Starting /dee2/code/volunteer_pipeline.sh SRR18697333 current disk space = 1526103339008 free memory = 1556115628 SRR18697333 SRAfilesize 98a37f1e2d9fbfb96625b8cf9483dc82 SRR18697333.sra SRR18697333.sra file validated SRR18697333 is paired end SRR18697333 is conventional basespace SRR18697333 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18697333_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2265 37.0 37.0 37.0 37.0 37.0 2 36.306 37.0 37.0 37.0 37.0 37.0 3 36.2695 37.0 37.0 37.0 37.0 37.0 4 36.448 37.0 37.0 37.0 37.0 37.0 5 36.389 37.0 37.0 37.0 37.0 37.0 6 36.396 37.0 37.0 37.0 37.0 37.0 7 36.2915 37.0 37.0 37.0 37.0 37.0 8 36.4265 37.0 37.0 37.0 37.0 37.0 9 36.434 37.0 37.0 37.0 37.0 37.0 10-14 36.4279 37.0 37.0 37.0 37.0 37.0 15-19 36.367399999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.363299999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.3013 37.0 37.0 37.0 37.0 37.0 30-34 36.242 37.0 37.0 37.0 37.0 37.0 35-39 36.0086 37.0 37.0 37.0 37.0 37.0 40-44 36.1872 37.0 37.0 37.0 37.0 37.0 45-49 36.1751 37.0 37.0 37.0 37.0 37.0 50-54 36.0907 37.0 37.0 37.0 37.0 37.0 55-59 36.1266 37.0 37.0 37.0 37.0 37.0 60-64 35.997699999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.047399999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.0457 37.0 37.0 37.0 37.0 37.0 75-79 35.876099999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.8881 37.0 37.0 37.0 37.0 37.0 85-89 35.898199999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.7963 37.0 37.0 37.0 37.0 37.0 95-99 35.7668 37.0 37.0 37.0 37.0 37.0 100-104 35.8068 37.0 37.0 37.0 37.0 37.0 105-109 35.561800000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.444199999999995 37.0 37.0 37.0 32.2 37.0 115-119 35.6366 37.0 37.0 37.0 37.0 37.0 120-124 35.574 37.0 37.0 37.0 37.0 37.0 125-129 35.5187 37.0 37.0 37.0 37.0 37.0 130-134 35.4705 37.0 37.0 37.0 37.0 37.0 135-139 35.4696 37.0 37.0 37.0 37.0 37.0 140-144 35.478899999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.412099999999995 37.0 37.0 37.0 37.0 37.0 150 35.472 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 4.0 24 3.0 25 7.0 26 13.0 27 9.0 28 30.0 29 41.0 30 58.0 31 75.0 32 86.0 33 113.0 34 167.0 35 326.0 36 2651.0 37 415.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.625000000000004 8.425 13.5 47.449999999999996 2 24.349999999999998 12.775 35.525 27.35 3 23.200000000000003 14.374999999999998 22.525000000000002 39.900000000000006 4 27.975 21.375 19.3 31.35 5 28.4 24.9 23.65 23.05 6 23.65 29.325000000000003 23.25 23.775 7 20.1 21.475 35.675000000000004 22.75 8 20.825 21.475 30.525000000000002 27.175 9 23.625 20.575 29.549999999999997 26.25 10-14 24.755 25.6 23.419999999999998 26.224999999999998 15-19 24.905 23.605 24.13 27.36 20-24 25.055 24.745 23.0 27.200000000000003 25-29 25.485000000000003 23.880000000000003 23.235 27.400000000000002 30-34 25.759999999999998 23.044999999999998 23.11 28.084999999999997 35-39 25.165 24.240000000000002 22.435 28.16 40-44 25.585 23.525 23.315 27.575 45-49 25.979999999999997 22.88 23.18 27.96 50-54 26.27 23.355 22.830000000000002 27.544999999999998 55-59 25.965 22.575 23.294999999999998 28.165000000000003 60-64 25.995 22.830000000000002 22.475 28.7 65-69 26.655 22.49 23.035 27.82 70-74 26.705000000000002 23.44 22.075 27.779999999999998 75-79 26.75 23.16 21.845 28.244999999999997 80-84 27.045 22.85 22.400000000000002 27.705000000000002 85-89 26.57 22.37 22.67 28.389999999999997 90-94 26.645000000000003 22.48 22.23 28.645 95-99 27.13 22.66 22.215 27.994999999999997 100-104 26.674999999999997 22.79 22.205 28.33 105-109 26.915 22.31 22.415 28.360000000000003 110-114 26.715 21.995 22.509999999999998 28.78 115-119 27.095000000000002 22.21 22.55 28.144999999999996 120-124 26.83 22.285 22.37 28.515 125-129 27.325 22.12 22.2 28.355000000000004 130-134 27.665 21.89 22.3 28.144999999999996 135-139 27.500000000000004 22.3 21.805 28.395 140-144 27.435 21.64 22.05 28.875 145-149 27.18 21.935 22.11 28.775000000000002 150 29.049999999999997 20.974999999999998 22.0 27.975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 2.5 28 1.0 29 1.0 30 3.5 31 5.0 32 7.0 33 14.5 34 25.5 35 30.5 36 29.5 37 37.5 38 60.0 39 72.5 40 80.5 41 95.5 42 107.5 43 119.0 44 142.0 45 146.5 46 141.5 47 153.5 48 157.0 49 150.0 50 137.5 51 124.5 52 116.0 53 123.5 54 127.5 55 112.0 56 99.0 57 100.5 58 85.5 59 78.5 60 88.0 61 82.5 62 77.0 63 74.0 64 81.5 65 81.5 66 85.0 67 88.5 68 86.0 69 84.5 70 68.5 71 59.0 72 53.0 73 53.5 74 53.0 75 44.0 76 33.0 77 27.5 78 23.5 79 19.0 80 15.5 81 10.0 82 8.5 83 5.0 84 2.0 85 0.5 86 0.5 87 1.5 88 1.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.35 #Duplication Level Percentage of deduplicated Percentage of total 1 91.18773946360153 83.3 2 8.210180623973727 15.0 3 0.5747126436781609 1.575 4 0.0 0.0 5 0.027367268746579094 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTTGGCGTACTGGCACAGACAACCCTGCTGCGCCCTCAGGTTGCTGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.1125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.125 0.0 0.0 0.0 0.0 118-119 0.15 0.0 0.0 0.0 0.0 120-121 0.16249999999999998 0.0 0.0 0.0 0.0 122-123 0.21250000000000002 0.0 0.0 0.0 0.0 124-125 0.2625 0.0 0.0 0.0 0.0 126-127 0.2875 0.0 0.0 0.0 0.0 128-129 0.325 0.0 0.0 0.0 0.0 130-131 0.4125 0.0 0.0 0.0 0.0 132-133 0.4625 0.0 0.0 0.0 0.0 134-135 0.4875 0.0 0.0 0.0 0.0 136-137 0.5625 0.0 0.0 0.0 0.0 138 0.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAATGA 10 0.006973645 144.0 6 CCTCAAT 10 0.006973645 144.0 4 CTCAATG 10 0.006973645 144.0 5 AATGATG 10 0.006973645 144.0 8 >>END_MODULE SRR18697333 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18697333_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.217 37.0 37.0 37.0 37.0 37.0 2 36.394 37.0 37.0 37.0 37.0 37.0 3 36.453 37.0 37.0 37.0 37.0 37.0 4 36.3305 37.0 37.0 37.0 37.0 37.0 5 36.4175 37.0 37.0 37.0 37.0 37.0 6 36.2305 37.0 37.0 37.0 37.0 37.0 7 36.1985 37.0 37.0 37.0 37.0 37.0 8 36.3725 37.0 37.0 37.0 37.0 37.0 9 36.3045 37.0 37.0 37.0 37.0 37.0 10-14 36.3846 37.0 37.0 37.0 37.0 37.0 15-19 36.37 37.0 37.0 37.0 37.0 37.0 20-24 36.4226 37.0 37.0 37.0 37.0 37.0 25-29 36.3403 37.0 37.0 37.0 37.0 37.0 30-34 36.2898 37.0 37.0 37.0 37.0 37.0 35-39 36.306400000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.2569 37.0 37.0 37.0 37.0 37.0 45-49 36.219899999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.1911 37.0 37.0 37.0 37.0 37.0 55-59 36.1914 37.0 37.0 37.0 37.0 37.0 60-64 36.204100000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.076 37.0 37.0 37.0 37.0 37.0 70-74 36.078599999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.130399999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.910900000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.8738 37.0 37.0 37.0 37.0 37.0 90-94 35.982600000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.9309 37.0 37.0 37.0 37.0 37.0 100-104 35.87820000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.8775 37.0 37.0 37.0 37.0 37.0 110-114 35.827600000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.844800000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.7679 37.0 37.0 37.0 37.0 37.0 125-129 35.765699999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.67 37.0 37.0 37.0 37.0 37.0 135-139 35.7178 37.0 37.0 37.0 37.0 37.0 140-144 35.7322 37.0 37.0 37.0 37.0 37.0 145-149 35.5957 37.0 37.0 37.0 37.0 37.0 150 35.451 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 4.0 24 5.0 25 11.0 26 13.0 27 19.0 28 22.0 29 23.0 30 37.0 31 36.0 32 44.0 33 91.0 34 164.0 35 364.0 36 2789.0 37 377.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.3 16.650000000000002 11.899999999999999 40.150000000000006 2 29.599999999999998 26.174999999999997 25.275 18.95 3 23.075000000000003 28.1 18.175 30.65 4 27.825 29.125 15.45 27.6 5 29.075 29.575000000000003 19.225 22.125 6 24.474999999999998 32.725 17.525 25.275 7 23.775 17.075000000000003 32.2 26.950000000000003 8 25.15 19.775000000000002 22.875 32.2 9 25.074999999999996 19.825 25.424999999999997 29.675 10-14 27.065 23.865 20.455000000000002 28.615000000000002 15-19 28.12 22.415 21.099999999999998 28.365000000000002 20-24 27.62 22.855 21.09 28.435 25-29 27.944999999999997 23.35 21.04 27.665 30-34 27.62 22.99 21.81 27.58 35-39 28.395 22.765 21.275 27.565 40-44 27.935 23.13 21.075 27.860000000000003 45-49 28.43 22.52 21.675 27.375 50-54 28.610000000000003 22.615 21.45 27.325 55-59 28.804999999999996 22.42 21.07 27.705000000000002 60-64 28.92 22.675 21.044999999999998 27.36 65-69 28.935 22.0 22.0 27.065 70-74 28.875 21.975 21.23 27.92 75-79 28.749999999999996 22.595000000000002 21.015 27.639999999999997 80-84 28.560000000000002 21.8 21.44 28.199999999999996 85-89 28.845 22.215 21.215 27.725 90-94 28.54 22.16 21.955 27.345000000000002 95-99 29.24 22.09 21.560000000000002 27.11 100-104 28.645 22.220000000000002 21.355 27.779999999999998 105-109 28.585 22.27 21.5 27.644999999999996 110-114 28.84 21.845 22.3 27.015 115-119 28.904999999999998 22.495 21.52 27.08 120-124 28.785 22.555 21.525 27.134999999999998 125-129 28.73 22.605 21.715 26.950000000000003 130-134 29.165000000000003 22.595000000000002 21.62 26.619999999999997 135-139 29.21 22.05 21.834999999999997 26.905 140-144 28.9 22.88 21.8 26.419999999999998 145-149 28.915000000000003 22.755 21.445 26.884999999999998 150 26.974999999999998 22.475 21.65 28.9 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 0.5 28 0.0 29 0.5 30 3.0 31 4.0 32 3.0 33 2.0 34 4.5 35 9.5 36 13.0 37 25.0 38 45.5 39 50.5 40 60.0 41 79.5 42 87.5 43 106.0 44 115.0 45 116.0 46 136.0 47 147.0 48 133.5 49 130.0 50 131.0 51 133.0 52 135.0 53 116.0 54 107.5 55 94.0 56 87.5 57 89.5 58 95.0 59 100.5 60 109.5 61 112.0 62 104.0 63 107.0 64 107.5 65 109.0 66 102.0 67 103.5 68 109.5 69 101.5 70 91.5 71 81.0 72 67.5 73 59.5 74 58.5 75 58.5 76 38.5 77 25.0 78 25.0 79 21.0 80 16.0 81 11.5 82 9.0 83 3.0 84 1.5 85 1.5 86 1.0 87 1.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 90.97641250685683 82.92500000000001 2 8.447613823368075 15.4 3 0.5211190345584202 1.425 4 0.0 0.0 5 0.054854635216675815 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAGCGCACCACGACAGTAGCAAGAGCTTTTGATCATATCTTGCAGCAATC 5 0.125 No Hit CTCAAAAGCAAGCAAGCTAGCTAGCGAGCATCAATGGCGATGACCATGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.16249999999999998 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.175 0.0 0.0 0.0 0.0 118-119 0.2 0.0 0.0 0.0 0.0 120-121 0.21250000000000002 0.0 0.0 0.0 0.0 122-123 0.2625 0.0 0.0 0.0 0.0 124-125 0.3125 0.0 0.0 0.0 0.0 126-127 0.3375 0.0 0.0 0.0 0.0 128-129 0.375 0.0 0.0 0.0 0.0 130-131 0.4625 0.0 0.0 0.0 0.0 132-133 0.5125 0.0 0.0 0.0 0.0 134-135 0.5375000000000001 0.0 0.0 0.0 0.0 136-137 0.6125 0.0 0.0 0.0 0.0 138 0.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCACACA 10 0.006973645 144.0 8 CAACGAC 10 0.006973645 144.0 9 >>END_MODULE Read 1608447 spots for SRR18697333.sra Written 1608447 spots for SRR18697333.sra Read 1608447 spots for SRR18697333.sra Written 1608447 spots for SRR18697333.sra Read 1608447 spots for SRR18697333.sra Written 1608447 spots for SRR18697333.sra Read 1608447 spots for SRR18697333.sra Written 1608447 spots for SRR18697333.sra Read 1608447 spots for SRR18697333.sra Written 1608447 spots for SRR18697333.sra Read 1608447 spots for SRR18697333.sra Written 1608447 spots for SRR18697333.sra Read 1608447 spots for SRR18697333.sra Written 1608447 spots for SRR18697333.sra Read 1608447 spots for SRR18697333.sra Written 1608447 spots for SRR18697333.sra Read 1608447 spots for SRR18697333.sra Written 1608447 spots for SRR18697333.sra Read 1608447 spots for SRR18697333.sra Written 1608447 spots for SRR18697333.sra Read 1608459 spots for SRR18697333.sra Written 1608459 spots for SRR18697333.sra Read 1608447 spots for SRR18697333.sra Written 1608447 spots for SRR18697333.sra Read 1608447 spots for SRR18697333.sra Written 1608447 spots for SRR18697333.sra Read 1608447 spots for SRR18697333.sra Written 1608447 spots for SRR18697333.sra Read 1608447 spots for SRR18697333.sra Written 1608447 spots for SRR18697333.sra Read 1608447 spots for SRR18697333.sra Written 1608447 spots for SRR18697333.sra Read 1608447 spots for SRR18697333.sra Written 1608447 spots for SRR18697333.sra Read 1608447 spots for SRR18697333.sra Written 1608447 spots for SRR18697333.sra Read 1608447 spots for SRR18697333.sra Written 1608447 spots for SRR18697333.sra Read 1608447 spots for SRR18697333.sra Written 1608447 spots for SRR18697333.sra SRR ids: ['SRR18697333.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8p9bwit1 SRR18697333.sra spots: 32168952 blocks: [[1, 1608447], [1608448, 3216894], [3216895, 4825341], [4825342, 6433788], [6433789, 8042235], [8042236, 9650682], [9650683, 11259129], [11259130, 12867576], [12867577, 14476023], [14476024, 16084470], [16084471, 17692917], [17692918, 19301364], [19301365, 20909811], [20909812, 22518258], [22518259, 24126705], [24126706, 25735152], [25735153, 27343599], [27343600, 28952046], [28952047, 30560493], [30560494, 32168952]] SRR18697333 file size 10847886 SRR18697333 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18697333 SRR18697333_1.fastq SRR18697333_2.fastq Input file: SRR18697333_1.fastq Paired file: SRR18697333_2.fastq trimmed: SRR18697333-trimmed-pair1.fastq, SRR18697333-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:06:00 2024 >> started Tue Dec 10 07:06:33 2024 >> done (33.059s) 32168952 read pairs processed; of these: 104 ( 0.00%) short read pairs filtered out after trimming by size control 120 ( 0.00%) empty read pairs filtered out after trimming by size control 32168728 (100.00%) read pairs available; of these: 377981 ( 1.17%) trimmed read pairs available after processing 31790747 (98.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 35 0.00% 21 9 0.00% 22 4 0.00% 23 9 0.00% 24 5 0.00% 25 6 0.00% 26 5 0.00% 27 13 0.00% 28 11 0.00% 29 8 0.00% 30 43 0.00% 31 26 0.00% 32 18 0.00% 33 12 0.00% 34 10 0.00% 35 17 0.00% 36 20 0.00% 37 13 0.00% 38 23 0.00% 39 30 0.00% 40 18 0.00% 41 24 0.00% 42 18 0.00% 43 24 0.00% 44 28 0.00% 45 31 0.00% 46 35 0.00% 47 30 0.00% 48 24 0.00% 49 27 0.00% 50 47 0.00% 51 38 0.00% 52 55 0.00% 53 58 0.00% 54 40 0.00% 55 61 0.00% 56 56 0.00% 57 63 0.00% 58 57 0.00% 59 57 0.00% 60 72 0.00% 61 84 0.00% 62 107 0.00% 63 68 0.00% 64 94 0.00% 65 103 0.00% 66 104 0.00% 67 87 0.00% 68 94 0.00% 69 135 0.00% 70 125 0.00% 71 132 0.00% 72 168 0.00% 73 149 0.00% 74 168 0.00% 75 184 0.00% 76 190 0.00% 77 201 0.00% 78 266 0.00% 79 245 0.00% 80 239 0.00% 81 302 0.00% 82 343 0.00% 83 391 0.00% 84 380 0.00% 85 487 0.00% 86 523 0.00% 87 487 0.00% 88 606 0.00% 89 628 0.00% 90 714 0.00% 91 743 0.00% 92 802 0.00% 93 863 0.00% 94 937 0.00% 95 1021 0.00% 96 1096 0.00% 97 1234 0.00% 98 1336 0.00% 99 1337 0.00% 100 1487 0.00% 101 1693 0.01% 102 1642 0.01% 103 1800 0.01% 104 1871 0.01% 105 1977 0.01% 106 2221 0.01% 107 2388 0.01% 108 2487 0.01% 109 2618 0.01% 110 2820 0.01% 111 2901 0.01% 112 3152 0.01% 113 3268 0.01% 114 3565 0.01% 115 3741 0.01% 116 3917 0.01% 117 4143 0.01% 118 4300 0.01% 119 4549 0.01% 120 4697 0.01% 121 4892 0.02% 122 5022 0.02% 123 5418 0.02% 124 5671 0.02% 125 6140 0.02% 126 6447 0.02% 127 6796 0.02% 128 7020 0.02% 129 7252 0.02% 130 7684 0.02% 131 8359 0.03% 132 8281 0.03% 133 8623 0.03% 134 9037 0.03% 135 9688 0.03% 136 10267 0.03% 137 10381 0.03% 138 10971 0.03% 139 11728 0.04% 140 12195 0.04% 141 12310 0.04% 142 13241 0.04% 143 13571 0.04% 144 14394 0.04% 145 15453 0.05% 146 15510 0.05% 147 16364 0.05% 148 17316 0.05% 149 18351 0.06% 150 31790747 98.83% 32168728 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=16.81 fanout-score-rank=13 prefix-density=0.36 prefix-fanout=8.2 sequence=ACCTCCTCCAGCTCCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=18 fanout-score=169.35 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=21.4 sequence=CGCCGCCGCCGCGG criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=14.22 fanout-score-rank=11 prefix-density=0.45 prefix-fanout=8.5 sequence=AAGGAGCTGGAG criterion=fanout-score sequence-density=0.13 sequence-density-rank=18 fanout-score=284.23 fanout-score-rank=1 prefix-density=1.55 prefix-fanout=23.0 sequence=CGCCGCCGCCGG SRR18697333 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:07:17 Started mapping on | Dec 10 07:07:17 Finished on | Dec 10 07:09:50 Mapping speed, Million of reads per hour | 756.91 Number of input reads | 32168728 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 31144373 Uniquely mapped reads % | 96.82% Average mapped length | 298.56 Number of splices: Total | 30624960 Number of splices: Annotated (sjdb) | 29016547 Number of splices: GT/AG | 30232434 Number of splices: GC/AG | 325569 Number of splices: AT/AC | 24210 Number of splices: Non-canonical | 42747 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.58 Insertion rate per base | 0.01% Insertion average length | 2.98 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 589766 % of reads mapped to multiple loci | 1.83% Number of reads mapped to too many loci | 9347 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.94% % of reads unmapped: other | 0.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 434589 434589 434589 N_multimapping 589766 589766 589766 N_noFeature 440444 27028189 3445940 N_ambiguous 1224739 15675 102803 UnstrandedReadsAssigned:29479190 PositiveStrandReadsAssigned:4100509 NegativeStrandReadsAssigned:27595630 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR18697333 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18697333-trimmed-pair1.fastq SRR18697333-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,168,728 reads, 27,911,858 reads pseudoaligned [quant] estimated average fragment length: 258.508 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,053 rounds 52973 SRR18697333.ke.tsv 35125 SRR18697333.se.tsv 88098 total ==> SRR18697333.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 678.82 2.94196e-06 1.68759e-07 PNS24247 1044 786.492 51.4973 2.54961 PNS24249 1928 1670.49 393.073 9.16248 PNS24246 1044 786.492 51.4973 2.54961 PNS24248 1044 786.492 51.4973 2.54961 PNS24244 1471 1213.49 18.4353 0.591558 PNS24243 293 57.2122 0 0 KQK14069 1603 1345.49 4595.55 132.997 KQK14071 474 219.132 29.0653 5.1648 ==> SRR18697333.se.tsv <== BRADI_1g14170v3 4665 BRADI_1g53295v3 10 BRADI_1g59795v3 68 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 1309 BRADI_1g74790v3 140 BRADI_1g09890v3 51 BRADI_1g77505v3 743 BRADI_1g48960v3 2 SRR18697333 completed mapping pipeline successfully