Starting /dee2/code/volunteer_pipeline.sh SRR18694445 current disk space = 1526054100992 free memory = 1602346636 SRR18694445 SRAfilesize 0f21ddd5407ae86014b4e0937b4485da SRR18694445.sra SRR18694445.sra file validated SRR18694445 is paired end SRR18694445 is conventional basespace SRR18694445 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694445_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8845 37.0 37.0 37.0 37.0 37.0 2 35.74975 37.0 37.0 37.0 37.0 37.0 3 36.224 37.0 37.0 37.0 37.0 37.0 4 36.4465 37.0 37.0 37.0 37.0 37.0 5 36.45 37.0 37.0 37.0 37.0 37.0 6 36.4735 37.0 37.0 37.0 37.0 37.0 7 36.398 37.0 37.0 37.0 37.0 37.0 8 36.533 37.0 37.0 37.0 37.0 37.0 9 36.543 37.0 37.0 37.0 37.0 37.0 10-14 36.553 37.0 37.0 37.0 37.0 37.0 15-19 36.549899999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.572199999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.462199999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.488899999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.5758 37.0 37.0 37.0 37.0 37.0 40-44 36.5166 37.0 37.0 37.0 37.0 37.0 45-49 36.3057 37.0 37.0 37.0 37.0 37.0 50-54 36.465999999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.456900000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.4655 37.0 37.0 37.0 37.0 37.0 65-69 36.1928 37.0 37.0 37.0 37.0 37.0 70-74 36.362199999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.4788 37.0 37.0 37.0 37.0 37.0 80-84 36.359300000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.132099999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.407 37.0 37.0 37.0 29.8 37.0 95-99 36.08710000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.094300000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.0985 37.0 37.0 37.0 37.0 37.0 110-114 36.1603 37.0 37.0 37.0 37.0 37.0 115-119 36.414 37.0 37.0 37.0 37.0 37.0 120-124 36.5578 37.0 37.0 37.0 37.0 37.0 125-129 36.4899 37.0 37.0 37.0 37.0 37.0 130-134 36.498599999999996 37.0 37.0 37.0 37.0 37.0 135-139 36.3538 37.0 37.0 37.0 37.0 37.0 140-144 36.162099999999995 37.0 37.0 37.0 37.0 37.0 145-149 36.1597 37.0 37.0 37.0 37.0 37.0 150-151 33.7895 37.0 31.0 37.0 24.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 0.0 23 2.0 24 1.0 25 1.0 26 2.0 27 2.0 28 3.0 29 7.0 30 6.0 31 14.0 32 35.0 33 69.0 34 128.0 35 394.0 36 3180.0 37 154.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.15 9.625 5.925 36.3 2 23.486561165536298 9.746294900778699 35.31775935694549 31.449384576739515 3 20.325 14.85 24.8 40.025 4 24.65 21.075 22.6 31.674999999999997 5 24.875 26.575 24.675 23.875 6 22.7 31.4 23.799999999999997 22.1 7 17.95 25.1 38.775 18.175 8 18.7 25.55 30.125 25.624999999999996 9 19.2 21.925 34.4 24.474999999999998 10-14 22.25 27.74 26.61 23.400000000000002 15-19 22.3 26.025 26.815 24.86 20-24 22.58 26.095000000000002 26.245 25.080000000000002 25-29 22.17 25.995 26.265 25.569999999999997 30-34 22.255 26.040000000000003 26.334999999999997 25.369999999999997 35-39 22.305 26.27 25.855 25.569999999999997 40-44 22.634999999999998 26.51 25.735000000000003 25.119999999999997 45-49 22.14 25.790000000000003 26.595000000000002 25.474999999999998 50-54 22.285 26.784999999999997 25.705 25.224999999999998 55-59 22.855 25.685000000000002 26.56 24.9 60-64 22.73 26.340000000000003 25.895000000000003 25.035 65-69 22.715 25.585 26.345000000000002 25.355 70-74 22.435 25.85 26.295 25.419999999999998 75-79 23.105 26.095000000000002 26.08 24.72 80-84 22.685 25.979999999999997 26.19 25.145 85-89 23.155 25.695 25.83 25.319999999999997 90-94 23.39 24.84 26.55 25.22 95-99 22.8 26.075 25.685000000000002 25.44 100-104 23.7 25.89 25.490000000000002 24.92 105-109 23.125 25.924999999999997 25.924999999999997 25.025 110-114 23.625 25.674999999999997 25.255 25.445 115-119 22.939999999999998 25.990000000000002 25.89 25.180000000000003 120-124 22.98 25.395 26.095000000000002 25.53 125-129 23.955000000000002 25.685000000000002 25.275 25.085 130-134 22.59 26.085 26.445 24.88 135-139 23.65 25.974999999999998 25.679999999999996 24.695 140-144 22.830000000000002 25.86 25.290000000000003 26.02 145-149 23.385 25.94 25.14 25.535000000000004 150-151 22.9375 25.974999999999998 26.1125 24.975 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 1.5 18 1.5 19 1.0 20 2.0 21 3.0 22 3.0 23 4.0 24 4.5 25 2.5 26 2.5 27 5.0 28 7.5 29 14.0 30 21.5 31 27.0 32 26.5 33 31.0 34 49.0 35 56.0 36 63.5 37 78.5 38 90.0 39 107.0 40 113.0 41 129.0 42 165.0 43 171.5 44 179.0 45 205.5 46 200.5 47 194.5 48 193.0 49 171.5 50 158.0 51 149.0 52 142.5 53 123.5 54 102.5 55 101.0 56 92.5 57 82.0 58 78.0 59 71.0 60 68.0 61 62.5 62 57.0 63 53.0 64 45.0 65 52.0 66 47.0 67 34.0 68 33.5 69 32.5 70 26.0 71 21.0 72 17.0 73 8.5 74 5.0 75 3.0 76 2.5 77 1.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.475 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.375 #Duplication Level Percentage of deduplicated Percentage of total 1 87.75393419170243 76.67500000000001 2 10.472103004291846 18.3 3 1.4592274678111588 3.8249999999999997 4 0.22889842632331905 0.8 5 0.057224606580829764 0.25 6 0.028612303290414882 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGCCTTTTCTTGTTCCTTCAATTCATTGATCCTCTCAGGTGTAAAAGG 6 0.15 No Hit GGCTCATCTTGTCGGCCAGCCCTGCCTTCTCGACAGCAGCAACGGAGTCA 5 0.125 No Hit CTCCGTTTCAGCTAGCTCCCTCTCCAGAACCCTCAGGAACTGGTCGGTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.8374999999999999 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.0499999999999998 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.85 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.35 0.0 0.0 0.0 0.0 116-117 2.7125 0.0 0.0 0.0 0.0 118-119 3.0375 0.0 0.0 0.0 0.0 120-121 3.2375 0.0 0.0 0.0 0.0 122-123 3.3875 0.0 0.0 0.0 0.0 124-125 3.7 0.0 0.0 0.0 0.0 126-127 4.05 0.0 0.0 0.0 0.0 128-129 4.375 0.0 0.0 0.0 0.0 130-131 4.8875 0.0 0.0 0.0 0.0 132-133 5.475 0.0 0.0 0.0 0.0 134-135 5.925000000000001 0.0 0.0 0.0 0.0 136-137 6.3 0.0 0.0 0.0 0.0 138-139 6.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCACGG 10 0.006830828 145.0 6 >>END_MODULE SRR18694445 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18694445_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.7875 37.0 37.0 37.0 25.0 37.0 2 34.9295 37.0 37.0 37.0 25.0 37.0 3 34.7905 37.0 37.0 37.0 25.0 37.0 4 35.005 37.0 37.0 37.0 25.0 37.0 5 35.0495 37.0 37.0 37.0 25.0 37.0 6 34.967 37.0 37.0 37.0 25.0 37.0 7 35.037 37.0 37.0 37.0 25.0 37.0 8 35.3075 37.0 37.0 37.0 25.0 37.0 9 35.2245 37.0 37.0 37.0 25.0 37.0 10-14 35.3241 37.0 37.0 37.0 34.6 37.0 15-19 35.454699999999995 37.0 37.0 37.0 37.0 37.0 20-24 35.191199999999995 37.0 37.0 37.0 27.4 37.0 25-29 35.347300000000004 37.0 37.0 37.0 32.2 37.0 30-34 35.6354 37.0 37.0 37.0 34.6 37.0 35-39 35.47880000000001 37.0 37.0 37.0 34.6 37.0 40-44 35.0596 37.0 37.0 37.0 27.4 37.0 45-49 35.322 37.0 37.0 37.0 27.4 37.0 50-54 34.812 37.0 37.0 37.0 27.0 37.0 55-59 34.26389999999999 37.0 37.0 37.0 25.0 37.0 60-64 34.9765 37.0 37.0 37.0 27.4 37.0 65-69 34.1287 37.0 34.6 37.0 27.4 37.0 70-74 32.9268 37.0 29.8 37.0 22.2 37.0 75-79 33.594899999999996 37.0 34.6 37.0 22.2 37.0 80-84 34.3384 37.0 37.0 37.0 25.0 37.0 85-89 32.5243 37.0 32.2 37.0 19.4 37.0 90-94 33.8932 37.0 37.0 37.0 25.0 37.0 95-99 33.803000000000004 37.0 37.0 37.0 25.0 37.0 100-104 33.2512 37.0 37.0 37.0 25.0 37.0 105-109 33.976600000000005 37.0 37.0 37.0 25.0 37.0 110-114 34.337 37.0 37.0 37.0 25.0 37.0 115-119 34.398700000000005 37.0 37.0 37.0 25.0 37.0 120-124 33.933499999999995 37.0 37.0 37.0 25.0 37.0 125-129 33.920100000000005 37.0 37.0 37.0 25.0 37.0 130-134 33.548700000000004 37.0 37.0 37.0 25.0 37.0 135-139 31.882500000000004 37.0 27.4 37.0 13.8 37.0 140-144 31.569899999999997 37.0 25.0 37.0 11.0 37.0 145-149 31.282400000000003 37.0 25.0 37.0 13.8 37.0 150-151 30.634749999999997 37.0 25.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 3.0 17 3.0 18 1.0 19 3.0 20 2.0 21 2.0 22 5.0 23 10.0 24 8.0 25 7.0 26 16.0 27 23.0 28 26.0 29 57.0 30 90.0 31 147.0 32 308.0 33 640.0 34 1142.0 35 1318.0 36 189.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.025000000000006 22.8 8.774999999999999 25.4 2 30.049999999999997 23.1 27.3 19.55 3 21.25 26.275 29.375 23.1 4 26.025 32.2 21.7 20.075000000000003 5 28.375 33.575 17.575 20.474999999999998 6 24.025 36.075 19.05 20.849999999999998 7 22.675 20.349999999999998 34.725 22.25 8 22.725 24.2 25.074999999999996 28.000000000000004 9 24.15 22.975 27.425 25.45 10-14 25.69 26.11 23.849999999999998 24.349999999999998 15-19 25.369999999999997 25.52 25.330000000000002 23.78 20-24 25.169999999999998 25.995 24.785 24.05 25-29 24.9 26.295 24.66 24.145 30-34 25.009999999999998 26.724999999999998 24.235 24.03 35-39 25.445 25.740000000000002 24.545 24.27 40-44 25.380000000000003 25.605 24.93 24.085 45-49 25.314999999999998 25.3 25.46 23.925 50-54 24.29 26.279999999999998 26.025 23.405 55-59 25.064999999999998 26.11 24.94 23.885 60-64 25.7 25.555 25.095 23.65 65-69 25.305 26.305 24.95 23.44 70-74 26.045 25.14 25.215 23.599999999999998 75-79 26.740000000000002 23.794999999999998 25.735000000000003 23.73 80-84 25.369999999999997 26.445 24.77 23.415 85-89 23.315 28.720000000000002 24.34 23.625 90-94 25.35 26.745 24.67 23.235 95-99 25.415 26.075 25.53 22.98 100-104 25.729999999999997 26.655 24.91 22.705000000000002 105-109 25.255 26.575 25.31 22.86 110-114 26.064999999999998 26.419999999999998 24.965 22.55 115-119 26.619999999999997 25.474999999999998 25.374999999999996 22.53 120-124 25.729999999999997 26.474999999999998 24.95 22.845 125-129 25.345000000000002 26.125 25.465 23.064999999999998 130-134 26.605 26.150000000000002 25.240000000000002 22.005 135-139 26.279999999999998 26.31 25.055 22.355 140-144 26.419999999999998 26.784999999999997 24.845 21.95 145-149 26.3 26.215 24.83 22.655 150-151 24.637500000000003 25.3125 28.849999999999998 21.2 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 1.5 19 1.5 20 0.0 21 1.5 22 2.0 23 2.0 24 5.5 25 5.5 26 6.0 27 8.5 28 10.5 29 14.0 30 23.5 31 32.0 32 33.0 33 37.5 34 41.0 35 38.5 36 44.5 37 65.5 38 87.0 39 93.0 40 110.0 41 140.0 42 156.0 43 163.0 44 165.5 45 176.5 46 184.5 47 181.0 48 185.5 49 165.0 50 146.0 51 148.0 52 133.5 53 113.5 54 107.0 55 100.0 56 98.0 57 91.5 58 92.0 59 95.0 60 78.0 61 73.5 62 67.5 63 60.5 64 56.0 65 62.5 66 58.0 67 43.0 68 41.0 69 31.5 70 21.5 71 24.0 72 21.0 73 13.5 74 8.5 75 6.5 76 4.5 77 2.0 78 3.5 79 3.0 80 2.0 81 2.0 82 1.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.5 98 2.0 99 2.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.675 #Duplication Level Percentage of deduplicated Percentage of total 1 89.65322808006766 79.5 2 8.627008739780095 15.299999999999999 3 1.381449111925571 3.675 4 0.19734987313222443 0.7000000000000001 5 0.05638567803777841 0.25 6 0.0 0.0 7 0.028192839018889203 0.17500000000000002 8 0.05638567803777841 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTGGGTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGT 8 0.2 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit AAAAGCCTTGATGAGCGGTTTCAGGTCCGCGGTATTCCACACCTTGTCAT 7 0.17500000000000002 No Hit AACCGTCAGAGGACTTTGCTGCATACATCAAGCAGAGAGGCTATGACCTC 5 0.125 No Hit AAGAAATCAGCCGACAAATCCGTTTCTAAGGAAAAATCCAAGGCGTTATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.8374999999999999 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.6124999999999998 0.0 0.0 0.0 0.0 108-109 1.7625000000000002 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.45 0.0 0.0 0.0 0.0 116-117 2.8 0.0 0.0 0.0 0.0 118-119 3.1125 0.0 0.0 0.0 0.0 120-121 3.3125 0.0 0.0 0.0 0.0 122-123 3.4625 0.0 0.0 0.0 0.0 124-125 3.7750000000000004 0.0 0.0 0.0 0.0 126-127 4.125 0.0 0.0 0.0 0.0 128-129 4.475 0.0 0.0 0.0 0.0 130-131 5.0125 0.0 0.0 0.0 0.0 132-133 5.6 0.0 0.0 0.0 0.0 134-135 6.050000000000001 0.0 0.0 0.0 0.0 136-137 6.425 0.0 0.0 0.0 0.0 138-139 6.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATCGCC 10 0.006830828 145.0 8 ATCGCCA 10 0.006830828 145.0 9 CTATCGC 10 0.006830828 145.0 7 >>END_MODULE Read 697201 spots for SRR18694445.sra Written 697201 spots for SRR18694445.sra Read 697201 spots for SRR18694445.sra Written 697201 spots for SRR18694445.sra Read 697201 spots for SRR18694445.sra Written 697201 spots for SRR18694445.sra Read 697201 spots for SRR18694445.sra Written 697201 spots for SRR18694445.sra Read 697208 spots for SRR18694445.sra Written 697208 spots for SRR18694445.sra Read 697201 spots for SRR18694445.sra Written 697201 spots for SRR18694445.sra Read 697201 spots for SRR18694445.sra Written 697201 spots for SRR18694445.sra Read 697201 spots for SRR18694445.sra Written 697201 spots for SRR18694445.sra Read 697201 spots for SRR18694445.sra Written 697201 spots for SRR18694445.sra Read 697201 spots for SRR18694445.sra Written 697201 spots for SRR18694445.sra Read 697201 spots for SRR18694445.sra Written 697201 spots for SRR18694445.sra Read 697201 spots for SRR18694445.sra Written 697201 spots for SRR18694445.sra Read 697201 spots for SRR18694445.sra Written 697201 spots for SRR18694445.sra Read 697201 spots for SRR18694445.sra Written 697201 spots for SRR18694445.sra Read 697201 spots for SRR18694445.sra Written 697201 spots for SRR18694445.sra Read 697201 spots for SRR18694445.sra Written 697201 spots for SRR18694445.sra Read 697201 spots for SRR18694445.sra Written 697201 spots for SRR18694445.sra Read 697201 spots for SRR18694445.sra Written 697201 spots for SRR18694445.sra Read 697201 spots for SRR18694445.sra Written 697201 spots for SRR18694445.sra Read 697201 spots for SRR18694445.sra Written 697201 spots for SRR18694445.sra SRR ids: ['SRR18694445.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d4uud7g7 SRR18694445.sra spots: 13944027 blocks: [[1, 697201], [697202, 1394402], [1394403, 2091603], [2091604, 2788804], [2788805, 3486005], [3486006, 4183206], [4183207, 4880407], [4880408, 5577608], [5577609, 6274809], [6274810, 6972010], [6972011, 7669211], [7669212, 8366412], [8366413, 9063613], [9063614, 9760814], [9760815, 10458015], [10458016, 11155216], [11155217, 11852417], [11852418, 12549618], [12549619, 13246819], [13246820, 13944027]] SRR18694445 file size 4717090 SRR18694445 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18694445 SRR18694445_1.fastq SRR18694445_2.fastq Input file: SRR18694445_1.fastq Paired file: SRR18694445_2.fastq trimmed: SRR18694445-trimmed-pair1.fastq, SRR18694445-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:00:58 2024 >> started Tue Dec 10 07:01:14 2024 >> done (15.653s) 13944027 read pairs processed; of these: 110 ( 0.00%) short read pairs filtered out after trimming by size control 6626 ( 0.05%) empty read pairs filtered out after trimming by size control 13937291 (99.95%) read pairs available; of these: 1430911 (10.27%) trimmed read pairs available after processing 12506380 (89.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 12 0.00% 20 14 0.00% 21 23 0.00% 22 20 0.00% 23 18 0.00% 24 17 0.00% 25 23 0.00% 26 16 0.00% 27 44 0.00% 28 25 0.00% 29 29 0.00% 30 36 0.00% 31 39 0.00% 32 41 0.00% 33 40 0.00% 34 35 0.00% 35 39 0.00% 36 30 0.00% 37 55 0.00% 38 47 0.00% 39 44 0.00% 40 61 0.00% 41 42 0.00% 42 55 0.00% 43 71 0.00% 44 70 0.00% 45 58 0.00% 46 66 0.00% 47 67 0.00% 48 77 0.00% 49 78 0.00% 50 97 0.00% 51 109 0.00% 52 106 0.00% 53 99 0.00% 54 108 0.00% 55 112 0.00% 56 141 0.00% 57 119 0.00% 58 156 0.00% 59 194 0.00% 60 203 0.00% 61 233 0.00% 62 277 0.00% 63 281 0.00% 64 322 0.00% 65 340 0.00% 66 342 0.00% 67 436 0.00% 68 414 0.00% 69 566 0.00% 70 606 0.00% 71 765 0.01% 72 837 0.01% 73 869 0.01% 74 1025 0.01% 75 1033 0.01% 76 1238 0.01% 77 1316 0.01% 78 1488 0.01% 79 1562 0.01% 80 1838 0.01% 81 2063 0.01% 82 2448 0.02% 83 2445 0.02% 84 2841 0.02% 85 3098 0.02% 86 3347 0.02% 87 3724 0.03% 88 3909 0.03% 89 4247 0.03% 90 4617 0.03% 91 4872 0.03% 92 5325 0.04% 93 5860 0.04% 94 6223 0.04% 95 6507 0.05% 96 6737 0.05% 97 7482 0.05% 98 7587 0.05% 99 8437 0.06% 100 8791 0.06% 101 9072 0.07% 102 9580 0.07% 103 10326 0.07% 104 11092 0.08% 105 11410 0.08% 106 11897 0.09% 107 12446 0.09% 108 12698 0.09% 109 13454 0.10% 110 13871 0.10% 111 14565 0.10% 112 15383 0.11% 113 16141 0.12% 114 17209 0.12% 115 18038 0.13% 116 18279 0.13% 117 18862 0.14% 118 19392 0.14% 119 20142 0.14% 120 20952 0.15% 121 21818 0.16% 122 22547 0.16% 123 23535 0.17% 124 24840 0.18% 125 25386 0.18% 126 26204 0.19% 127 26754 0.19% 128 27014 0.19% 129 27888 0.20% 130 28486 0.20% 131 29281 0.21% 132 30387 0.22% 133 31460 0.23% 134 32408 0.23% 135 33792 0.24% 136 35269 0.25% 137 35634 0.26% 138 36045 0.26% 139 36753 0.26% 140 37325 0.27% 141 37751 0.27% 142 39067 0.28% 143 39917 0.29% 144 41381 0.30% 145 42795 0.31% 146 42851 0.31% 147 43873 0.31% 148 45014 0.32% 149 45178 0.32% 150 46354 0.33% 151 12506380 89.73% 13937291 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=34 prefix-density=0.18 prefix-fanout=2.5 sequence=GCCAAAGATGTATA criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=464.35 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=36.4 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=32 prefix-density=0.53 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=945.66 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=20.4 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR18694445 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:02:14 Started mapping on | Dec 10 07:02:14 Finished on | Dec 10 07:07:43 Mapping speed, Million of reads per hour | 152.51 Number of input reads | 13937291 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11805440 Uniquely mapped reads % | 84.70% Average mapped length | 295.73 Number of splices: Total | 12682494 Number of splices: Annotated (sjdb) | 11934054 Number of splices: GT/AG | 12513101 Number of splices: GC/AG | 142437 Number of splices: AT/AC | 8005 Number of splices: Non-canonical | 18951 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.01% Deletion average length | 2.49 Insertion rate per base | 0.01% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 164897 % of reads mapped to multiple loci | 1.18% Number of reads mapped to too many loci | 24903 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.87% % of reads unmapped: other | 2.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1966954 1966954 1966954 N_multimapping 164897 164897 164897 N_noFeature 453307 11527428 542935 N_ambiguous 218859 1411 30833 UnstrandedReadsAssigned:11133274 PositiveStrandReadsAssigned:276601 NegativeStrandReadsAssigned:11231672 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR18694445 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18694445-trimmed-pair1.fastq SRR18694445-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,937,291 reads, 11,426,223 reads pseudoaligned [quant] estimated average fragment length: 257.588 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52973 SRR18694445.ke.tsv 35125 SRR18694445.se.tsv 88098 total ==> SRR18694445.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 679.85 0 0 PNS24247 1044 787.412 40.0728 6.57565 PNS24249 1928 1671.41 31.9358 2.4688 PNS24246 1044 787.412 40.0728 6.57565 PNS24248 1044 787.412 40.0728 6.57565 PNS24244 1471 1214.41 81.8457 8.70804 PNS24243 293 94.3792 0 0 KQK14069 1603 1346.41 1412.57 135.558 KQK14071 474 237.538 17.733 9.64582 ==> SRR18694445.se.tsv <== BRADI_1g14170v3 1514 BRADI_1g53295v3 16 BRADI_1g59795v3 249 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 472 BRADI_1g74790v3 35 BRADI_1g09890v3 0 BRADI_1g77505v3 85 BRADI_1g48960v3 0 SRR18694445 completed mapping pipeline successfully