Starting /dee2/code/volunteer_pipeline.sh SRR18697336 current disk space = 1526092840960 free memory = 1556092204 SRR18697336 SRAfilesize 7c652bc6a43f037b1df68fc4fadd811f SRR18697336.sra SRR18697336.sra file validated SRR18697336 is paired end SRR18697336 is conventional basespace SRR18697336 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18697336_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.222 37.0 37.0 37.0 37.0 37.0 2 36.1785 37.0 37.0 37.0 37.0 37.0 3 36.2985 37.0 37.0 37.0 37.0 37.0 4 36.4935 37.0 37.0 37.0 37.0 37.0 5 36.4505 37.0 37.0 37.0 37.0 37.0 6 36.396 37.0 37.0 37.0 37.0 37.0 7 36.3835 37.0 37.0 37.0 37.0 37.0 8 36.454 37.0 37.0 37.0 37.0 37.0 9 36.404 37.0 37.0 37.0 37.0 37.0 10-14 36.4017 37.0 37.0 37.0 37.0 37.0 15-19 36.3756 37.0 37.0 37.0 37.0 37.0 20-24 36.342200000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.269400000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.2216 37.0 37.0 37.0 37.0 37.0 35-39 35.9839 37.0 37.0 37.0 37.0 37.0 40-44 36.1879 37.0 37.0 37.0 37.0 37.0 45-49 36.1985 37.0 37.0 37.0 37.0 37.0 50-54 36.1277 37.0 37.0 37.0 37.0 37.0 55-59 36.094199999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.0225 37.0 37.0 37.0 37.0 37.0 65-69 36.002 37.0 37.0 37.0 37.0 37.0 70-74 35.953799999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.8744 37.0 37.0 37.0 37.0 37.0 80-84 35.9349 37.0 37.0 37.0 37.0 37.0 85-89 35.869600000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.777499999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.746599999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.8584 37.0 37.0 37.0 37.0 37.0 105-109 35.5816 37.0 37.0 37.0 37.0 37.0 110-114 35.42550000000001 37.0 37.0 37.0 32.2 37.0 115-119 35.7364 37.0 37.0 37.0 37.0 37.0 120-124 35.5863 37.0 37.0 37.0 37.0 37.0 125-129 35.5082 37.0 37.0 37.0 37.0 37.0 130-134 35.514199999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.4841 37.0 37.0 37.0 37.0 37.0 140-144 35.4579 37.0 37.0 37.0 34.6 37.0 145-149 35.447900000000004 37.0 37.0 37.0 37.0 37.0 150 35.433 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 3.0 24 4.0 25 8.0 26 17.0 27 18.0 28 27.0 29 51.0 30 44.0 31 73.0 32 84.0 33 117.0 34 139.0 35 332.0 36 2664.0 37 417.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.475 9.325 13.375 47.825 2 26.450000000000003 13.700000000000001 33.175 26.674999999999997 3 23.1 15.8 22.1 39.0 4 29.5 22.025 17.7 30.775000000000002 5 28.225 25.775 23.05 22.95 6 25.275 29.7 23.35 21.675 7 22.925 20.125 35.075 21.875 8 20.349999999999998 22.45 30.2 27.0 9 21.65 21.675 32.175 24.5 10-14 24.565 25.665 23.36 26.41 15-19 25.505 23.585 23.44 27.47 20-24 25.205 24.42 22.71 27.665 25-29 25.755 24.795 22.1 27.35 30-34 25.264999999999997 24.015 23.169999999999998 27.55 35-39 25.295 24.385 23.150000000000002 27.169999999999998 40-44 26.290000000000003 23.674999999999997 22.759999999999998 27.275 45-49 25.545 23.645 23.1 27.71 50-54 26.584999999999997 22.925 23.155 27.334999999999997 55-59 26.200000000000003 23.565 22.53 27.705000000000002 60-64 26.31 23.225 22.505 27.96 65-69 26.63 23.265 21.965 28.139999999999997 70-74 26.71 22.189999999999998 23.255 27.845 75-79 27.034999999999997 22.49 22.84 27.634999999999998 80-84 26.11 23.055 22.495 28.34 85-89 26.86 22.645 22.18 28.315 90-94 26.529999999999998 22.98 22.085 28.405 95-99 26.595000000000002 22.58 22.45 28.375 100-104 26.85 22.285 22.31 28.555000000000003 105-109 27.075 22.759999999999998 22.075 28.09 110-114 27.075 22.439999999999998 22.425 28.060000000000002 115-119 27.395000000000003 22.35 22.3 27.955000000000002 120-124 27.02 22.259999999999998 22.015 28.705000000000002 125-129 26.99 21.86 23.035 28.115000000000002 130-134 27.775 21.78 22.14 28.305000000000003 135-139 27.62 22.395 21.245 28.74 140-144 27.67 22.07 21.87 28.389999999999997 145-149 27.71 22.205 21.805 28.28 150 26.85 23.200000000000003 21.075 28.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 0.0 26 0.5 27 6.0 28 6.5 29 2.0 30 7.0 31 8.0 32 9.0 33 15.0 34 19.5 35 26.5 36 37.0 37 51.5 38 56.0 39 65.5 40 81.0 41 108.0 42 125.0 43 129.5 44 136.0 45 142.0 46 147.0 47 133.0 48 140.5 49 148.0 50 128.5 51 125.0 52 129.5 53 118.5 54 113.5 55 112.0 56 99.5 57 83.5 58 74.5 59 75.0 60 86.5 61 85.5 62 79.5 63 83.0 64 84.5 65 94.0 66 95.0 67 84.0 68 73.0 69 78.0 70 74.0 71 62.5 72 63.0 73 52.0 74 47.0 75 43.0 76 33.5 77 31.0 78 26.5 79 19.5 80 14.0 81 11.5 82 8.0 83 4.0 84 3.0 85 1.0 86 0.0 87 0.5 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.92785793562707 81.025 2 9.211986681465039 16.6 3 0.804661487236404 2.175 4 0.05549389567147614 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.05 0.0 0.0 54-55 0.0 0.0 0.05 0.0 0.0 56-57 0.0 0.0 0.05 0.0 0.0 58-59 0.0 0.0 0.05 0.0 0.0 60-61 0.0 0.0 0.05 0.0 0.0 62-63 0.0 0.0 0.05 0.0 0.0 64-65 0.0 0.0 0.05 0.0 0.0 66-67 0.0 0.0 0.05 0.0 0.0 68-69 0.0 0.0 0.05 0.0 0.0 70-71 0.0 0.0 0.05 0.0 0.0 72-73 0.0 0.0 0.05 0.0 0.0 74-75 0.025 0.0 0.05 0.0 0.0 76-77 0.025 0.0 0.05 0.0 0.0 78-79 0.025 0.0 0.05 0.0 0.0 80-81 0.025 0.0 0.05 0.0 0.0 82-83 0.025 0.0 0.05 0.0 0.0 84-85 0.025 0.0 0.05 0.0 0.0 86-87 0.037500000000000006 0.0 0.05 0.0 0.0 88-89 0.0625 0.0 0.05 0.0 0.0 90-91 0.075 0.0 0.05 0.0 0.0 92-93 0.075 0.0 0.05 0.0 0.0 94-95 0.0875 0.0 0.05 0.0 0.0 96-97 0.1 0.0 0.05 0.0 0.0 98-99 0.1 0.0 0.05 0.0 0.0 100-101 0.1 0.0 0.05 0.0 0.0 102-103 0.1 0.0 0.05 0.0 0.0 104-105 0.125 0.0 0.05 0.0 0.0 106-107 0.125 0.0 0.05 0.0 0.0 108-109 0.125 0.0 0.05 0.0 0.0 110-111 0.16249999999999998 0.0 0.05 0.0 0.0 112-113 0.175 0.0 0.05 0.0 0.0 114-115 0.175 0.0 0.05 0.0 0.0 116-117 0.2 0.0 0.05 0.0 0.0 118-119 0.225 0.0 0.05 0.0 0.0 120-121 0.25 0.0 0.05 0.0 0.0 122-123 0.275 0.0 0.05 0.0 0.0 124-125 0.3125 0.0 0.05 0.0 0.0 126-127 0.3625 0.0 0.05 0.0 0.0 128-129 0.42500000000000004 0.0 0.05 0.0 0.0 130-131 0.45 0.0 0.05 0.0 0.0 132-133 0.5 0.0 0.05 0.0 0.0 134-135 0.5874999999999999 0.0 0.05 0.0 0.0 136-137 0.725 0.0 0.05 0.0 0.0 138 0.775 0.0 0.05 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR18697336 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR18697336_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0925 37.0 37.0 37.0 37.0 37.0 2 36.2255 37.0 37.0 37.0 37.0 37.0 3 36.171 37.0 37.0 37.0 37.0 37.0 4 36.242 37.0 37.0 37.0 37.0 37.0 5 36.3105 37.0 37.0 37.0 37.0 37.0 6 36.2115 37.0 37.0 37.0 37.0 37.0 7 36.2705 37.0 37.0 37.0 37.0 37.0 8 36.3205 37.0 37.0 37.0 37.0 37.0 9 36.2055 37.0 37.0 37.0 37.0 37.0 10-14 36.2907 37.0 37.0 37.0 37.0 37.0 15-19 36.300200000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.2861 37.0 37.0 37.0 37.0 37.0 25-29 36.22430000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.2329 37.0 37.0 37.0 37.0 37.0 35-39 36.15260000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.2128 37.0 37.0 37.0 37.0 37.0 45-49 36.1712 37.0 37.0 37.0 37.0 37.0 50-54 36.1332 37.0 37.0 37.0 37.0 37.0 55-59 36.123799999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.122400000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.0698 37.0 37.0 37.0 37.0 37.0 70-74 36.0598 37.0 37.0 37.0 37.0 37.0 75-79 36.0336 37.0 37.0 37.0 37.0 37.0 80-84 35.8137 37.0 37.0 37.0 34.6 37.0 85-89 35.830499999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.970800000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.8763 37.0 37.0 37.0 37.0 37.0 100-104 35.908100000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.792699999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.839999999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.7812 37.0 37.0 37.0 37.0 37.0 120-124 35.6873 37.0 37.0 37.0 37.0 37.0 125-129 35.6872 37.0 37.0 37.0 37.0 37.0 130-134 35.6124 37.0 37.0 37.0 37.0 37.0 135-139 35.6143 37.0 37.0 37.0 37.0 37.0 140-144 35.6216 37.0 37.0 37.0 37.0 37.0 145-149 35.5949 37.0 37.0 37.0 37.0 37.0 150 35.479 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 5.0 23 5.0 24 9.0 25 13.0 26 13.0 27 21.0 28 13.0 29 22.0 30 35.0 31 52.0 32 58.0 33 88.0 34 153.0 35 403.0 36 2787.0 37 322.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.25 18.725 11.175 40.849999999999994 2 28.7 26.775 25.75 18.775 3 24.525 26.625 19.975 28.875 4 29.825000000000003 28.65 14.674999999999999 26.85 5 28.95 29.375 18.125 23.549999999999997 6 22.650000000000002 32.324999999999996 19.650000000000002 25.374999999999996 7 24.825 16.900000000000002 30.65 27.625 8 24.55 19.85 22.650000000000002 32.95 9 24.975 20.549999999999997 25.5 28.975 10-14 27.224999999999998 23.965 20.445 28.365000000000002 15-19 27.134999999999998 23.169999999999998 21.455 28.24 20-24 28.155 22.95 21.065 27.83 25-29 27.875 22.675 21.645 27.805000000000003 30-34 27.345000000000002 23.06 21.265 28.33 35-39 27.51 22.855 21.224999999999998 28.410000000000004 40-44 28.15 22.415 21.42 28.015 45-49 27.650000000000002 22.314999999999998 21.805 28.23 50-54 28.08 22.395 21.815 27.71 55-59 28.52 22.384999999999998 21.575 27.52 60-64 28.435 22.17 21.884999999999998 27.51 65-69 28.645 22.220000000000002 21.17 27.965 70-74 28.78 22.305 21.705 27.21 75-79 28.235 22.29 21.705 27.77 80-84 28.810000000000002 21.93 21.66 27.6 85-89 28.42 22.18 21.615000000000002 27.785 90-94 28.315 22.07 21.825 27.79 95-99 28.71 22.06 21.46 27.77 100-104 27.92 22.29 21.855 27.935 105-109 28.884999999999998 22.5 21.245 27.37 110-114 28.51 22.869999999999997 21.115000000000002 27.505000000000003 115-119 28.575 22.81 21.58 27.034999999999997 120-124 28.599999999999998 22.134999999999998 21.825 27.439999999999998 125-129 28.54 22.655 21.55 27.255000000000003 130-134 28.92 22.355 21.525 27.200000000000003 135-139 28.189999999999998 22.12 22.465 27.224999999999998 140-144 28.689999999999998 22.41 22.689999999999998 26.21 145-149 29.225 21.975 22.215 26.584999999999997 150 26.674999999999997 22.05 22.875 28.4 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 2.0 28 1.0 29 3.5 30 4.5 31 1.5 32 2.0 33 6.5 34 12.5 35 15.0 36 18.5 37 27.5 38 34.5 39 39.0 40 57.5 41 80.5 42 97.5 43 124.5 44 141.5 45 129.5 46 126.5 47 138.5 48 121.0 49 104.0 50 112.0 51 108.5 52 102.0 53 107.0 54 121.5 55 115.0 56 98.0 57 107.0 58 112.0 59 103.0 60 100.0 61 107.0 62 104.5 63 101.5 64 112.5 65 114.5 66 112.0 67 107.5 68 100.5 69 99.5 70 100.5 71 92.5 72 74.0 73 58.5 74 51.5 75 50.5 76 38.0 77 20.0 78 18.5 79 19.5 80 15.5 81 10.0 82 4.0 83 4.5 84 4.0 85 1.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.05 #Duplication Level Percentage of deduplicated Percentage of total 1 90.0610771793448 81.10000000000001 2 8.967240421987785 16.150000000000002 3 0.8328706274292059 2.25 4 0.13881177123820101 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.16249999999999998 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.25 0.0 0.0 0.0 0.0 122-123 0.275 0.0 0.0 0.0 0.0 124-125 0.32499999999999996 0.0 0.0 0.0 0.0 126-127 0.3875 0.0 0.0 0.0 0.0 128-129 0.44999999999999996 0.0 0.0 0.0 0.0 130-131 0.475 0.0 0.0 0.0 0.0 132-133 0.525 0.0 0.0 0.0 0.0 134-135 0.625 0.0 0.0 0.0 0.0 136-137 0.725 0.0 0.0 0.0 0.0 138 0.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACGATC 10 0.006973645 144.0 6 ACGATCT 10 0.006973645 144.0 7 >>END_MODULE Read 1872795 spots for SRR18697336.sra Written 1872795 spots for SRR18697336.sra Read 1872795 spots for SRR18697336.sra Written 1872795 spots for SRR18697336.sra Read 1872795 spots for SRR18697336.sra Written 1872795 spots for SRR18697336.sra Read 1872795 spots for SRR18697336.sra Written 1872795 spots for SRR18697336.sra Read 1872795 spots for SRR18697336.sra Written 1872795 spots for SRR18697336.sra Read 1872795 spots for SRR18697336.sra Written 1872795 spots for SRR18697336.sra Read 1872795 spots for SRR18697336.sra Written 1872795 spots for SRR18697336.sra Read 1872795 spots for SRR18697336.sra Written 1872795 spots for SRR18697336.sra Read 1872795 spots for SRR18697336.sra Written 1872795 spots for SRR18697336.sra Read 1872795 spots for SRR18697336.sra Written 1872795 spots for SRR18697336.sra Read 1872795 spots for SRR18697336.sra Written 1872795 spots for SRR18697336.sra Read 1872803 spots for SRR18697336.sra Written 1872803 spots for SRR18697336.sra Read 1872795 spots for SRR18697336.sra Written 1872795 spots for SRR18697336.sra Read 1872795 spots for SRR18697336.sra Written 1872795 spots for SRR18697336.sra Read 1872795 spots for SRR18697336.sra Written 1872795 spots for SRR18697336.sra Read 1872795 spots for SRR18697336.sra Written 1872795 spots for SRR18697336.sra Read 1872795 spots for SRR18697336.sra Written 1872795 spots for SRR18697336.sra Read 1872795 spots for SRR18697336.sra Written 1872795 spots for SRR18697336.sra Read 1872795 spots for SRR18697336.sra Written 1872795 spots for SRR18697336.sra Read 1872795 spots for SRR18697336.sra Written 1872795 spots for SRR18697336.sra SRR ids: ['SRR18697336.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zs2izgee SRR18697336.sra spots: 37455908 blocks: [[1, 1872795], [1872796, 3745590], [3745591, 5618385], [5618386, 7491180], [7491181, 9363975], [9363976, 11236770], [11236771, 13109565], [13109566, 14982360], [14982361, 16855155], [16855156, 18727950], [18727951, 20600745], [20600746, 22473540], [22473541, 24346335], [24346336, 26219130], [26219131, 28091925], [28091926, 29964720], [29964721, 31837515], [31837516, 33710310], [33710311, 35583105], [35583106, 37455908]] SRR18697336 file size 12634299 SRR18697336 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR18697336 SRR18697336_1.fastq SRR18697336_2.fastq Input file: SRR18697336_1.fastq Paired file: SRR18697336_2.fastq trimmed: SRR18697336-trimmed-pair1.fastq, SRR18697336-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:18:15 2024 >> started Tue Dec 10 07:19:00 2024 >> done (44.368s) 37455908 read pairs processed; of these: 139 ( 0.00%) short read pairs filtered out after trimming by size control 150 ( 0.00%) empty read pairs filtered out after trimming by size control 37455619 (100.00%) read pairs available; of these: 523933 ( 1.40%) trimmed read pairs available after processing 36931686 (98.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 12 0.00% 20 5 0.00% 21 17 0.00% 22 5 0.00% 23 12 0.00% 24 4 0.00% 25 14 0.00% 26 11 0.00% 27 11 0.00% 28 15 0.00% 29 15 0.00% 30 64 0.00% 31 30 0.00% 32 18 0.00% 33 22 0.00% 34 21 0.00% 35 24 0.00% 36 18 0.00% 37 18 0.00% 38 31 0.00% 39 25 0.00% 40 29 0.00% 41 22 0.00% 42 31 0.00% 43 32 0.00% 44 44 0.00% 45 30 0.00% 46 48 0.00% 47 40 0.00% 48 42 0.00% 49 30 0.00% 50 54 0.00% 51 50 0.00% 52 44 0.00% 53 62 0.00% 54 59 0.00% 55 63 0.00% 56 65 0.00% 57 68 0.00% 58 85 0.00% 59 85 0.00% 60 80 0.00% 61 94 0.00% 62 120 0.00% 63 114 0.00% 64 99 0.00% 65 133 0.00% 66 131 0.00% 67 161 0.00% 68 155 0.00% 69 176 0.00% 70 171 0.00% 71 169 0.00% 72 191 0.00% 73 225 0.00% 74 222 0.00% 75 244 0.00% 76 312 0.00% 77 328 0.00% 78 334 0.00% 79 340 0.00% 80 386 0.00% 81 447 0.00% 82 510 0.00% 83 520 0.00% 84 583 0.00% 85 612 0.00% 86 724 0.00% 87 797 0.00% 88 769 0.00% 89 892 0.00% 90 1000 0.00% 91 998 0.00% 92 1144 0.00% 93 1228 0.00% 94 1349 0.00% 95 1478 0.00% 96 1547 0.00% 97 1723 0.00% 98 1836 0.00% 99 2041 0.01% 100 2126 0.01% 101 2316 0.01% 102 2425 0.01% 103 2598 0.01% 104 2760 0.01% 105 2956 0.01% 106 3155 0.01% 107 3317 0.01% 108 3403 0.01% 109 3665 0.01% 110 3884 0.01% 111 4247 0.01% 112 4365 0.01% 113 4556 0.01% 114 4826 0.01% 115 5068 0.01% 116 5539 0.01% 117 5564 0.01% 118 5789 0.02% 119 6418 0.02% 120 6367 0.02% 121 6836 0.02% 122 7395 0.02% 123 7569 0.02% 124 8086 0.02% 125 8279 0.02% 126 8955 0.02% 127 9483 0.03% 128 9678 0.03% 129 10174 0.03% 130 10798 0.03% 131 10725 0.03% 132 11463 0.03% 133 12141 0.03% 134 12663 0.03% 135 13059 0.03% 136 13899 0.04% 137 14700 0.04% 138 15244 0.04% 139 16385 0.04% 140 16605 0.04% 141 17472 0.05% 142 18326 0.05% 143 18771 0.05% 144 19687 0.05% 145 20889 0.06% 146 21860 0.06% 147 22825 0.06% 148 24072 0.06% 149 24787 0.07% 150 36931686 98.60% 37455619 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=4.97 fanout-score-rank=21 prefix-density=0.34 prefix-fanout=4.3 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.13 sequence-density-rank=16 fanout-score=152.03 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=22.9 sequence=CGCCGCCGCCGA criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=9.78 fanout-score-rank=13 prefix-density=0.46 prefix-fanout=6.4 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTA criterion=fanout-score sequence-density=0.16 sequence-density-rank=14 fanout-score=213.20 fanout-score-rank=1 prefix-density=1.50 prefix-fanout=23.2 sequence=CGCCGCCGCCATCCCCTCCAAGTGCGGCGTCAGCATCCCTTACACCATCAGCCCCTCCGTCGACTGCTCCAGGGTCAACTAGAGAGATCGAGAGATCGGCCGTCTTCTCCGGCTCCGGCGCCGGCGGGCGGCGGCCATGGACGTACTGGAGAGGGTGAGCATATATATTTATACGACGAATAAAAGGCTGCCACGTGGCGGGTAGCTGCCACGTAGATGCATGCATG SRR18697336 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:19:45 Started mapping on | Dec 10 07:19:45 Finished on | Dec 10 07:23:12 Mapping speed, Million of reads per hour | 651.40 Number of input reads | 37455619 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 36305037 Uniquely mapped reads % | 96.93% Average mapped length | 298.35 Number of splices: Total | 34253636 Number of splices: Annotated (sjdb) | 32193087 Number of splices: GT/AG | 33809070 Number of splices: GC/AG | 362112 Number of splices: AT/AC | 29278 Number of splices: Non-canonical | 53176 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.56 Insertion rate per base | 0.01% Insertion average length | 2.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 442027 % of reads mapped to multiple loci | 1.18% Number of reads mapped to too many loci | 12773 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.20% % of reads unmapped: other | 0.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 708555 708555 708555 N_multimapping 442027 442027 442027 N_noFeature 703987 31134188 4582487 N_ambiguous 1462499 25807 149559 UnstrandedReadsAssigned:34138551 PositiveStrandReadsAssigned:5145042 NegativeStrandReadsAssigned:31572991 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR18697336 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR18697336-trimmed-pair1.fastq SRR18697336-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 37,455,619 reads, 31,752,197 reads pseudoaligned [quant] estimated average fragment length: 255.173 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,052 rounds 52973 SRR18697336.ke.tsv 35125 SRR18697336.se.tsv 88098 total ==> SRR18697336.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 682.111 51.5147 2.42312 PNS24247 1044 789.827 40.1174 1.62967 PNS24249 1928 1673.83 484.843 9.29369 PNS24246 1044 789.827 40.1174 1.62967 PNS24248 1044 789.827 40.1174 1.62967 PNS24244 1471 1216.83 5.29033 0.139493 PNS24243 293 59.2195 0 0 KQK14069 1603 1348.83 6630.36 157.717 KQK14071 474 222.406 9.87807 1.42503 ==> SRR18697336.se.tsv <== BRADI_1g14170v3 6675 BRADI_1g53295v3 21 BRADI_1g59795v3 164 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 782 BRADI_1g74790v3 242 BRADI_1g09890v3 66 BRADI_1g77505v3 1377 BRADI_1g48960v3 0 SRR18697336 completed mapping pipeline successfully