Starting /dee2/code/volunteer_pipeline.sh SRR18697334 current disk space = 1526102097920 free memory = 1556083308 SRR18697334 SRAfilesize cc895a2b20b9b3045e9ed941bab612f1 SRR18697334.sra SRR18697334.sra file validated SRR18697334 is paired end SRR18697334 is conventional basespace SRR18697334 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18697334_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.333 37.0 37.0 37.0 37.0 37.0 2 36.166 37.0 37.0 37.0 37.0 37.0 3 36.275 37.0 37.0 37.0 37.0 37.0 4 36.368 37.0 37.0 37.0 37.0 37.0 5 36.366 37.0 37.0 37.0 37.0 37.0 6 36.3325 37.0 37.0 37.0 37.0 37.0 7 36.2565 37.0 37.0 37.0 37.0 37.0 8 36.4115 37.0 37.0 37.0 37.0 37.0 9 36.428 37.0 37.0 37.0 37.0 37.0 10-14 36.3647 37.0 37.0 37.0 37.0 37.0 15-19 36.3609 37.0 37.0 37.0 37.0 37.0 20-24 36.3113 37.0 37.0 37.0 37.0 37.0 25-29 36.2543 37.0 37.0 37.0 37.0 37.0 30-34 36.143299999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.9836 37.0 37.0 37.0 37.0 37.0 40-44 36.1188 37.0 37.0 37.0 37.0 37.0 45-49 36.10459999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.0159 37.0 37.0 37.0 37.0 37.0 55-59 36.048199999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.9584 37.0 37.0 37.0 37.0 37.0 65-69 35.8776 37.0 37.0 37.0 37.0 37.0 70-74 35.85430000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.8215 37.0 37.0 37.0 37.0 37.0 80-84 35.8328 37.0 37.0 37.0 37.0 37.0 85-89 35.822799999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.7356 37.0 37.0 37.0 37.0 37.0 95-99 35.6863 37.0 37.0 37.0 37.0 37.0 100-104 35.732400000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.533 37.0 37.0 37.0 34.6 37.0 110-114 35.3158 37.0 37.0 37.0 32.2 37.0 115-119 35.627199999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.5369 37.0 37.0 37.0 37.0 37.0 125-129 35.5362 37.0 37.0 37.0 37.0 37.0 130-134 35.370200000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.389700000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.394600000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.4062 37.0 37.0 37.0 37.0 37.0 150 35.337 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 8.0 24 8.0 25 8.0 26 14.0 27 15.0 28 33.0 29 48.0 30 66.0 31 72.0 32 79.0 33 105.0 34 159.0 35 332.0 36 2667.0 37 383.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.800000000000004 9.700000000000001 12.4 50.1 2 25.25 14.224999999999998 35.449999999999996 25.074999999999996 3 22.975 15.6 23.724999999999998 37.7 4 27.675 21.6 18.825 31.900000000000002 5 28.799999999999997 25.275 22.125 23.799999999999997 6 24.474999999999998 29.95 21.825 23.75 7 19.75 20.05 37.375 22.825 8 20.825 21.475 31.474999999999998 26.224999999999998 9 22.725 22.725 29.625 24.925 10-14 24.745 25.545 23.599999999999998 26.11 15-19 24.94 23.915 23.25 27.894999999999996 20-24 25.0 24.13 23.585 27.284999999999997 25-29 25.869999999999997 23.225 23.369999999999997 27.534999999999997 30-34 25.655 23.794999999999998 22.925 27.625 35-39 25.14 22.945 23.59 28.325 40-44 25.180000000000003 24.205 22.725 27.889999999999997 45-49 25.96 23.150000000000002 22.994999999999997 27.894999999999996 50-54 25.5 23.445 23.13 27.925 55-59 26.400000000000002 23.24 23.0 27.36 60-64 26.185000000000002 22.855 22.99 27.97 65-69 26.35 23.62 22.49 27.54 70-74 26.325 22.905 22.814999999999998 27.955000000000002 75-79 26.41 22.735 22.615 28.24 80-84 26.105 22.650000000000002 23.14 28.105000000000004 85-89 26.565 22.575 22.93 27.93 90-94 26.63 21.654999999999998 23.195 28.52 95-99 26.075 22.33 23.265 28.33 100-104 27.139999999999997 21.945 22.165000000000003 28.749999999999996 105-109 26.185000000000002 22.975 22.205 28.634999999999998 110-114 26.955000000000002 22.759999999999998 22.585 27.700000000000003 115-119 26.88 22.555 22.695 27.87 120-124 27.105 22.23 22.755 27.91 125-129 26.61 22.85 22.470000000000002 28.07 130-134 27.215 21.72 22.7 28.365000000000002 135-139 27.315 22.525000000000002 21.93 28.23 140-144 27.985 21.87 22.31 27.834999999999997 145-149 26.55 22.925 21.92 28.605000000000004 150 26.6 22.875 23.150000000000002 27.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 0.5 28 2.0 29 2.5 30 5.5 31 6.5 32 9.0 33 12.5 34 13.5 35 20.5 36 28.0 37 39.5 38 59.0 39 74.0 40 89.0 41 117.5 42 133.0 43 135.0 44 150.0 45 161.5 46 158.0 47 150.0 48 144.5 49 140.5 50 128.0 51 131.0 52 132.5 53 116.0 54 112.5 55 105.5 56 88.0 57 76.5 58 78.5 59 88.5 60 89.5 61 81.0 62 70.5 63 76.0 64 81.5 65 86.5 66 89.0 67 85.0 68 81.0 69 67.0 70 64.5 71 64.5 72 50.5 73 40.0 74 51.0 75 50.5 76 42.5 77 32.0 78 21.0 79 19.5 80 13.0 81 8.5 82 8.0 83 8.0 84 4.5 85 2.5 86 2.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.025 #Duplication Level Percentage of deduplicated Percentage of total 1 89.94723687864482 80.975 2 9.164121077478478 16.5 3 0.833101916134407 2.25 4 0.027770063871146906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.027770063871146906 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGGCGTACTGGCACAGACAACCCTGCTGCGCCCTCAGGTTGCTGCAGC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.1 0.0 0.0 0.0 0.0 114-115 0.1 0.0 0.0 0.0 0.0 116-117 0.1125 0.0 0.0 0.0 0.0 118-119 0.15 0.0 0.0 0.0 0.0 120-121 0.175 0.0 0.0 0.0 0.0 122-123 0.21250000000000002 0.0 0.0 0.0 0.0 124-125 0.2375 0.0 0.0 0.0 0.0 126-127 0.275 0.0 0.0 0.0 0.0 128-129 0.3125 0.0 0.0 0.0 0.0 130-131 0.3875 0.0 0.0 0.0 0.0 132-133 0.44999999999999996 0.0 0.0 0.0 0.0 134-135 0.55 0.0 0.0 0.0 0.0 136-137 0.675 0.0 0.0 0.0 0.0 138 0.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18697334 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18697334_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2365 37.0 37.0 37.0 37.0 37.0 2 36.1445 37.0 37.0 37.0 37.0 37.0 3 36.2145 37.0 37.0 37.0 37.0 37.0 4 36.249 37.0 37.0 37.0 37.0 37.0 5 36.3 37.0 37.0 37.0 37.0 37.0 6 36.291 37.0 37.0 37.0 37.0 37.0 7 36.2555 37.0 37.0 37.0 37.0 37.0 8 36.291 37.0 37.0 37.0 37.0 37.0 9 36.3015 37.0 37.0 37.0 37.0 37.0 10-14 36.2649 37.0 37.0 37.0 37.0 37.0 15-19 36.267 37.0 37.0 37.0 37.0 37.0 20-24 36.291000000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.208600000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.1708 37.0 37.0 37.0 37.0 37.0 35-39 36.2034 37.0 37.0 37.0 37.0 37.0 40-44 36.1659 37.0 37.0 37.0 37.0 37.0 45-49 36.132099999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.077999999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.1195 37.0 37.0 37.0 37.0 37.0 60-64 36.038 37.0 37.0 37.0 37.0 37.0 65-69 36.0154 37.0 37.0 37.0 37.0 37.0 70-74 36.0053 37.0 37.0 37.0 37.0 37.0 75-79 35.8901 37.0 37.0 37.0 37.0 37.0 80-84 35.7804 37.0 37.0 37.0 34.6 37.0 85-89 35.714 37.0 37.0 37.0 37.0 37.0 90-94 35.8983 37.0 37.0 37.0 37.0 37.0 95-99 35.7907 37.0 37.0 37.0 37.0 37.0 100-104 35.75789999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.8271 37.0 37.0 37.0 37.0 37.0 110-114 35.6907 37.0 37.0 37.0 37.0 37.0 115-119 35.7205 37.0 37.0 37.0 37.0 37.0 120-124 35.6974 37.0 37.0 37.0 37.0 37.0 125-129 35.6549 37.0 37.0 37.0 37.0 37.0 130-134 35.5033 37.0 37.0 37.0 37.0 37.0 135-139 35.5967 37.0 37.0 37.0 37.0 37.0 140-144 35.5479 37.0 37.0 37.0 37.0 37.0 145-149 35.519099999999995 37.0 37.0 37.0 37.0 37.0 150 35.356 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 7.0 24 8.0 25 7.0 26 16.0 27 17.0 28 25.0 29 34.0 30 41.0 31 46.0 32 71.0 33 77.0 34 179.0 35 400.0 36 2752.0 37 317.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.225 18.025 10.85 42.9 2 28.849999999999998 27.575 26.275 17.299999999999997 3 23.150000000000002 28.65 18.55 29.65 4 28.65 27.85 17.075000000000003 26.424999999999997 5 27.950000000000003 30.3 19.35 22.400000000000002 6 21.975 32.85 18.925 26.25 7 23.275000000000002 18.075 30.775000000000002 27.875 8 23.275000000000002 20.75 23.9 32.074999999999996 9 24.25 21.349999999999998 24.55 29.849999999999998 10-14 27.250000000000004 24.07 20.925 27.755000000000003 15-19 26.884999999999998 23.3 22.065 27.750000000000004 20-24 27.095000000000002 24.135 21.705 27.065 25-29 27.465 23.105 21.740000000000002 27.689999999999998 30-34 27.72 23.27 21.29 27.72 35-39 27.01 23.745 21.905 27.339999999999996 40-44 28.025 22.61 21.81 27.555000000000003 45-49 28.27 22.830000000000002 21.295 27.605 50-54 27.839999999999996 22.97 21.88 27.310000000000002 55-59 28.265 22.02 22.12 27.595 60-64 28.244999999999997 22.64 21.945 27.169999999999998 65-69 28.275 22.8 21.990000000000002 26.935 70-74 28.544999999999998 22.564999999999998 21.6 27.29 75-79 28.04 23.07 21.455 27.435 80-84 28.904999999999998 22.82 21.7 26.575 85-89 28.765 22.98 21.44 26.815 90-94 28.77 22.535 21.545 27.150000000000002 95-99 28.265 22.264999999999997 22.28 27.189999999999998 100-104 29.18 22.14 21.525 27.155 105-109 28.199999999999996 22.89 21.565 27.345000000000002 110-114 28.689999999999998 22.68 21.875 26.755000000000003 115-119 28.845 22.085 21.59 27.48 120-124 28.08 22.495 21.78 27.644999999999996 125-129 28.07 22.755 21.84 27.334999999999997 130-134 28.125 23.06 21.975 26.840000000000003 135-139 28.18 22.125 22.645 27.05 140-144 28.144999999999996 23.080000000000002 22.585 26.19 145-149 28.165000000000003 23.474999999999998 21.455 26.905 150 28.125 22.275 22.3 27.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 0.5 26 0.5 27 0.0 28 0.0 29 0.5 30 1.5 31 3.5 32 3.5 33 3.0 34 4.0 35 9.0 36 20.5 37 38.0 38 47.0 39 52.0 40 67.0 41 85.0 42 112.0 43 131.0 44 136.5 45 144.0 46 150.0 47 148.5 48 146.5 49 140.5 50 130.0 51 118.5 52 111.5 53 106.0 54 88.0 55 89.5 56 99.0 57 94.5 58 87.5 59 91.0 60 103.5 61 107.5 62 98.5 63 86.5 64 102.0 65 112.5 66 103.5 67 97.0 68 91.5 69 90.0 70 84.5 71 82.0 72 77.0 73 62.5 74 51.0 75 45.5 76 36.5 77 28.5 78 23.0 79 16.5 80 12.0 81 7.0 82 4.5 83 3.5 84 2.5 85 2.0 86 2.5 87 1.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.875 #Duplication Level Percentage of deduplicated Percentage of total 1 89.8191933240612 80.72500000000001 2 9.429763560500696 16.950000000000003 3 0.6675938803894298 1.7999999999999998 4 0.0 0.0 5 0.0 0.0 6 0.027816411682892908 0.15 7 0.027816411682892908 0.17500000000000002 8 0.027816411682892908 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCAAAAGCAAGCAAGCTAGCTAGCGAGCATCAATGGCGATGACCATGAG 8 0.2 No Hit CAAAAGCAAGCAAGCTAGCTAGCGAGCATCAATGGCGATGACCATGAGGA 7 0.17500000000000002 No Hit AAAGCAAGCAAGCTAGCTAGCGAGCATCAATGGCGATGACCATGAGGAAG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.1375 0.0 0.0 0.0 0.0 118-119 0.175 0.0 0.0 0.0 0.0 120-121 0.2 0.0 0.0 0.0 0.0 122-123 0.2375 0.0 0.0 0.0 0.0 124-125 0.2625 0.0 0.0 0.0 0.0 126-127 0.3 0.0 0.0 0.0 0.0 128-129 0.32499999999999996 0.0 0.0 0.0 0.0 130-131 0.3875 0.0 0.0 0.0 0.0 132-133 0.4375 0.0 0.0 0.0 0.0 134-135 0.525 0.0 0.0 0.0 0.0 136-137 0.675 0.0 0.0 0.0 0.0 138 0.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATCAC 10 0.006973645 144.0 4 TTAAGCA 10 0.006973645 144.0 7 GCATCAT 10 0.006973645 144.0 9 >>END_MODULE Read 1527797 spots for SRR18697334.sra Written 1527797 spots for SRR18697334.sra Read 1527797 spots for SRR18697334.sra Written 1527797 spots for SRR18697334.sra Read 1527797 spots for SRR18697334.sra Written 1527797 spots for SRR18697334.sra Read 1527797 spots for SRR18697334.sra Written 1527797 spots for SRR18697334.sra Read 1527797 spots for SRR18697334.sra Written 1527797 spots for SRR18697334.sra Read 1527797 spots for SRR18697334.sra Written 1527797 spots for SRR18697334.sra Read 1527797 spots for SRR18697334.sra Written 1527797 spots for SRR18697334.sra Read 1527797 spots for SRR18697334.sra Written 1527797 spots for SRR18697334.sra Read 1527797 spots for SRR18697334.sra Written 1527797 spots for SRR18697334.sra Read 1527797 spots for SRR18697334.sra Written 1527797 spots for SRR18697334.sra Read 1527797 spots for SRR18697334.sra Written 1527797 spots for SRR18697334.sra Read 1527797 spots for SRR18697334.sra Written 1527797 spots for SRR18697334.sra Read 1527808 spots for SRR18697334.sra Written 1527808 spots for SRR18697334.sra Read 1527797 spots for SRR18697334.sra Written 1527797 spots for SRR18697334.sra Read 1527797 spots for SRR18697334.sra Written 1527797 spots for SRR18697334.sra Read 1527797 spots for SRR18697334.sra Written 1527797 spots for SRR18697334.sra Read 1527797 spots for SRR18697334.sra Written 1527797 spots for SRR18697334.sra Read 1527797 spots for SRR18697334.sra Written 1527797 spots for SRR18697334.sra Read 1527797 spots for SRR18697334.sra Written 1527797 spots for SRR18697334.sra Read 1527797 spots for SRR18697334.sra Written 1527797 spots for SRR18697334.sra SRR ids: ['SRR18697334.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_inhd70kz SRR18697334.sra spots: 30555951 blocks: [[1, 1527797], [1527798, 3055594], [3055595, 4583391], [4583392, 6111188], [6111189, 7638985], [7638986, 9166782], [9166783, 10694579], [10694580, 12222376], [12222377, 13750173], [13750174, 15277970], [15277971, 16805767], [16805768, 18333564], [18333565, 19861361], [19861362, 21389158], [21389159, 22916955], [22916956, 24444752], [24444753, 25972549], [25972550, 27500346], [27500347, 29028143], [29028144, 30555951]] SRR18697334 file size 10302869 SRR18697334 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18697334 SRR18697334_1.fastq SRR18697334_2.fastq Input file: SRR18697334_1.fastq Paired file: SRR18697334_2.fastq trimmed: SRR18697334-trimmed-pair1.fastq, SRR18697334-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:05:32 2024 >> started Tue Dec 10 07:06:08 2024 >> done (35.756s) 30555951 read pairs processed; of these: 242 ( 0.00%) short read pairs filtered out after trimming by size control 77 ( 0.00%) empty read pairs filtered out after trimming by size control 30555632 (100.00%) read pairs available; of these: 399454 ( 1.31%) trimmed read pairs available after processing 30156178 (98.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 9 0.00% 20 13 0.00% 21 11 0.00% 22 13 0.00% 23 18 0.00% 24 9 0.00% 25 10 0.00% 26 12 0.00% 27 9 0.00% 28 11 0.00% 29 8 0.00% 30 40 0.00% 31 12 0.00% 32 19 0.00% 33 22 0.00% 34 10 0.00% 35 17 0.00% 36 18 0.00% 37 20 0.00% 38 25 0.00% 39 29 0.00% 40 18 0.00% 41 28 0.00% 42 29 0.00% 43 27 0.00% 44 38 0.00% 45 30 0.00% 46 31 0.00% 47 34 0.00% 48 26 0.00% 49 34 0.00% 50 32 0.00% 51 31 0.00% 52 49 0.00% 53 49 0.00% 54 47 0.00% 55 54 0.00% 56 61 0.00% 57 54 0.00% 58 68 0.00% 59 56 0.00% 60 69 0.00% 61 60 0.00% 62 75 0.00% 63 94 0.00% 64 100 0.00% 65 85 0.00% 66 113 0.00% 67 119 0.00% 68 118 0.00% 69 129 0.00% 70 142 0.00% 71 165 0.00% 72 176 0.00% 73 195 0.00% 74 189 0.00% 75 215 0.00% 76 238 0.00% 77 241 0.00% 78 284 0.00% 79 276 0.00% 80 337 0.00% 81 365 0.00% 82 414 0.00% 83 401 0.00% 84 446 0.00% 85 520 0.00% 86 500 0.00% 87 539 0.00% 88 642 0.00% 89 712 0.00% 90 800 0.00% 91 811 0.00% 92 840 0.00% 93 1003 0.00% 94 1095 0.00% 95 1134 0.00% 96 1221 0.00% 97 1378 0.00% 98 1408 0.00% 99 1495 0.00% 100 1693 0.01% 101 1745 0.01% 102 1965 0.01% 103 2066 0.01% 104 2204 0.01% 105 2377 0.01% 106 2415 0.01% 107 2632 0.01% 108 2592 0.01% 109 2887 0.01% 110 3079 0.01% 111 3156 0.01% 112 3355 0.01% 113 3657 0.01% 114 3868 0.01% 115 4029 0.01% 116 4102 0.01% 117 4291 0.01% 118 4594 0.02% 119 4792 0.02% 120 5032 0.02% 121 5293 0.02% 122 5734 0.02% 123 5787 0.02% 124 5931 0.02% 125 6494 0.02% 126 6741 0.02% 127 7391 0.02% 128 7360 0.02% 129 7696 0.03% 130 8241 0.03% 131 8621 0.03% 132 8894 0.03% 133 9072 0.03% 134 9632 0.03% 135 9977 0.03% 136 10553 0.03% 137 10998 0.04% 138 11602 0.04% 139 12080 0.04% 140 12723 0.04% 141 13074 0.04% 142 13943 0.05% 143 14341 0.05% 144 14898 0.05% 145 15818 0.05% 146 16316 0.05% 147 17001 0.06% 148 17709 0.06% 149 18720 0.06% 150 30156178 98.69% 30555632 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.66 fanout-score-rank=32 prefix-density=0.19 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=210.50 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=17.7 sequence=GCAGCAGCAGACTACGACGAAGACGAAGACGACTCGGATCACTAATCCATGGCGATGGCAATGCAGCAAGCTCCCCGGCACAGCATCTACCAGGGGAGGATCTTCCAGCGCTGGTTGTCGCCCTCGCACCACTTCCAGAGCACGACCTCGGTGCCGTCATGGACGCCGCCGTGGGCCTTGTCGCCATGGAAGGCGTCGAAGTTGAGGTAGATGTTGTTCACCATGCGCACGCACCTGAATCCCTTGCCAACGTCGCGGCTCTCCGTCC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=14.09 fanout-score-rank=11 prefix-density=0.40 prefix-fanout=8.5 sequence=AAGGAGCTGGAG criterion=fanout-score sequence-density=0.16 sequence-density-rank=8 fanout-score=212.01 fanout-score-rank=1 prefix-density=1.46 prefix-fanout=23.0 sequence=CGCCGCCGCCGC SRR18697334 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:06:57 Started mapping on | Dec 10 07:06:58 Finished on | Dec 10 07:09:25 Mapping speed, Million of reads per hour | 748.30 Number of input reads | 30555632 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 29627544 Uniquely mapped reads % | 96.96% Average mapped length | 298.38 Number of splices: Total | 29127803 Number of splices: Annotated (sjdb) | 27697014 Number of splices: GT/AG | 28750079 Number of splices: GC/AG | 316504 Number of splices: AT/AC | 21363 Number of splices: Non-canonical | 39857 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.60 Insertion rate per base | 0.01% Insertion average length | 3.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 559596 % of reads mapped to multiple loci | 1.83% Number of reads mapped to too many loci | 6994 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.94% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 368492 368492 368492 N_multimapping 559596 559596 559596 N_noFeature 366533 25852689 3093006 N_ambiguous 1139831 11550 83457 UnstrandedReadsAssigned:28121180 PositiveStrandReadsAssigned:3763305 NegativeStrandReadsAssigned:26451081 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR18697334 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18697334-trimmed-pair1.fastq SRR18697334-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,555,632 reads, 26,789,402 reads pseudoaligned [quant] estimated average fragment length: 258.742 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,148 rounds 52973 SRR18697334.ke.tsv 35125 SRR18697334.se.tsv 88098 total ==> SRR18697334.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 678.581 76.9847 4.99417 PNS24247 1044 786.258 30.2034 1.69103 PNS24249 1928 1670.26 333.595 8.79221 PNS24246 1044 786.258 30.2034 1.69103 PNS24248 1044 786.258 30.2034 1.69103 PNS24244 1471 1213.26 14.8096 0.537342 PNS24243 293 57.7391 0 0 KQK14069 1603 1345.26 1642.04 53.7328 KQK14071 474 218.718 30.3477 6.10804 ==> SRR18697334.se.tsv <== BRADI_1g14170v3 1681 BRADI_1g53295v3 16 BRADI_1g59795v3 99 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 2027 BRADI_1g74790v3 124 BRADI_1g09890v3 41 BRADI_1g77505v3 547 BRADI_1g48960v3 2 SRR18697334 completed mapping pipeline successfully