Starting /dee2/code/volunteer_pipeline.sh SRR18694444 current disk space = 1525933195264 free memory = 1554828096 SRR18694444 SRAfilesize e7bbd07a0016360f2609776db71ccb37 SRR18694444.sra SRR18694444.sra file validated SRR18694444 is paired end SRR18694444 is conventional basespace SRR18694444 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694444_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.04 37.0 37.0 37.0 37.0 37.0 2 35.93725 37.0 37.0 37.0 37.0 37.0 3 36.345 37.0 37.0 37.0 37.0 37.0 4 36.4685 37.0 37.0 37.0 37.0 37.0 5 36.528 37.0 37.0 37.0 37.0 37.0 6 36.5905 37.0 37.0 37.0 37.0 37.0 7 36.49 37.0 37.0 37.0 37.0 37.0 8 36.5805 37.0 37.0 37.0 37.0 37.0 9 36.624 37.0 37.0 37.0 37.0 37.0 10-14 36.6265 37.0 37.0 37.0 37.0 37.0 15-19 36.587799999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.6077 37.0 37.0 37.0 37.0 37.0 25-29 36.5631 37.0 37.0 37.0 37.0 37.0 30-34 36.541700000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.6684 37.0 37.0 37.0 37.0 37.0 40-44 36.593900000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.4556 37.0 37.0 37.0 37.0 37.0 50-54 36.536 37.0 37.0 37.0 37.0 37.0 55-59 36.5428 37.0 37.0 37.0 37.0 37.0 60-64 36.5228 37.0 37.0 37.0 37.0 37.0 65-69 36.32040000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.4591 37.0 37.0 37.0 37.0 37.0 75-79 36.5395 37.0 37.0 37.0 37.0 37.0 80-84 36.4263 37.0 37.0 37.0 37.0 37.0 85-89 36.1765 37.0 37.0 37.0 37.0 37.0 90-94 35.372499999999995 37.0 37.0 37.0 29.8 37.0 95-99 36.094300000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.1197 37.0 37.0 37.0 37.0 37.0 105-109 36.1469 37.0 37.0 37.0 37.0 37.0 110-114 36.2043 37.0 37.0 37.0 37.0 37.0 115-119 36.4621 37.0 37.0 37.0 37.0 37.0 120-124 36.5731 37.0 37.0 37.0 37.0 37.0 125-129 36.5305 37.0 37.0 37.0 37.0 37.0 130-134 36.5101 37.0 37.0 37.0 37.0 37.0 135-139 36.39640000000001 37.0 37.0 37.0 37.0 37.0 140-144 36.2471 37.0 37.0 37.0 37.0 37.0 145-149 36.228899999999996 37.0 37.0 37.0 37.0 37.0 150-151 33.69975 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 1.0 27 2.0 28 6.0 29 4.0 30 6.0 31 12.0 32 24.0 33 55.0 34 132.0 35 360.0 36 3190.0 37 207.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.425000000000004 10.125 5.375 36.075 2 22.342297059562704 10.404624277456648 35.63709474742397 31.615983915556672 3 19.125 14.399999999999999 26.1 40.375 4 24.5 21.425 22.400000000000002 31.674999999999997 5 27.3 26.575 22.5 23.625 6 24.3 30.625000000000004 22.2 22.875 7 17.2 25.424999999999997 37.925 19.45 8 20.3 25.45 30.125 24.125 9 20.125 22.0 34.0 23.875 10-14 22.545 27.175 26.11 24.169999999999998 15-19 22.689999999999998 25.455 26.935 24.92 20-24 22.655 26.395000000000003 25.869999999999997 25.080000000000002 25-29 23.200000000000003 26.155 26.169999999999998 24.474999999999998 30-34 22.53 26.005 26.0 25.465 35-39 23.195 25.169999999999998 26.145000000000003 25.490000000000002 40-44 22.56 26.41 26.064999999999998 24.965 45-49 22.435 25.31 26.945000000000004 25.31 50-54 23.075000000000003 25.6 25.729999999999997 25.595000000000002 55-59 23.080000000000002 25.66 25.495 25.765 60-64 23.115 26.205000000000002 25.674999999999997 25.005 65-69 23.015 25.775 26.205000000000002 25.005 70-74 23.189999999999998 25.580000000000002 25.47 25.759999999999998 75-79 23.11 25.545 25.885 25.46 80-84 22.78 25.729999999999997 25.779999999999998 25.71 85-89 23.205000000000002 25.740000000000002 25.335 25.72 90-94 23.45 25.590000000000003 26.040000000000003 24.92 95-99 23.29 25.919999999999998 25.305 25.485000000000003 100-104 23.525 25.955000000000002 25.009999999999998 25.509999999999998 105-109 23.505000000000003 25.44 25.83 25.224999999999998 110-114 23.849999999999998 25.105 25.405 25.64 115-119 23.56 26.279999999999998 24.255 25.905 120-124 23.125 26.35 25.130000000000003 25.395 125-129 23.419999999999998 25.985000000000003 25.055 25.540000000000003 130-134 22.935 25.990000000000002 25.355 25.72 135-139 23.57 25.929999999999996 25.21 25.290000000000003 140-144 23.28 25.35 25.825 25.545 145-149 23.535 25.669999999999998 25.174999999999997 25.619999999999997 150-151 23.5625 25.5 25.0 25.937500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 1.5 25 0.5 26 1.0 27 3.5 28 5.5 29 8.0 30 14.5 31 18.0 32 19.0 33 22.0 34 31.0 35 46.0 36 56.5 37 66.0 38 79.0 39 92.5 40 124.0 41 147.5 42 163.0 43 183.5 44 211.0 45 230.5 46 232.0 47 208.5 48 187.5 49 177.0 50 151.0 51 138.5 52 128.0 53 121.5 54 105.5 55 94.0 56 101.0 57 94.5 58 76.5 59 67.5 60 71.0 61 69.5 62 65.0 63 61.5 64 48.5 65 41.5 66 40.5 67 45.0 68 42.0 69 31.5 70 28.0 71 17.0 72 9.5 73 8.0 74 4.0 75 3.0 76 3.0 77 2.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.525 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 86.60454280722189 74.35000000000001 2 11.269656377402445 19.35 3 1.6307513104251603 4.2 4 0.29120559114735 1.0 5 0.11648223645894001 0.5 6 0.0 0.0 7 0.05824111822947001 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.029120559114735003 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCAGTAGTAGTGTGGAAACTATTTATCAACATGGCTGTGGCAGTTCCA 10 0.25 No Hit CTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCAC 7 0.17500000000000002 No Hit ATTGCCTGAGTATTTGATGGTACCTCGAACTCCCTTTCGCCTATCCCCTT 7 0.17500000000000002 No Hit GACCTTGCGAGCATTCTACCGAGTAACACCACACCGCTCATTGTCAGTGA 5 0.125 No Hit GCCATGAACAACTCTGTTTTCCTCTTGTGAAGAGAAGCAACAAACTCCTT 5 0.125 No Hit CCATAACCACCACCACCACGGAAGCCACTAGTCCGCTCATTGGCTTCACT 5 0.125 No Hit TGTGGATATACCATATGTATAAGCCCATAAACAATCCAGCACATATTGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.2000000000000002 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.3499999999999996 0.0 0.0 0.0 0.0 124-125 2.5 0.0 0.0 0.0 0.0 126-127 2.825 0.0 0.0 0.0 0.0 128-129 3.0625 0.0 0.0 0.0 0.0 130-131 3.2125000000000004 0.0 0.0 0.0 0.0 132-133 3.5875 0.0 0.0 0.0 0.0 134-135 4.125 0.0 0.0 0.0 0.0 136-137 4.525 0.0 0.0 0.0 0.0 138-139 4.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCACA 10 0.006830828 145.0 6 CAATAAC 10 0.006830828 145.0 7 GTCTATC 10 0.006830828 145.0 1 ATCAATA 10 0.006830828 145.0 5 >>END_MODULE SRR18694444 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694444_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.8575 37.0 37.0 37.0 25.0 37.0 2 34.6935 37.0 37.0 37.0 25.0 37.0 3 34.878 37.0 37.0 37.0 25.0 37.0 4 34.8965 37.0 37.0 37.0 25.0 37.0 5 34.865 37.0 37.0 37.0 25.0 37.0 6 34.8975 37.0 37.0 37.0 25.0 37.0 7 35.1705 37.0 37.0 37.0 25.0 37.0 8 35.432 37.0 37.0 37.0 37.0 37.0 9 35.396 37.0 37.0 37.0 37.0 37.0 10-14 35.4015 37.0 37.0 37.0 32.2 37.0 15-19 35.4424 37.0 37.0 37.0 34.6 37.0 20-24 35.2159 37.0 37.0 37.0 27.4 37.0 25-29 35.4316 37.0 37.0 37.0 29.8 37.0 30-34 35.6273 37.0 37.0 37.0 34.6 37.0 35-39 35.528999999999996 37.0 37.0 37.0 34.6 37.0 40-44 35.162400000000005 37.0 37.0 37.0 29.8 37.0 45-49 35.3394 37.0 37.0 37.0 27.4 37.0 50-54 34.8086 37.0 37.0 37.0 27.0 37.0 55-59 34.3031 37.0 37.0 37.0 25.0 37.0 60-64 34.9813 37.0 37.0 37.0 27.4 37.0 65-69 34.1634 37.0 34.6 37.0 27.4 37.0 70-74 32.9408 37.0 29.8 37.0 19.4 37.0 75-79 33.5162 37.0 34.6 37.0 22.2 37.0 80-84 34.4735 37.0 37.0 37.0 25.0 37.0 85-89 32.5575 37.0 32.2 37.0 19.4 37.0 90-94 33.9747 37.0 37.0 37.0 25.0 37.0 95-99 33.869899999999994 37.0 37.0 37.0 25.0 37.0 100-104 33.5405 37.0 37.0 37.0 25.0 37.0 105-109 34.1707 37.0 37.0 37.0 25.0 37.0 110-114 34.4905 37.0 37.0 37.0 25.0 37.0 115-119 34.36 37.0 37.0 37.0 25.0 37.0 120-124 33.996900000000004 37.0 37.0 37.0 25.0 37.0 125-129 33.8792 37.0 37.0 37.0 25.0 37.0 130-134 33.6625 37.0 34.6 37.0 25.0 37.0 135-139 32.0561 37.0 25.0 37.0 13.8 37.0 140-144 31.6318 37.0 25.0 37.0 11.0 37.0 145-149 31.1775 37.0 25.0 37.0 11.0 37.0 150-151 30.87175 37.0 25.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 0.0 18 2.0 19 3.0 20 9.0 21 8.0 22 5.0 23 4.0 24 8.0 25 12.0 26 10.0 27 13.0 28 24.0 29 42.0 30 79.0 31 156.0 32 301.0 33 632.0 34 1140.0 35 1366.0 36 184.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.699999999999996 23.175 7.825 28.299999999999997 2 30.75 23.474999999999998 27.125 18.65 3 23.025000000000002 24.625 29.675 22.675 4 26.924999999999997 29.4 21.7 21.975 5 28.725 32.800000000000004 20.225 18.25 6 23.375 34.525 19.775000000000002 22.325 7 22.95 20.4 34.925 21.725 8 22.575 23.599999999999998 25.074999999999996 28.749999999999996 9 24.349999999999998 22.1 27.925 25.624999999999996 10-14 25.724999999999998 26.290000000000003 23.93 24.055 15-19 25.345000000000002 25.430000000000003 25.135 24.09 20-24 25.55 25.36 24.365000000000002 24.725 25-29 25.955000000000002 24.86 25.119999999999997 24.065 30-34 25.535000000000004 25.25 24.959999999999997 24.255 35-39 26.235000000000003 24.43 24.945 24.39 40-44 25.650000000000002 25.495 25.014999999999997 23.84 45-49 25.275 25.525 24.88 24.32 50-54 25.019999999999996 25.2 26.08 23.7 55-59 25.155 26.27 24.855 23.72 60-64 25.845000000000002 25.019999999999996 25.41 23.724999999999998 65-69 26.479999999999997 24.834999999999997 25.380000000000003 23.305 70-74 26.515 24.75 24.745 23.990000000000002 75-79 26.665 23.330000000000002 25.729999999999997 24.275 80-84 25.424999999999997 25.019999999999996 25.535000000000004 24.02 85-89 23.155 28.199999999999996 25.230000000000004 23.415 90-94 25.655 25.8 24.715 23.830000000000002 95-99 25.330000000000002 25.919999999999998 24.955 23.794999999999998 100-104 25.990000000000002 24.95 24.779999999999998 24.279999999999998 105-109 26.0 25.05 25.53 23.419999999999998 110-114 26.13 25.895000000000003 24.64 23.335 115-119 26.145000000000003 25.97 24.705 23.18 120-124 25.130000000000003 25.605 25.355 23.91 125-129 26.040000000000003 25.419999999999998 25.025 23.515 130-134 25.97 25.31 25.77 22.95 135-139 26.245 25.779999999999998 25.155 22.82 140-144 26.474999999999998 26.68 24.404999999999998 22.439999999999998 145-149 25.965 26.105 25.095 22.835 150-151 24.45 25.8625 27.8875 21.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.0 22 0.5 23 1.5 24 1.5 25 1.0 26 1.5 27 6.0 28 8.5 29 9.0 30 14.0 31 13.5 32 10.5 33 20.5 34 36.5 35 41.0 36 44.5 37 62.5 38 85.0 39 101.0 40 116.5 41 133.5 42 164.5 43 178.0 44 172.5 45 193.5 46 204.0 47 176.0 48 171.0 49 163.0 50 135.0 51 140.0 52 133.0 53 116.0 54 103.5 55 97.0 56 99.0 57 93.5 58 101.0 59 98.5 60 88.0 61 89.0 62 84.5 63 76.5 64 66.5 65 57.0 66 48.5 67 41.0 68 38.0 69 35.5 70 32.0 71 26.0 72 20.5 73 17.5 74 10.0 75 4.5 76 1.5 77 1.0 78 1.5 79 2.0 80 2.5 81 1.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 88.06525472238123 76.925 2 10.274756725815685 17.95 3 1.2020606754436176 3.15 4 0.28620492272467085 1.0 5 0.08586147681740126 0.375 6 0.0 0.0 7 0.028620492272467084 0.17500000000000002 8 0.028620492272467084 0.2 9 0.028620492272467084 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGGGCGGTGGATGTTAAAAATCCCTCACTGAGTTGGATGATCGGGTTCA 9 0.22499999999999998 No Hit GGTGGGTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGT 8 0.2 No Hit CGCAGAACCACCTCACCGTCGCTCATCGCTGACGCCGCCTTCGAGCAACA 7 0.17500000000000002 No Hit GAATTTGGCATGAGATTGGATTGCTTTTAGTCAGCCTCTTATAGCCTAAA 5 0.125 No Hit CTAGAGGTTTTGGCTTTATAACTTATGCGGCAGAGGATCAGGCAAAAGCT 5 0.125 No Hit AGAGCCTAGAAGCATAGTTAGTGGTACTTTGTACTGTATCGTGTTGGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.1749999999999998 0.0 0.0 0.0 0.0 112-113 1.2625000000000002 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.675 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.325 0.0 0.0 0.0 0.0 124-125 2.475 0.0 0.0 0.0 0.0 126-127 2.75 0.0 0.0 0.0 0.0 128-129 2.9749999999999996 0.0 0.0 0.0 0.0 130-131 3.1125 0.0 0.0 0.0 0.0 132-133 3.4875 0.0 0.0 0.0 0.0 134-135 4.025 0.0 0.0 0.0 0.0 136-137 4.4 0.0 0.0 0.0 0.0 138-139 4.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCGGTG 10 0.006830828 145.0 3 AAACCGG 10 0.006830828 145.0 1 GGTGAAA 10 0.006830828 145.0 6 AACCGGT 10 0.006830828 145.0 2 GAAATCA 10 0.006830828 145.0 9 GATCCAG 10 0.006830828 145.0 5 CTTGCTC 10 0.006830828 145.0 5 AGATCCA 10 0.006830828 145.0 4 TTGCTCT 10 0.006830828 145.0 6 >>END_MODULE Read 667442 spots for SRR18694444.sra Written 667442 spots for SRR18694444.sra Read 667442 spots for SRR18694444.sra Written 667442 spots for SRR18694444.sra Read 667442 spots for SRR18694444.sra Written 667442 spots for SRR18694444.sra Read 667442 spots for SRR18694444.sra Written 667442 spots for SRR18694444.sra Read 667442 spots for SRR18694444.sra Written 667442 spots for SRR18694444.sra Read 667442 spots for SRR18694444.sra Written 667442 spots for SRR18694444.sra Read 667442 spots for SRR18694444.sra Written 667442 spots for SRR18694444.sra Read 667442 spots for SRR18694444.sra Written 667442 spots for SRR18694444.sra Read 667442 spots for SRR18694444.sra Written 667442 spots for SRR18694444.sra Read 667442 spots for SRR18694444.sra Written 667442 spots for SRR18694444.sra Read 667442 spots for SRR18694444.sra Written 667442 spots for SRR18694444.sra Read 667442 spots for SRR18694444.sra Written 667442 spots for SRR18694444.sra Read 667442 spots for SRR18694444.sra Written 667442 spots for SRR18694444.sra Read 667442 spots for SRR18694444.sra Written 667442 spots for SRR18694444.sra Read 667442 spots for SRR18694444.sra Written 667442 spots for SRR18694444.sra Read 667442 spots for SRR18694444.sra Written 667442 spots for SRR18694444.sra Read 667442 spots for SRR18694444.sra Written 667442 spots for SRR18694444.sra Read 667442 spots for SRR18694444.sra Written 667442 spots for SRR18694444.sra Read 667456 spots for SRR18694444.sra Written 667456 spots for SRR18694444.sra Read 667442 spots for SRR18694444.sra Written 667442 spots for SRR18694444.sra SRR ids: ['SRR18694444.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oanbpafr SRR18694444.sra spots: 13348854 blocks: [[1, 667442], [667443, 1334884], [1334885, 2002326], [2002327, 2669768], [2669769, 3337210], [3337211, 4004652], [4004653, 4672094], [4672095, 5339536], [5339537, 6006978], [6006979, 6674420], [6674421, 7341862], [7341863, 8009304], [8009305, 8676746], [8676747, 9344188], [9344189, 10011630], [10011631, 10679072], [10679073, 11346514], [11346515, 12013956], [12013957, 12681398], [12681399, 13348854]] SRR18694444 file size 4514824 SRR18694444 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694444 SRR18694444_1.fastq SRR18694444_2.fastq Input file: SRR18694444_1.fastq Paired file: SRR18694444_2.fastq trimmed: SRR18694444-trimmed-pair1.fastq, SRR18694444-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 06:53:32 2024 >> started Tue Dec 10 06:53:47 2024 >> done (14.573s) 13348854 read pairs processed; of these: 129 ( 0.00%) short read pairs filtered out after trimming by size control 1162 ( 0.01%) empty read pairs filtered out after trimming by size control 13347563 (99.99%) read pairs available; of these: 1076517 ( 8.07%) trimmed read pairs available after processing 12271046 (91.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 10 0.00% 20 13 0.00% 21 11 0.00% 22 20 0.00% 23 17 0.00% 24 20 0.00% 25 17 0.00% 26 21 0.00% 27 20 0.00% 28 35 0.00% 29 30 0.00% 30 26 0.00% 31 30 0.00% 32 34 0.00% 33 38 0.00% 34 36 0.00% 35 52 0.00% 36 33 0.00% 37 34 0.00% 38 44 0.00% 39 33 0.00% 40 41 0.00% 41 27 0.00% 42 37 0.00% 43 52 0.00% 44 44 0.00% 45 36 0.00% 46 66 0.00% 47 53 0.00% 48 44 0.00% 49 59 0.00% 50 60 0.00% 51 71 0.00% 52 63 0.00% 53 85 0.00% 54 86 0.00% 55 85 0.00% 56 76 0.00% 57 112 0.00% 58 113 0.00% 59 117 0.00% 60 143 0.00% 61 171 0.00% 62 194 0.00% 63 210 0.00% 64 223 0.00% 65 223 0.00% 66 287 0.00% 67 284 0.00% 68 327 0.00% 69 371 0.00% 70 433 0.00% 71 534 0.00% 72 576 0.00% 73 604 0.00% 74 678 0.01% 75 746 0.01% 76 834 0.01% 77 949 0.01% 78 1043 0.01% 79 1223 0.01% 80 1297 0.01% 81 1404 0.01% 82 1677 0.01% 83 1775 0.01% 84 1888 0.01% 85 2031 0.02% 86 2312 0.02% 87 2435 0.02% 88 2622 0.02% 89 2991 0.02% 90 3092 0.02% 91 3360 0.03% 92 3552 0.03% 93 4012 0.03% 94 4400 0.03% 95 4695 0.04% 96 4848 0.04% 97 5105 0.04% 98 5378 0.04% 99 5932 0.04% 100 6214 0.05% 101 6588 0.05% 102 6833 0.05% 103 7277 0.05% 104 7346 0.06% 105 8039 0.06% 106 8409 0.06% 107 9023 0.07% 108 9242 0.07% 109 9562 0.07% 110 10068 0.08% 111 10568 0.08% 112 11142 0.08% 113 11633 0.09% 114 12246 0.09% 115 13085 0.10% 116 13487 0.10% 117 13619 0.10% 118 14290 0.11% 119 14610 0.11% 120 15496 0.12% 121 16142 0.12% 122 16468 0.12% 123 17292 0.13% 124 18467 0.14% 125 18819 0.14% 126 19360 0.15% 127 19948 0.15% 128 20537 0.15% 129 21180 0.16% 130 21816 0.16% 131 22257 0.17% 132 23694 0.18% 133 23955 0.18% 134 24689 0.18% 135 25415 0.19% 136 26150 0.20% 137 26635 0.20% 138 27086 0.20% 139 28008 0.21% 140 28940 0.22% 141 29234 0.22% 142 30428 0.23% 143 30978 0.23% 144 31982 0.24% 145 33426 0.25% 146 33905 0.25% 147 35500 0.27% 148 35358 0.26% 149 35950 0.27% 150 37353 0.28% 151 12271046 91.93% 13347563 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=22 prefix-density=0.46 prefix-fanout=2.1 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=27 fanout-score=90.86 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=12.0 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=32 prefix-density=0.81 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.25 sequence-density-rank=9 fanout-score=12.42 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=6.3 sequence=AAGAAGGAGTACCC SRR18694444 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 06:54:37 Started mapping on | Dec 10 06:54:37 Finished on | Dec 10 06:56:25 Mapping speed, Million of reads per hour | 444.92 Number of input reads | 13347563 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 12483340 Uniquely mapped reads % | 93.53% Average mapped length | 296.81 Number of splices: Total | 13194640 Number of splices: Annotated (sjdb) | 12335473 Number of splices: GT/AG | 13006790 Number of splices: GC/AG | 159745 Number of splices: AT/AC | 5278 Number of splices: Non-canonical | 22827 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.01% Deletion average length | 2.46 Insertion rate per base | 0.01% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 164837 % of reads mapped to multiple loci | 1.23% Number of reads mapped to too many loci | 13055 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.15% % of reads unmapped: other | 1.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 699386 699386 699386 N_multimapping 164837 164837 164837 N_noFeature 694065 12134345 800099 N_ambiguous 294202 1769 52133 UnstrandedReadsAssigned:11495073 PositiveStrandReadsAssigned:347226 NegativeStrandReadsAssigned:11631108 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694444 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694444-trimmed-pair1.fastq SRR18694444-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,347,563 reads, 11,807,451 reads pseudoaligned [quant] estimated average fragment length: 268.046 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52973 SRR18694444.ke.tsv 35125 SRR18694444.se.tsv 88098 total ==> SRR18694444.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 669.453 0 0 PNS24247 1044 776.954 45.2161 7.0894 PNS24249 1928 1660.95 25.8981 1.89943 PNS24246 1044 776.954 45.2161 7.0894 PNS24248 1044 776.954 45.2161 7.0894 PNS24244 1471 1203.95 48.4536 4.90261 PNS24243 293 89.3493 0 0 KQK14069 1603 1335.95 569.406 51.9209 KQK14071 474 230.07 7.54922 3.99718 ==> SRR18694444.se.tsv <== BRADI_1g14170v3 654 BRADI_1g53295v3 51 BRADI_1g59795v3 908 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 310 BRADI_1g74790v3 147 BRADI_1g09890v3 0 BRADI_1g77505v3 122 BRADI_1g48960v3 0 SRR18694444 completed mapping pipeline successfully