Starting /dee2/code/volunteer_pipeline.sh SRR18697335 current disk space = 1526092840960 free memory = 1601713256 SRR18697335 SRAfilesize ac23d0539d5c3e1a765d95046dd9a24f SRR18697335.sra SRR18697335.sra file validated SRR18697335 is paired end SRR18697335 is conventional basespace SRR18697335 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18697335_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.375 37.0 37.0 37.0 37.0 37.0 2 36.328 37.0 37.0 37.0 37.0 37.0 3 36.366 37.0 37.0 37.0 37.0 37.0 4 36.391 37.0 37.0 37.0 37.0 37.0 5 36.418 37.0 37.0 37.0 37.0 37.0 6 36.3715 37.0 37.0 37.0 37.0 37.0 7 36.383 37.0 37.0 37.0 37.0 37.0 8 36.4915 37.0 37.0 37.0 37.0 37.0 9 36.4545 37.0 37.0 37.0 37.0 37.0 10-14 36.465 37.0 37.0 37.0 37.0 37.0 15-19 36.4286 37.0 37.0 37.0 37.0 37.0 20-24 36.4028 37.0 37.0 37.0 37.0 37.0 25-29 36.30460000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.28190000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.041199999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.273 37.0 37.0 37.0 37.0 37.0 45-49 36.2117 37.0 37.0 37.0 37.0 37.0 50-54 36.15599999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.1425 37.0 37.0 37.0 37.0 37.0 60-64 36.1589 37.0 37.0 37.0 37.0 37.0 65-69 36.0447 37.0 37.0 37.0 37.0 37.0 70-74 35.994 37.0 37.0 37.0 37.0 37.0 75-79 35.981399999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.9646 37.0 37.0 37.0 37.0 37.0 85-89 35.919399999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.8785 37.0 37.0 37.0 37.0 37.0 95-99 35.815799999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.898399999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.6281 37.0 37.0 37.0 37.0 37.0 110-114 35.4906 37.0 37.0 37.0 32.2 37.0 115-119 35.7586 37.0 37.0 37.0 37.0 37.0 120-124 35.6925 37.0 37.0 37.0 37.0 37.0 125-129 35.6459 37.0 37.0 37.0 37.0 37.0 130-134 35.5804 37.0 37.0 37.0 37.0 37.0 135-139 35.5588 37.0 37.0 37.0 37.0 37.0 140-144 35.464800000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.5589 37.0 37.0 37.0 37.0 37.0 150 35.5155 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 6.0 24 4.0 25 8.0 26 17.0 27 13.0 28 29.0 29 39.0 30 46.0 31 54.0 32 77.0 33 99.0 34 143.0 35 340.0 36 2739.0 37 385.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.7 9.950000000000001 12.45 48.9 2 24.9 14.649999999999999 33.074999999999996 27.375 3 22.3 15.325 22.875 39.5 4 28.375 20.275000000000002 19.7 31.65 5 28.325 24.15 21.775 25.75 6 24.275 30.475 21.65 23.599999999999998 7 20.075000000000003 21.475 34.875 23.575 8 20.575 22.225 29.475 27.725 9 22.15 21.075 31.05 25.724999999999998 10-14 24.765 25.230000000000004 23.035 26.97 15-19 25.19 23.535 23.735 27.54 20-24 25.36 24.08 23.119999999999997 27.439999999999998 25-29 25.41 24.03 22.735 27.825 30-34 25.759999999999998 23.085 22.905 28.249999999999996 35-39 25.77 23.655 22.785 27.79 40-44 26.169999999999998 23.330000000000002 22.675 27.825 45-49 25.595000000000002 23.29 22.71 28.405 50-54 25.724999999999998 23.365 22.7 28.21 55-59 25.35 23.25 22.785 28.615000000000002 60-64 26.525 23.1 22.264999999999997 28.110000000000003 65-69 26.31 23.04 22.27 28.38 70-74 26.790000000000003 22.275 22.09 28.845 75-79 26.779999999999998 22.41 22.384999999999998 28.425 80-84 27.13 22.665 21.745 28.46 85-89 26.584999999999997 22.634999999999998 22.62 28.16 90-94 26.805 22.53 22.575 28.09 95-99 27.27 23.150000000000002 21.64 27.939999999999998 100-104 27.76 21.925 21.89 28.425 105-109 27.255000000000003 21.89 22.405 28.449999999999996 110-114 27.384999999999998 22.915 21.33 28.37 115-119 27.139999999999997 22.53 21.990000000000002 28.34 120-124 27.105 22.18 22.0 28.715000000000003 125-129 27.425 21.9 21.759999999999998 28.915000000000003 130-134 27.74 21.395 22.134999999999998 28.73 135-139 27.02 22.134999999999998 21.845 28.999999999999996 140-144 27.685 22.045 21.645 28.625 145-149 28.08 21.775 21.805 28.34 150 27.450000000000003 22.75 20.575 29.225 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.5 28 2.0 29 2.5 30 3.5 31 5.5 32 9.5 33 9.0 34 16.5 35 30.5 36 38.0 37 46.5 38 54.5 39 68.5 40 93.0 41 112.0 42 128.5 43 141.0 44 135.5 45 122.5 46 120.5 47 131.0 48 150.0 49 137.5 50 123.0 51 132.5 52 113.0 53 111.0 54 108.5 55 90.5 56 84.0 57 81.0 58 92.0 59 87.0 60 83.5 61 92.0 62 86.5 63 82.0 64 90.5 65 97.5 66 91.5 67 92.0 68 93.5 69 83.5 70 77.0 71 75.5 72 69.0 73 57.0 74 54.5 75 48.5 76 37.5 77 27.5 78 18.5 79 15.0 80 13.0 81 8.0 82 4.5 83 6.0 84 3.0 85 2.0 86 2.0 87 0.5 88 0.5 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.38250908074882 79.975 2 9.611623358480022 17.2 3 0.866163732886281 2.325 4 0.13970382788488406 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.36250000000000004 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4625 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.4875 0.0 0.0 0.0 0.0 126-127 0.5125 0.0 0.0 0.0 0.0 128-129 0.5375000000000001 0.0 0.0 0.0 0.0 130-131 0.6 0.0 0.0 0.0 0.0 132-133 0.625 0.0 0.0 0.0 0.0 134-135 0.6875 0.0 0.0 0.0 0.0 136-137 0.8 0.0 0.0 0.0 0.0 138 0.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCTGAA 10 0.006973645 144.0 6 TCTTGCA 10 0.006973645 144.0 3 >>END_MODULE SRR18697335 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18697335_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 56 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.143 37.0 37.0 37.0 37.0 37.0 2 36.0525 37.0 37.0 37.0 37.0 37.0 3 36.1885 37.0 37.0 37.0 37.0 37.0 4 36.186 37.0 37.0 37.0 37.0 37.0 5 36.1955 37.0 37.0 37.0 37.0 37.0 6 36.014 37.0 37.0 37.0 37.0 37.0 7 36.168 37.0 37.0 37.0 37.0 37.0 8 36.3115 37.0 37.0 37.0 37.0 37.0 9 36.2165 37.0 37.0 37.0 37.0 37.0 10-14 36.233700000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.27139999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.2357 37.0 37.0 37.0 37.0 37.0 25-29 36.241 37.0 37.0 37.0 37.0 37.0 30-34 36.1349 37.0 37.0 37.0 37.0 37.0 35-39 36.0967 37.0 37.0 37.0 37.0 37.0 40-44 36.145799999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.0695 37.0 37.0 37.0 37.0 37.0 50-54 36.0559 37.0 37.0 37.0 37.0 37.0 55-59 36.0111 37.0 37.0 37.0 37.0 37.0 60-64 36.0143 37.0 37.0 37.0 37.0 37.0 65-69 35.999900000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.9486 37.0 37.0 37.0 37.0 37.0 75-79 35.9344 37.0 37.0 37.0 37.0 37.0 80-84 35.729499999999994 37.0 37.0 37.0 34.6 37.0 85-89 35.7108 37.0 37.0 37.0 37.0 37.0 90-94 35.83 37.0 37.0 37.0 37.0 37.0 95-99 35.8036 37.0 37.0 37.0 37.0 37.0 100-104 35.695100000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.7118 37.0 37.0 37.0 37.0 37.0 110-114 35.6291 37.0 37.0 37.0 37.0 37.0 115-119 35.7103 37.0 37.0 37.0 37.0 37.0 120-124 35.6037 37.0 37.0 37.0 37.0 37.0 125-129 35.5595 37.0 37.0 37.0 37.0 37.0 130-134 35.439299999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.4833 37.0 37.0 37.0 37.0 37.0 140-144 35.516200000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.50320000000001 37.0 37.0 37.0 34.6 37.0 150 35.2085 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 5.0 24 5.0 25 16.0 26 12.0 27 18.0 28 28.0 29 30.0 30 33.0 31 52.0 32 60.0 33 111.0 34 180.0 35 461.0 36 2741.0 37 247.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.4 17.65 10.9 41.05 2 28.499999999999996 26.525 26.05 18.925 3 23.849999999999998 26.55 18.95 30.65 4 28.349999999999998 29.2 16.55 25.900000000000002 5 29.025000000000002 28.7 18.975 23.3 6 23.625 32.35 19.2 24.825 7 24.975 17.075000000000003 30.45 27.500000000000004 8 23.35 21.875 23.45 31.324999999999996 9 26.450000000000003 20.525 24.325 28.7 10-14 27.97 23.845 19.905 28.28 15-19 27.765 22.66 21.525 28.050000000000004 20-24 27.87 23.549999999999997 20.62 27.96 25-29 27.36 22.705000000000002 21.32 28.615000000000002 30-34 28.29 23.385 21.21 27.115000000000002 35-39 27.82 23.26 21.27 27.650000000000002 40-44 28.13 22.21 21.435000000000002 28.225 45-49 27.810000000000002 22.470000000000002 21.85 27.87 50-54 28.68 22.335 21.755 27.229999999999997 55-59 28.555000000000003 22.165000000000003 20.93 28.349999999999998 60-64 28.38 22.42 21.52 27.68 65-69 28.765 22.155 21.82 27.26 70-74 28.52 21.61 21.735 28.134999999999998 75-79 28.735 22.06 21.92 27.284999999999997 80-84 28.794999999999998 22.285 21.029999999999998 27.889999999999997 85-89 29.15 21.87 21.135 27.845 90-94 28.025 22.08 21.790000000000003 28.105000000000004 95-99 29.115000000000002 22.555 20.77 27.560000000000002 100-104 29.215000000000003 21.740000000000002 21.54 27.505000000000003 105-109 29.049999999999997 21.634999999999998 21.65 27.665 110-114 28.144999999999996 22.195 21.9 27.76 115-119 28.715000000000003 21.47 21.955 27.860000000000003 120-124 28.794999999999998 22.0 21.834999999999997 27.37 125-129 28.925 22.24 21.825 27.01 130-134 29.175 21.795 22.025 27.005000000000003 135-139 28.439999999999998 22.915 21.685 26.96 140-144 29.17 22.505 21.65 26.674999999999997 145-149 28.265 22.395 21.7 27.639999999999997 150 29.475 23.3 21.3 25.924999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 1.5 28 1.0 29 1.0 30 0.5 31 1.5 32 3.5 33 4.0 34 10.0 35 15.0 36 16.5 37 23.0 38 42.5 39 57.0 40 65.5 41 76.5 42 87.5 43 106.5 44 118.5 45 119.0 46 119.5 47 120.0 48 136.0 49 135.0 50 115.5 51 123.5 52 130.5 53 112.5 54 99.0 55 104.0 56 110.5 57 102.0 58 101.5 59 102.0 60 96.0 61 104.0 62 101.0 63 108.5 64 121.0 65 118.5 66 107.0 67 104.0 68 108.0 69 93.5 70 94.0 71 88.5 72 63.0 73 61.5 74 62.5 75 57.0 76 44.0 77 29.5 78 24.0 79 18.5 80 13.0 81 8.5 82 4.5 83 1.0 84 1.0 85 2.0 86 1.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.5 #Duplication Level Percentage of deduplicated Percentage of total 1 89.3854748603352 80.0 2 9.636871508379889 17.25 3 0.8938547486033519 2.4 4 0.055865921787709494 0.2 5 0.0 0.0 6 0.027932960893854747 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAGCAAGCAAGCTAGCTAGCGAGCATCAATGGCGATGACCATGAGGAAG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0375 0.0 0.0 84-85 0.075 0.0 0.075 0.0 0.0 86-87 0.075 0.0 0.075 0.0 0.0 88-89 0.075 0.0 0.075 0.0 0.0 90-91 0.075 0.0 0.075 0.0 0.0 92-93 0.075 0.0 0.075 0.0 0.0 94-95 0.075 0.0 0.075 0.0 0.0 96-97 0.1375 0.0 0.075 0.0 0.0 98-99 0.15 0.0 0.075 0.0 0.0 100-101 0.15 0.0 0.075 0.0 0.0 102-103 0.16249999999999998 0.0 0.075 0.0 0.0 104-105 0.2 0.0 0.075 0.0 0.0 106-107 0.21250000000000002 0.0 0.075 0.0 0.0 108-109 0.25 0.0 0.075 0.0 0.0 110-111 0.275 0.0 0.075 0.0 0.0 112-113 0.275 0.0 0.075 0.0 0.0 114-115 0.3125 0.0 0.075 0.0 0.0 116-117 0.35 0.0 0.075 0.0 0.0 118-119 0.35 0.0 0.075 0.0 0.0 120-121 0.4125 0.0 0.075 0.0 0.0 122-123 0.425 0.0 0.075 0.0 0.0 124-125 0.4375 0.0 0.075 0.0 0.0 126-127 0.4625 0.0 0.075 0.0 0.0 128-129 0.4875 0.0 0.075 0.0 0.0 130-131 0.55 0.0 0.075 0.0 0.0 132-133 0.575 0.0 0.075 0.0 0.0 134-135 0.6125 0.0 0.075 0.0 0.0 136-137 0.725 0.0 0.075 0.0 0.0 138 0.775 0.0 0.075 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTTGCA 10 0.006973645 144.0 4 >>END_MODULE Read 1880635 spots for SRR18697335.sra Written 1880635 spots for SRR18697335.sra Read 1880635 spots for SRR18697335.sra Written 1880635 spots for SRR18697335.sra Read 1880635 spots for SRR18697335.sra Written 1880635 spots for SRR18697335.sra Read 1880635 spots for SRR18697335.sra Written 1880635 spots for SRR18697335.sra Read 1880635 spots for SRR18697335.sra Written 1880635 spots for SRR18697335.sra Read 1880635 spots for SRR18697335.sra Written 1880635 spots for SRR18697335.sra Read 1880635 spots for SRR18697335.sra Written 1880635 spots for SRR18697335.sra Read 1880635 spots for SRR18697335.sra Written 1880635 spots for SRR18697335.sra Read 1880635 spots for SRR18697335.sra Written 1880635 spots for SRR18697335.sra Read 1880635 spots for SRR18697335.sra Written 1880635 spots for SRR18697335.sra Read 1880635 spots for SRR18697335.sra Written 1880635 spots for SRR18697335.sra Read 1880635 spots for SRR18697335.sra Written 1880635 spots for SRR18697335.sra Read 1880635 spots for SRR18697335.sra Written 1880635 spots for SRR18697335.sra Read 1880635 spots for SRR18697335.sra Written 1880635 spots for SRR18697335.sra Read 1880635 spots for SRR18697335.sra Written 1880635 spots for SRR18697335.sra Read 1880635 spots for SRR18697335.sra Written 1880635 spots for SRR18697335.sra Read 1880636 spots for SRR18697335.sra Written 1880636 spots for SRR18697335.sra Read 1880635 spots for SRR18697335.sra Written 1880635 spots for SRR18697335.sra Read 1880635 spots for SRR18697335.sra Written 1880635 spots for SRR18697335.sra Read 1880635 spots for SRR18697335.sra Written 1880635 spots for SRR18697335.sra SRR ids: ['SRR18697335.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2thttjk7 SRR18697335.sra spots: 37612701 blocks: [[1, 1880635], [1880636, 3761270], [3761271, 5641905], [5641906, 7522540], [7522541, 9403175], [9403176, 11283810], [11283811, 13164445], [13164446, 15045080], [15045081, 16925715], [16925716, 18806350], [18806351, 20686985], [20686986, 22567620], [22567621, 24448255], [24448256, 26328890], [26328891, 28209525], [28209526, 30090160], [30090161, 31970795], [31970796, 33851430], [33851431, 35732065], [35732066, 37612701]] SRR18697335 file size 12687278 SRR18697335 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18697335 SRR18697335_1.fastq SRR18697335_2.fastq Input file: SRR18697335_1.fastq Paired file: SRR18697335_2.fastq trimmed: SRR18697335-trimmed-pair1.fastq, SRR18697335-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:08:53 2024 >> started Tue Dec 10 07:09:50 2024 >> done (56.915s) 37612701 read pairs processed; of these: 215 ( 0.00%) short read pairs filtered out after trimming by size control 172 ( 0.00%) empty read pairs filtered out after trimming by size control 37612314 (100.00%) read pairs available; of these: 448018 ( 1.19%) trimmed read pairs available after processing 37164296 (98.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 16 0.00% 20 14 0.00% 21 11 0.00% 22 17 0.00% 23 22 0.00% 24 12 0.00% 25 9 0.00% 26 11 0.00% 27 14 0.00% 28 15 0.00% 29 20 0.00% 30 74 0.00% 31 24 0.00% 32 20 0.00% 33 23 0.00% 34 20 0.00% 35 23 0.00% 36 18 0.00% 37 20 0.00% 38 28 0.00% 39 27 0.00% 40 30 0.00% 41 33 0.00% 42 27 0.00% 43 34 0.00% 44 38 0.00% 45 37 0.00% 46 45 0.00% 47 48 0.00% 48 42 0.00% 49 37 0.00% 50 48 0.00% 51 57 0.00% 52 51 0.00% 53 49 0.00% 54 72 0.00% 55 68 0.00% 56 73 0.00% 57 68 0.00% 58 73 0.00% 59 76 0.00% 60 74 0.00% 61 82 0.00% 62 93 0.00% 63 125 0.00% 64 109 0.00% 65 127 0.00% 66 128 0.00% 67 165 0.00% 68 130 0.00% 69 160 0.00% 70 179 0.00% 71 174 0.00% 72 183 0.00% 73 224 0.00% 74 215 0.00% 75 261 0.00% 76 265 0.00% 77 280 0.00% 78 305 0.00% 79 341 0.00% 80 357 0.00% 81 419 0.00% 82 494 0.00% 83 472 0.00% 84 494 0.00% 85 531 0.00% 86 599 0.00% 87 664 0.00% 88 724 0.00% 89 807 0.00% 90 845 0.00% 91 1021 0.00% 92 1048 0.00% 93 1050 0.00% 94 1226 0.00% 95 1156 0.00% 96 1256 0.00% 97 1409 0.00% 98 1554 0.00% 99 1705 0.00% 100 1780 0.00% 101 1885 0.01% 102 2102 0.01% 103 2336 0.01% 104 2167 0.01% 105 2481 0.01% 106 2715 0.01% 107 2779 0.01% 108 2997 0.01% 109 3248 0.01% 110 3349 0.01% 111 3503 0.01% 112 3851 0.01% 113 3861 0.01% 114 4192 0.01% 115 4497 0.01% 116 4495 0.01% 117 4770 0.01% 118 5110 0.01% 119 5274 0.01% 120 5450 0.01% 121 5967 0.02% 122 6278 0.02% 123 6333 0.02% 124 6823 0.02% 125 7373 0.02% 126 7483 0.02% 127 8055 0.02% 128 8274 0.02% 129 8847 0.02% 130 9363 0.02% 131 9597 0.03% 132 9973 0.03% 133 10359 0.03% 134 10731 0.03% 135 11172 0.03% 136 11807 0.03% 137 12545 0.03% 138 12890 0.03% 139 13792 0.04% 140 14165 0.04% 141 14690 0.04% 142 15629 0.04% 143 16386 0.04% 144 16859 0.04% 145 17396 0.05% 146 18563 0.05% 147 19222 0.05% 148 20538 0.05% 149 21161 0.06% 150 37164296 98.81% 37612314 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=16.08 fanout-score-rank=11 prefix-density=1.10 prefix-fanout=5.0 sequence=CTTGCCGTCGCC criterion=fanout-score sequence-density=0.11 sequence-density-rank=19 fanout-score=155.37 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=21.6 sequence=CAGCAGCAGCAGA criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=13.64 fanout-score-rank=12 prefix-density=0.44 prefix-fanout=8.4 sequence=AAGGAGCTGGAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=261.62 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=19.2 sequence=GGAGAAGAAGGGAAGCAATCGAGCGGATCACTTGCGGAAGCACTCGGCGGGGAAGCCTTTGGGGAAGCGCCAGCCGTCGGCGCAGTAGTTGTACGTCATGCAGGTGCGCTCGGCCCAGGCGACGGTGTCGAGGCCCTTGCCGTCGAGCTGCCTGTACATCCAGCCGTCGCTACCGGCGGGGCACGCCGAGGAGCCGCTGTTGCCGATGACGCAGGCGTTGGCGTAGTAGCCGCGGTAGTTGACGACGAAGGGCGCCTGGCTCCAGTCGATCTTGACGGCGCCGTGGCGGGTCGCCCAGTAGCTGCCGTCCCACAGCGTGAAGTACACCTTCATCGGCTGGCTGCTCGGGTACGGCAGGTCCGCGTACTTCCTGAACGTCCTCACCGGCACGTCGTCCACCTGGAATATGATGTTCGTGGGGTTCCAGACGATCTTGTAGGTGTGGAAGTCGGCGGAGGGGTCGAACCAGAGGTAGAACTGGTGCTCCTTCTTGCCGTCGC SRR18697335 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:10:55 Started mapping on | Dec 10 07:10:55 Finished on | Dec 10 07:13:59 Mapping speed, Million of reads per hour | 735.89 Number of input reads | 37612314 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 35780977 Uniquely mapped reads % | 95.13% Average mapped length | 298.45 Number of splices: Total | 31645978 Number of splices: Annotated (sjdb) | 29988259 Number of splices: GT/AG | 31192148 Number of splices: GC/AG | 352012 Number of splices: AT/AC | 22180 Number of splices: Non-canonical | 79638 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.59 Insertion rate per base | 0.01% Insertion average length | 2.94 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1258497 % of reads mapped to multiple loci | 3.35% Number of reads mapped to too many loci | 15212 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.03% % of reads unmapped: other | 0.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 572840 572840 572840 N_multimapping 1258497 1258497 1258497 N_noFeature 454436 31133646 4223130 N_ambiguous 1017364 24900 136895 UnstrandedReadsAssigned:34309177 PositiveStrandReadsAssigned:4622431 NegativeStrandReadsAssigned:31420952 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR18697335 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18697335-trimmed-pair1.fastq SRR18697335-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,612,314 reads, 32,319,458 reads pseudoaligned [quant] estimated average fragment length: 257.977 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52973 SRR18697335.ke.tsv 35125 SRR18697335.se.tsv 88098 total ==> SRR18697335.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 679.291 137.05 6.85474 PNS24247 1044 787.023 20.5204 0.885862 PNS24249 1928 1671.02 451.319 9.1763 PNS24246 1044 787.023 20.5204 0.885862 PNS24248 1044 787.023 20.5204 0.885862 PNS24244 1471 1214.02 22.0697 0.617641 PNS24243 293 57.1562 1 0.594434 KQK14069 1603 1346.02 4773.39 120.487 KQK14071 474 219.342 17.6265 2.73029 ==> SRR18697335.se.tsv <== BRADI_1g14170v3 4796 BRADI_1g53295v3 28 BRADI_1g59795v3 65 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 1494 BRADI_1g74790v3 104 BRADI_1g09890v3 69 BRADI_1g77505v3 600 BRADI_1g48960v3 3 SRR18697335 completed mapping pipeline successfully