Starting /dee2/code/volunteer_pipeline.sh SRR18694442 current disk space = 1525911666688 free memory = 1599183612 SRR18694442 SRAfilesize 50182ce60ebd554b810ec72f4652b2c3 SRR18694442.sra SRR18694442.sra file validated SRR18694442 is paired end SRR18694442 is conventional basespace SRR18694442 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694442_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.122 37.0 37.0 37.0 37.0 37.0 2 35.90075 37.0 37.0 37.0 37.0 37.0 3 36.5165 37.0 37.0 37.0 37.0 37.0 4 36.5 37.0 37.0 37.0 37.0 37.0 5 36.492 37.0 37.0 37.0 37.0 37.0 6 36.5455 37.0 37.0 37.0 37.0 37.0 7 36.53 37.0 37.0 37.0 37.0 37.0 8 36.6495 37.0 37.0 37.0 37.0 37.0 9 36.6235 37.0 37.0 37.0 37.0 37.0 10-14 36.6103 37.0 37.0 37.0 37.0 37.0 15-19 36.589200000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.63940000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.53830000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.50939999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.6687 37.0 37.0 37.0 37.0 37.0 40-44 36.592 37.0 37.0 37.0 37.0 37.0 45-49 36.4443 37.0 37.0 37.0 37.0 37.0 50-54 36.5296 37.0 37.0 37.0 37.0 37.0 55-59 36.522400000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.5092 37.0 37.0 37.0 37.0 37.0 65-69 36.3333 37.0 37.0 37.0 37.0 37.0 70-74 36.4345 37.0 37.0 37.0 37.0 37.0 75-79 36.5039 37.0 37.0 37.0 37.0 37.0 80-84 36.4015 37.0 37.0 37.0 37.0 37.0 85-89 36.1583 37.0 37.0 37.0 37.0 37.0 90-94 35.4296 37.0 37.0 37.0 29.8 37.0 95-99 36.1894 37.0 37.0 37.0 37.0 37.0 100-104 36.1449 37.0 37.0 37.0 37.0 37.0 105-109 36.0817 37.0 37.0 37.0 37.0 37.0 110-114 36.1888 37.0 37.0 37.0 37.0 37.0 115-119 36.503299999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.5573 37.0 37.0 37.0 37.0 37.0 125-129 36.512 37.0 37.0 37.0 37.0 37.0 130-134 36.4879 37.0 37.0 37.0 37.0 37.0 135-139 36.451899999999995 37.0 37.0 37.0 37.0 37.0 140-144 36.2356 37.0 37.0 37.0 37.0 37.0 145-149 36.208600000000004 37.0 37.0 37.0 37.0 37.0 150-151 33.67975 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 2.0 27 1.0 28 2.0 29 8.0 30 8.0 31 10.0 32 29.0 33 58.0 34 112.0 35 353.0 36 3221.0 37 194.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.699999999999996 9.125 5.4 36.775000000000006 2 21.247171234598945 10.409856675886346 35.705305506663315 32.637666582851395 3 20.175 13.875000000000002 25.6 40.35 4 26.275 20.775 21.75 31.2 5 26.025 27.0 23.599999999999998 23.375 6 22.55 31.65 22.6 23.200000000000003 7 17.675 24.75 38.550000000000004 19.025 8 18.575 24.375 30.75 26.3 9 18.525 21.4 34.25 25.825 10-14 22.689999999999998 27.425 26.22 23.665 15-19 22.900000000000002 25.365 26.115 25.619999999999997 20-24 22.865 25.855 25.905 25.374999999999996 25-29 23.345 25.905 25.685000000000002 25.064999999999998 30-34 23.630000000000003 25.509999999999998 25.64 25.22 35-39 23.14 25.590000000000003 25.155 26.115 40-44 22.939999999999998 25.575 26.025 25.46 45-49 22.805 25.624999999999996 25.840000000000003 25.729999999999997 50-54 23.415 26.145000000000003 25.314999999999998 25.124999999999996 55-59 23.325000000000003 25.840000000000003 25.39 25.445 60-64 23.035 25.86 25.374999999999996 25.729999999999997 65-69 22.720000000000002 26.095000000000002 25.555 25.629999999999995 70-74 22.81 26.005 25.674999999999997 25.509999999999998 75-79 23.09 26.240000000000002 24.985 25.685000000000002 80-84 23.325000000000003 25.575 25.685000000000002 25.415 85-89 24.14 25.4 24.97 25.490000000000002 90-94 23.755000000000003 24.955 25.415 25.874999999999996 95-99 23.330000000000002 25.290000000000003 25.619999999999997 25.759999999999998 100-104 23.875 25.064999999999998 25.495 25.564999999999998 105-109 23.595 26.105 24.69 25.61 110-114 23.47 25.2 25.835 25.495 115-119 23.79 24.79 25.855 25.564999999999998 120-124 23.580000000000002 25.619999999999997 25.445 25.355 125-129 23.875 25.095 24.85 26.179999999999996 130-134 23.400000000000002 25.715 25.264999999999997 25.619999999999997 135-139 24.0 25.105 25.009999999999998 25.885 140-144 23.84 25.83 24.795 25.535000000000004 145-149 24.07 25.674999999999997 24.529999999999998 25.724999999999998 150-151 23.7 25.45 25.4625 25.387500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 1.0 27 1.0 28 2.5 29 3.5 30 7.5 31 13.0 32 16.5 33 25.0 34 28.0 35 27.0 36 49.0 37 59.5 38 75.5 39 96.0 40 111.0 41 148.5 42 171.5 43 190.0 44 215.5 45 208.0 46 197.5 47 206.0 48 189.0 49 164.0 50 163.0 51 163.0 52 152.5 53 145.5 54 144.5 55 120.0 56 94.0 57 84.0 58 71.5 59 78.5 60 76.0 61 58.5 62 50.5 63 50.0 64 45.0 65 45.5 66 48.5 67 42.0 68 37.0 69 31.5 70 24.5 71 18.0 72 14.5 73 10.5 74 6.0 75 6.0 76 6.0 77 2.5 78 0.0 79 1.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.375 #Duplication Level Percentage of deduplicated Percentage of total 1 88.995756718529 78.64999999999999 2 9.391796322489391 16.6 3 1.3578500707213579 3.5999999999999996 4 0.14144271570014144 0.5 5 0.028288543140028287 0.125 6 0.056577086280056574 0.3 7 0.0 0.0 8 0.0 0.0 9 0.028288543140028287 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCTTTCAGAGCATTTCCTGAGATTTGCGAACAAGGCGCCTAACCTTTT 9 0.22499999999999998 No Hit GTCCACATATGGAAGAACCTTCTCTTGTGCATCACGGAAAAACTCACAGA 6 0.15 No Hit GTAAGCTGTAGCTGAAAATTAAGGTTCGCATATAACAACATACCTCAGGT 6 0.15 No Hit GTGGCGGCGGCCCAGTCTCGACGGTCCGGGTCGCAGGGCGGCCCGCCGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 0.9750000000000001 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.9125 0.0 0.0 0.0 0.0 114-115 2.1375 0.0 0.0 0.0 0.0 116-117 2.3625 0.0 0.0 0.0 0.0 118-119 2.625 0.0 0.0 0.0 0.0 120-121 2.9124999999999996 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.6125 0.0 0.0 0.0 0.0 126-127 3.8875 0.0 0.0 0.0 0.0 128-129 4.3125 0.0 0.0 0.0 0.0 130-131 4.7875 0.0 0.0 0.0 0.0 132-133 5.324999999999999 0.0 0.0 0.0 0.0 134-135 5.7125 0.0 0.0 0.0 0.0 136-137 6.2875 0.0 0.0 0.0 0.0 138-139 6.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCGCA 10 0.006830828 145.0 1 >>END_MODULE SRR18694442 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694442_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.5125 37.0 37.0 37.0 25.0 37.0 2 34.4815 37.0 37.0 37.0 25.0 37.0 3 34.631 37.0 37.0 37.0 25.0 37.0 4 34.752 37.0 37.0 37.0 25.0 37.0 5 34.7675 37.0 37.0 37.0 25.0 37.0 6 34.9125 37.0 37.0 37.0 25.0 37.0 7 34.6985 37.0 37.0 37.0 25.0 37.0 8 35.138 37.0 37.0 37.0 25.0 37.0 9 35.043 37.0 37.0 37.0 25.0 37.0 10-14 35.0655 37.0 37.0 37.0 25.0 37.0 15-19 35.283699999999996 37.0 37.0 37.0 27.4 37.0 20-24 35.000299999999996 37.0 37.0 37.0 25.0 37.0 25-29 35.1177 37.0 37.0 37.0 29.8 37.0 30-34 35.4491 37.0 37.0 37.0 32.2 37.0 35-39 35.28410000000001 37.0 37.0 37.0 29.8 37.0 40-44 34.9307 37.0 37.0 37.0 27.4 37.0 45-49 35.1548 37.0 37.0 37.0 27.4 37.0 50-54 34.5405 37.0 37.0 37.0 27.0 37.0 55-59 34.099000000000004 37.0 37.0 37.0 25.0 37.0 60-64 34.7946 37.0 37.0 37.0 27.4 37.0 65-69 33.888 37.0 34.6 37.0 24.6 37.0 70-74 32.7585 37.0 29.8 37.0 22.2 37.0 75-79 33.2977 37.0 34.6 37.0 22.2 37.0 80-84 34.2539 37.0 37.0 37.0 25.0 37.0 85-89 32.3266 37.0 32.2 37.0 19.4 37.0 90-94 33.7502 37.0 37.0 37.0 25.0 37.0 95-99 33.7124 37.0 37.0 37.0 25.0 37.0 100-104 33.3232 37.0 34.6 37.0 25.0 37.0 105-109 33.9014 37.0 37.0 37.0 25.0 37.0 110-114 34.2451 37.0 37.0 37.0 25.0 37.0 115-119 34.23909999999999 37.0 37.0 37.0 25.0 37.0 120-124 33.654399999999995 37.0 37.0 37.0 25.0 37.0 125-129 33.6668 37.0 37.0 37.0 25.0 37.0 130-134 33.2851 37.0 34.6 37.0 22.2 37.0 135-139 31.7445 37.0 25.0 37.0 13.8 37.0 140-144 31.140800000000002 37.0 25.0 37.0 11.0 37.0 145-149 30.790100000000002 37.0 25.0 37.0 11.0 37.0 150-151 30.46275 37.0 25.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 5.0 17 0.0 18 5.0 19 3.0 20 5.0 21 5.0 22 6.0 23 7.0 24 8.0 25 8.0 26 16.0 27 24.0 28 31.0 29 60.0 30 114.0 31 206.0 32 339.0 33 654.0 34 1210.0 35 1148.0 36 144.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.9 19.975 7.9 29.225 2 29.725 22.400000000000002 27.05 20.825 3 23.05 26.075 28.575 22.3 4 27.400000000000002 31.1 20.075000000000003 21.425 5 28.625 33.825 19.175 18.375 6 23.849999999999998 35.875 18.099999999999998 22.175 7 23.674999999999997 19.275000000000002 34.075 22.975 8 22.75 24.5 24.175 28.575 9 23.65 21.575 28.000000000000004 26.775 10-14 25.865 26.919999999999998 23.25 23.965 15-19 25.935000000000002 24.585 25.2 24.279999999999998 20-24 25.869999999999997 24.895 24.69 24.545 25-29 27.305 24.834999999999997 24.075 23.785 30-34 26.325 24.755 25.130000000000003 23.79 35-39 26.365 24.895 24.54 24.2 40-44 25.619999999999997 24.555 24.95 24.875 45-49 26.545 25.275 24.759999999999998 23.419999999999998 50-54 24.675 25.615 26.009999999999998 23.7 55-59 24.98 25.874999999999996 24.46 24.685000000000002 60-64 26.224999999999998 25.255 24.745 23.775 65-69 27.025 25.380000000000003 24.169999999999998 23.425 70-74 27.105 24.265 24.585 24.044999999999998 75-79 27.905 24.065 24.685000000000002 23.345 80-84 26.529999999999998 26.035000000000004 24.515 22.919999999999998 85-89 23.705000000000002 28.439999999999998 24.02 23.835 90-94 25.645 25.495 25.105 23.755000000000003 95-99 25.2 25.979999999999997 24.745 24.075 100-104 26.415 25.255 25.185000000000002 23.145 105-109 26.505000000000003 25.785000000000004 24.145 23.565 110-114 26.145000000000003 26.355 23.945 23.555 115-119 25.679999999999996 25.75 24.63 23.94 120-124 26.26 25.080000000000002 25.685000000000002 22.975 125-129 26.195 25.685000000000002 25.009999999999998 23.11 130-134 26.75 25.485000000000003 25.324999999999996 22.439999999999998 135-139 26.369999999999997 25.885 24.64 23.105 140-144 27.18 25.490000000000002 24.775 22.555 145-149 27.26 26.115 24.025 22.6 150-151 25.174999999999997 24.85 27.700000000000003 22.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 0.5 24 0.0 25 0.0 26 0.5 27 1.5 28 2.5 29 2.5 30 4.5 31 9.5 32 13.5 33 17.0 34 20.5 35 29.5 36 44.5 37 57.0 38 69.0 39 88.5 40 121.5 41 143.0 42 149.5 43 175.0 44 194.5 45 194.5 46 191.0 47 192.5 48 183.0 49 170.0 50 165.5 51 154.5 52 146.5 53 129.0 54 119.0 55 110.0 56 89.0 57 90.5 58 89.0 59 82.0 60 78.5 61 66.0 62 68.5 63 72.5 64 71.5 65 70.5 66 63.0 67 54.0 68 46.0 69 36.5 70 28.5 71 28.5 72 22.0 73 11.5 74 6.5 75 4.5 76 4.0 77 3.0 78 2.0 79 0.5 80 0.0 81 1.5 82 1.5 83 0.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 1.0 99 1.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.625 #Duplication Level Percentage of deduplicated Percentage of total 1 90.3486750348675 80.975 2 8.284518828451883 14.85 3 1.1157601115760112 3.0 4 0.08368200836820083 0.3 5 0.05578800557880056 0.25 6 0.08368200836820083 0.44999999999999996 7 0.02789400278940028 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGGCCCGCCCGAAACCTTATATGATGGGGGATACTTCAACGCAATAATGA 7 0.17500000000000002 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GCAAAATACATCTACATTGCTGGATTTTTCCTTACGGTCTCCCCTGATTC 6 0.15 No Hit CACGGACCTGCCGGTGCAGCCTCAGCACACGCTCATCTGCTACTGGAAGG 5 0.125 No Hit ACTTTACTGAAAAATATTGATGGTTCCTTGGATTCTAGTTCGTCAACTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0499999999999998 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.325 0.0 0.0 0.0 0.0 110-111 1.5499999999999998 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.1125 0.0 0.0 0.0 0.0 116-117 2.3125 0.0 0.0 0.0 0.0 118-119 2.575 0.0 0.0 0.0 0.0 120-121 2.8625 0.0 0.0 0.0 0.0 122-123 3.175 0.0 0.0 0.0 0.0 124-125 3.5375 0.0 0.0 0.0 0.0 126-127 3.8125 0.0 0.0 0.0 0.0 128-129 4.237500000000001 0.0 0.0 0.0 0.0 130-131 4.725 0.0 0.0 0.0 0.0 132-133 5.25 0.0 0.0 0.0 0.0 134-135 5.6125 0.0 0.0 0.0 0.0 136-137 6.1875 0.0 0.0 0.0 0.0 138-139 6.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATTAT 10 0.006830828 145.0 5 TTTTTTT 40 0.0076550315 18.125 120-124 >>END_MODULE Read 670723 spots for SRR18694442.sra Written 670723 spots for SRR18694442.sra Read 670723 spots for SRR18694442.sra Written 670723 spots for SRR18694442.sra Read 670723 spots for SRR18694442.sra Written 670723 spots for SRR18694442.sra Read 670723 spots for SRR18694442.sra Written 670723 spots for SRR18694442.sra Read 670723 spots for SRR18694442.sra Written 670723 spots for SRR18694442.sra Read 670723 spots for SRR18694442.sra Written 670723 spots for SRR18694442.sra Read 670723 spots for SRR18694442.sra Written 670723 spots for SRR18694442.sra Read 670723 spots for SRR18694442.sra Written 670723 spots for SRR18694442.sra Read 670723 spots for SRR18694442.sra Written 670723 spots for SRR18694442.sra Read 670723 spots for SRR18694442.sra Written 670723 spots for SRR18694442.sra Read 670723 spots for SRR18694442.sra Written 670723 spots for SRR18694442.sra Read 670723 spots for SRR18694442.sra Written 670723 spots for SRR18694442.sra Read 670723 spots for SRR18694442.sra Written 670723 spots for SRR18694442.sra Read 670723 spots for SRR18694442.sra Written 670723 spots for SRR18694442.sra Read 670723 spots for SRR18694442.sra Written 670723 spots for SRR18694442.sra Read 670723 spots for SRR18694442.sra Written 670723 spots for SRR18694442.sra Read 670723 spots for SRR18694442.sra Written 670723 spots for SRR18694442.sra Read 670723 spots for SRR18694442.sra Written 670723 spots for SRR18694442.sra Read 670723 spots for SRR18694442.sra Written 670723 spots for SRR18694442.sra Read 670734 spots for SRR18694442.sra Written 670734 spots for SRR18694442.sra SRR ids: ['SRR18694442.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_44uyryzo SRR18694442.sra spots: 13414471 blocks: [[1, 670723], [670724, 1341446], [1341447, 2012169], [2012170, 2682892], [2682893, 3353615], [3353616, 4024338], [4024339, 4695061], [4695062, 5365784], [5365785, 6036507], [6036508, 6707230], [6707231, 7377953], [7377954, 8048676], [8048677, 8719399], [8719400, 9390122], [9390123, 10060845], [10060846, 10731568], [10731569, 11402291], [11402292, 12073014], [12073015, 12743737], [12743738, 13414471]] SRR18694442 file size 4537123 SRR18694442 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694442 SRR18694442_1.fastq SRR18694442_2.fastq Input file: SRR18694442_1.fastq Paired file: SRR18694442_2.fastq trimmed: SRR18694442-trimmed-pair1.fastq, SRR18694442-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:52:55 2024 >> started Tue Dec 10 06:53:11 2024 >> done (15.499s) 13414471 read pairs processed; of these: 121 ( 0.00%) short read pairs filtered out after trimming by size control 4273 ( 0.03%) empty read pairs filtered out after trimming by size control 13410077 (99.97%) read pairs available; of these: 1312635 ( 9.79%) trimmed read pairs available after processing 12097442 (90.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 10 0.00% 20 14 0.00% 21 11 0.00% 22 12 0.00% 23 23 0.00% 24 17 0.00% 25 21 0.00% 26 13 0.00% 27 23 0.00% 28 21 0.00% 29 23 0.00% 30 34 0.00% 31 32 0.00% 32 36 0.00% 33 32 0.00% 34 32 0.00% 35 36 0.00% 36 29 0.00% 37 32 0.00% 38 51 0.00% 39 38 0.00% 40 33 0.00% 41 47 0.00% 42 37 0.00% 43 46 0.00% 44 46 0.00% 45 61 0.00% 46 62 0.00% 47 55 0.00% 48 64 0.00% 49 70 0.00% 50 64 0.00% 51 68 0.00% 52 84 0.00% 53 106 0.00% 54 97 0.00% 55 88 0.00% 56 115 0.00% 57 141 0.00% 58 142 0.00% 59 168 0.00% 60 177 0.00% 61 196 0.00% 62 205 0.00% 63 260 0.00% 64 219 0.00% 65 284 0.00% 66 350 0.00% 67 339 0.00% 68 400 0.00% 69 455 0.00% 70 473 0.00% 71 560 0.00% 72 647 0.00% 73 790 0.01% 74 811 0.01% 75 955 0.01% 76 1059 0.01% 77 1048 0.01% 78 1262 0.01% 79 1419 0.01% 80 1604 0.01% 81 1758 0.01% 82 2072 0.02% 83 2227 0.02% 84 2507 0.02% 85 2887 0.02% 86 2950 0.02% 87 3240 0.02% 88 3490 0.03% 89 3620 0.03% 90 3961 0.03% 91 4321 0.03% 92 4662 0.03% 93 4955 0.04% 94 5675 0.04% 95 5861 0.04% 96 6307 0.05% 97 6738 0.05% 98 7057 0.05% 99 7388 0.06% 100 7897 0.06% 101 8337 0.06% 102 8961 0.07% 103 9436 0.07% 104 9763 0.07% 105 10407 0.08% 106 10926 0.08% 107 11345 0.08% 108 11933 0.09% 109 12329 0.09% 110 12937 0.10% 111 13594 0.10% 112 14155 0.11% 113 14614 0.11% 114 15614 0.12% 115 16341 0.12% 116 16921 0.13% 117 17763 0.13% 118 17747 0.13% 119 18520 0.14% 120 19403 0.14% 121 19619 0.15% 122 20725 0.15% 123 21732 0.16% 124 22496 0.17% 125 22680 0.17% 126 24024 0.18% 127 24678 0.18% 128 25217 0.19% 129 25961 0.19% 130 26421 0.20% 131 27162 0.20% 132 28297 0.21% 133 29491 0.22% 134 29736 0.22% 135 30476 0.23% 136 31517 0.24% 137 32044 0.24% 138 32825 0.24% 139 34034 0.25% 140 34235 0.26% 141 35077 0.26% 142 37397 0.28% 143 37157 0.28% 144 37460 0.28% 145 38777 0.29% 146 39682 0.30% 147 41063 0.31% 148 41810 0.31% 149 41938 0.31% 150 42630 0.32% 151 12097442 90.21% 13410077 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=36 prefix-density=0.22 prefix-fanout=2.3 sequence=GCCAAAGATGTATA criterion=fanout-score sequence-density=0.07 sequence-density-rank=16 fanout-score=153.74 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=26.0 sequence=ATCTTCTTCTTG criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=30 prefix-density=0.56 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=1167.16 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=20.8 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR18694442 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:54:00 Started mapping on | Dec 10 06:54:00 Finished on | Dec 10 06:55:52 Mapping speed, Million of reads per hour | 431.04 Number of input reads | 13410077 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12378073 Uniquely mapped reads % | 92.30% Average mapped length | 295.89 Number of splices: Total | 13287296 Number of splices: Annotated (sjdb) | 12498447 Number of splices: GT/AG | 13114023 Number of splices: GC/AG | 144496 Number of splices: AT/AC | 8510 Number of splices: Non-canonical | 20267 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.01% Deletion average length | 2.64 Insertion rate per base | 0.01% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 161871 % of reads mapped to multiple loci | 1.21% Number of reads mapped to too many loci | 29354 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.30% % of reads unmapped: other | 1.97% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 870133 870133 870133 N_multimapping 161871 161871 161871 N_noFeature 525062 12085012 621245 N_ambiguous 229604 1551 33555 UnstrandedReadsAssigned:11623407 PositiveStrandReadsAssigned:291510 NegativeStrandReadsAssigned:11723273 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694442 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694442-trimmed-pair1.fastq SRR18694442-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,410,077 reads, 11,942,389 reads pseudoaligned [quant] estimated average fragment length: 260.397 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52973 SRR18694442.ke.tsv 35125 SRR18694442.se.tsv 88098 total ==> SRR18694442.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 677.036 0 0 PNS24247 1044 784.603 39.3978 6.45503 PNS24249 1928 1668.6 62.3563 4.80401 PNS24246 1044 784.603 39.3978 6.45503 PNS24248 1044 784.603 39.3978 6.45503 PNS24244 1471 1211.6 91.4504 9.70291 PNS24243 293 93.6346 1 1.3729 KQK14069 1603 1343.6 1014.18 97.0337 KQK14071 474 235.961 20.8575 11.3631 ==> SRR18694442.se.tsv <== BRADI_1g14170v3 1120 BRADI_1g53295v3 38 BRADI_1g59795v3 311 BRADI_1g07683v3 0 BRADI_1g00485v3 21 BRADI_1g20270v3 536 BRADI_1g74790v3 74 BRADI_1g09890v3 0 BRADI_1g77505v3 94 BRADI_1g48960v3 0 SRR18694442 completed mapping pipeline successfully