390523 spots for SRR18694441.sra Read 390523 spots for SRR18694441.sra Written 390523 spots for SRR18694441.sra Read 390523 spots for SRR18694441.sra Written 390523 spots for SRR18694441.sra Read 390523 spots for SRR18694441.sra Written 390523 spots for SRR18694441.sra Read 390523 spots for SRR18694441.sra Written 390523 spots for SRR18694441.sra Read 390523 spots for SRR18694441.sra Written 390523 spots for SRR18694441.sra Read 390523 spots for SRR18694441.sra Written 390523 spots for SRR18694441.sra Read 390523 spots for SRR18694441.sra Written 390523 spots for SRR18694441.sra SRR ids: ['SRR18694441.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cmsveow6 SRR18694441.sra spots: 7810464 blocks: [[1, 390523], [390524, 781046], [781047, 1171569], [1171570, 1562092], [1562093, 1952615], [1952616, 2343138], [2343139, 2733661], [2733662, 3124184], [3124185, 3514707], [3514708, 3905230], [3905231, 4295753], [4295754, 4686276], [4686277, 5076799], [5076800, 5467322], [5467323, 5857845], [5857846, 6248368], [6248369, 6638891], [6638892, 7029414], [7029415, 7419937], [7419938, 7810464]] SRR18694441 file size 2636913 SRR18694441 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694441 SRR18694441_1.fastq SRR18694441_2.fastq Input file: SRR18694441_1.fastq Paired file: SRR18694441_2.fastq trimmed: SRR18694441-trimmed-pair1.fastq, SRR18694441-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:52:09 2024 >> started Tue Dec 10 06:52:20 2024 >> done (10.690s) 7810464 read pairs processed; of these: 94 ( 0.00%) short read pairs filtered out after trimming by size control 868 ( 0.01%) empty read pairs filtered out after trimming by size control 7809502 (99.99%) read pairs available; of these: 1042865 (13.35%) trimmed read pairs available after processing 6766637 (86.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 6 0.00% 21 4 0.00% 22 10 0.00% 23 17 0.00% 24 21 0.00% 25 12 0.00% 26 9 0.00% 27 18 0.00% 28 24 0.00% 29 14 0.00% 30 13 0.00% 31 22 0.00% 32 11 0.00% 33 22 0.00% 34 25 0.00% 35 15 0.00% 36 20 0.00% 37 22 0.00% 38 25 0.00% 39 34 0.00% 40 32 0.00% 41 37 0.00% 42 31 0.00% 43 33 0.00% 44 33 0.00% 45 42 0.00% 46 44 0.00% 47 32 0.00% 48 37 0.00% 49 68 0.00% 50 84 0.00% 51 79 0.00% 52 77 0.00% 53 76 0.00% 54 87 0.00% 55 87 0.00% 56 88 0.00% 57 143 0.00% 58 111 0.00% 59 154 0.00% 60 185 0.00% 61 193 0.00% 62 251 0.00% 63 275 0.00% 64 297 0.00% 65 335 0.00% 66 359 0.00% 67 424 0.01% 68 488 0.01% 69 581 0.01% 70 641 0.01% 71 761 0.01% 72 848 0.01% 73 1011 0.01% 74 1034 0.01% 75 1021 0.01% 76 1198 0.02% 77 1373 0.02% 78 1456 0.02% 79 1719 0.02% 80 1892 0.02% 81 2072 0.03% 82 2383 0.03% 83 2523 0.03% 84 2745 0.04% 85 3107 0.04% 86 3193 0.04% 87 3501 0.04% 88 3928 0.05% 89 4148 0.05% 90 4325 0.06% 91 4628 0.06% 92 4965 0.06% 93 5576 0.07% 94 5577 0.07% 95 6116 0.08% 96 6254 0.08% 97 6698 0.09% 98 6996 0.09% 99 7419 0.09% 100 7553 0.10% 101 7885 0.10% 102 8373 0.11% 103 8843 0.11% 104 9319 0.12% 105 9618 0.12% 106 9970 0.13% 107 10573 0.14% 108 10889 0.14% 109 11368 0.15% 110 11637 0.15% 111 12000 0.15% 112 12323 0.16% 113 13066 0.17% 114 13496 0.17% 115 13792 0.18% 116 14242 0.18% 117 14868 0.19% 118 15016 0.19% 119 15418 0.20% 120 16135 0.21% 121 16231 0.21% 122 16999 0.22% 123 17219 0.22% 124 18008 0.23% 125 18629 0.24% 126 18804 0.24% 127 19418 0.25% 128 19638 0.25% 129 20297 0.26% 130 20225 0.26% 131 21010 0.27% 132 21590 0.28% 133 22177 0.28% 134 22248 0.28% 135 23208 0.30% 136 23869 0.31% 137 23816 0.30% 138 23941 0.31% 139 24732 0.32% 140 24977 0.32% 141 25288 0.32% 142 26067 0.33% 143 26537 0.34% 144 27037 0.35% 145 27344 0.35% 146 27764 0.36% 147 28395 0.36% 148 28570 0.37% 149 28753 0.37% 150 29466 0.38% 151 6766637 86.65% 7809502 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=33 prefix-density=0.24 prefix-fanout=2.3 sequence=GCCAAAGATGTATA criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=437.34 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=37.3 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=30 prefix-density=0.65 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=940.80 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=19.5 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR18694441 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:53:09 Started mapping on | Dec 10 06:53:09 Finished on | Dec 10 06:54:34 Mapping speed, Million of reads per hour | 330.76 Number of input reads | 7809502 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 7227926 Uniquely mapped reads % | 92.55% Average mapped length | 293.87 Number of splices: Total | 7644659 Number of splices: Annotated (sjdb) | 7181263 Number of splices: GT/AG | 7542908 Number of splices: GC/AG | 84582 Number of splices: AT/AC | 5132 Number of splices: Non-canonical | 12037 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.01% Deletion average length | 2.68 Insertion rate per base | 0.01% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 95979 % of reads mapped to multiple loci | 1.23% Number of reads mapped to too many loci | 19682 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.00% % of reads unmapped: other | 1.96% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 485597 485597 485597 N_multimapping 95979 95979 95979 N_noFeature 310490 7055455 369695 N_ambiguous 131572 863 18705 UnstrandedReadsAssigned:6785864 PositiveStrandReadsAssigned:171608 NegativeStrandReadsAssigned:6839526 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694441 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694441-trimmed-pair1.fastq SRR18694441-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,809,502 reads, 6,928,816 reads pseudoaligned [quant] estimated average fragment length: 249.365 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52973 SRR18694441.ke.tsv 35125 SRR18694441.se.tsv 88098 total ==> SRR18694441.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 688.181 54.11 17.6998 PNS24247 1044 795.635 19.422 5.49507 PNS24249 1928 1679.64 9.00291 1.20659 PNS24246 1044 795.635 19.422 5.49507 PNS24248 1044 795.635 19.422 5.49507 PNS24244 1471 1222.64 47.6209 8.76786 PNS24243 293 99.7225 0 0 KQK14069 1603 1354.64 444.759 73.9086 KQK14071 474 245.185 3.44239 3.16052 ==> SRR18694441.se.tsv <== BRADI_1g14170v3 497 BRADI_1g53295v3 26 BRADI_1g59795v3 197 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 247 BRADI_1g74790v3 40 BRADI_1g09890v3 0 BRADI_1g77505v3 59 BRADI_1g48960v3 0 SRR18694441 completed mapping pipeline successfully